Association of PPARγ2 polymorphisms with carcass and meat quality traits in a Pietrain x Jinhua F2 population.

The PPARγ2 gene is a key regulator of both proliferation and preadipocyte differentiation in mammals. Herein its genotype and allele frequencies were analyzed using PCR-SSCP in eight pig breeds (N = 416). Two kinds of polymorphisms of the PPARγ2 gene were detected, including a previously reported shift SNP A177G (Met59Val) in exon 1 and a novel silent mutation G876A in exon 5. The results revealed that European pig breeds carry a higher allele A frequency at the A177G locus and a fixed GG genotype at the G876A locus. Allele A at the G876A locus was only found in Jinhua pigs. The association between haplotype (A177G/G876A) and carcass and meat quality traits was analyzed in a Pietrain x Jinhua F2 population (N = 248). The PPARγ2 gene was found to be significantly associated with backfat thickness at the shoulder (p < 0.05), 6-7(th) ribs (p < 0.01), last rib (p < 0.01), gluteus medius (p <0.05) and ham weight (p < 0.01). Significant effects of different haplotypes on ham weight and backfat thickness at the 6-7(th) ribs, last rib, and gluteus medius were also observed.

Introduction

Genetic effects on porcine meat quality have historically been widely recognized and marker-assisted selection has been used by animal breeders to improve the quality and performance of livestock (Van der Steen ). Reducing body fat, increasing lean percentage, and improving meat quality are critical issues for the pig breeding industry. Thus, there is great interest in having comprehensive molecular marker information for improvement of domestic swine.

The peroxisome proliferator-activated receptor-γ (PPARγ) is a member of the nuclear hormone receptor superfamily. It exists as two distinct isoforms (γ1 and γ2) produced from a single gene sequence by alternative splicing, resulting in amino acid differences in the N-termini (Fajas ; Omi ). PPARγ1 is expressed in a variety of tissues at a relatively low level, while PPARγ2 is exclusively expressed in adipose tissue and at ten times higher transcriptional activity (Tontonoz ; Werman ). PPARγ2 is known as a key regulator of adipogenesis involved in the regulation of fatty acid uptake and storage (Rosen ). It participates in the transcriptional activation of several adipogenic transcription factors and lipogenic genes (Wu ; Pasceri ; Rosen ; Arimura ), and directs the differentiation of preadipocytes to adipocytes. Interestingly, overexpression of PPARγ2 in fibroblast cell lines using retroviral vectors efficiently converts them to adipocytes (Tontonoz ). Previous research also supported this view, indicating a dual role for PPARγ2 in the regulation of both proliferation and preadipocyte differentiation (Fajas ; Samulin ). Therefore, PPARγ2 appeared to be a promising candidate gene for improving carcass and meat quality traits. However, very little work has yet been conducted to investigate the role of the porcine PPARγ2 gene in carcass and meat quality.

Emnett found a signicant association between the PPARγ2 Met59Val polymorphism, meat quality and backfat thickness in Berkshire, Duroc, Hampshire and Landrace swine breeds, while Grindflek found a significant association between the Met59Val/A220G/G324A haplotype and ham weight in a Norwegian pig population, but they did not denote a major effect on backfat thickness.

The current study was designed to detect novel single nucleotide polymorphisms (SNPs) of the porcine PPARγ2 gene using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing, and to further investigate the relationship between these SNPs and carcass and meat quality in a Pietrain x Jinhua F2 crossbred population.

Material and Methods

Animal and data collection

The association between the SNPs and recorded traits were analyzed in a Pietrain x Jinhua F2 crossbred swine population. The Pietrain x Jinhua resource population was constructed from purebred Pietrain sires and Jinhua dams, including 6 F1 boars, 20 F1 sows and 248 F2 progeny. The 248 PJF2 offspring were raised under standard conditions at The Experimental Pig Farm of Zhejiang University and slaughtered at a commercial abattoir. In addition, DNA samples of eight pig breeds were collected, consisting of 96 Jinhua, 36 Jiaxing Black, 54 Bihu, 66 Shengxian Hua, 37 Landrace, 67 Yorkshire, 30 Duroc and 30 Pietrain pigs (Table 1). The sampled pigs were from sources that were unrelated throughout the last three generations.

Table 1

Genotype and allele frequencies of SNPs A177G and G876A in eight pig breeds.

Breed	N	SNP A177G genotype frequency			Allele frequency	χ2	SNP G876A genotype frequency			Allele frequency	χ2
		AA	AG	GG	A (%)		GG	GA	AA	G (%)
Jinhua	96	37	45	14	0.62	0.24	24	67	5	0.60	20.73**
Jiaxing Black	36	15	18	3	0.67	0.90	36	0	0	1.00	1
Bihu	54	16	36	2	0.63	11.48**	54	0	0	1.00	1
Shengxian Hua	66	8	44	14	0.45	8.57**	66	0	0	1.00	1
Pietrain	30	30	0	0	1.00	1	30	0	0	1.00	1
Landrace	37	24	11	2	0.80	0.14	37	0	0	1.00	1
Duroc	30	27	3	0	0.95	4.46*	30	0	0	1.00	1
Yorkshire	67	38	25	4	0.75	0.06	67	0	0	1.00	1

Source of breeds: Jinhua (Zhejiang Jiahua Pig Breeding Co., LTD), Jiaxing Black (Shuangqiao Pig Breeding Farm), Bihu (Lishui Pig Breeding Farm), Shengxian Hua (Shangyu Shenghua Pig Breeding Co., LTD), Yorkshire and Pietrain (The Experimental Pig Farm of Zhejiang University), Landrece (Zhejiang Dengta Pig Breeding Farm), Duroc (Xiaoshan Duroc Pig Breeding Farm).

genotype is fixed, the corresponding breed is not in Hardy-Weinberg equilibrium.

χ2 Test for Hardy-Weinberg equilibrium,

p <0.05,

p <0.01.

PJF2 animals were slaughtered (following electric shock) at 219 days of age (SD = 31.4 days, live weight 81.3 ± 10.58 kg). After slaughter, backfat thickness (BFT) was measured on the left side at four locations (shoulder, 6–7th ribs, last rib, and gluteus medius). At 45 min postmortem, muscle pH and temperature measurements were taken on the longissimus dorsi (LD) muscle using a Thermo Scientific Orion pH meter (Model 230A Plus, USA) and a digital thermometer (Ama-digit 14 TH 35° C-500 °C Amarell electronic, Kreuzwertheim, Germany), respectively. Loin eye area (LEA) of the LD muscle was traced on an acetate film between the 13/14th ribs and quantitated by planimetry. Samples of the longissimus dorsi muscle were taken at the 13th rib for the determination of water-holding capacity (WHC), intramuscular fat (IMF), protein (IMP) and water (IMW) content. WHC was determined with the filter paper press method (Wierbicki and Deatherage, 1958), while intramuscular fat, protein and water content were determined using a Meat Analyzer (Antaris II FT-NIR analyzer, Thermo Electric company, USA). Additionally, the ham was cut from the last lumbar vertebra and the feet were removed.

Primers, amplification conditions and PCR-SSCP analysis

Two pairs of primers were designed based on the porcine PPARγ2 gene mRNA sequence (GenBank, accession number NM_214379) and human PPARγ2 gene chromosomal sequence (GenBank, accession number NC_000003). For amplification of the PPARγ2 gene, the PPARγ2-P1 primer (5′ TGACACCGAGATGCCGTT 3′ and 5′ TGGAGCTTCAGGTCGTACTT 3′) were used. This primer combination generates a 204 base pair (bp) amplicon from exon 1. The second primer pair named PPARγ2-P2 (5′CTTGCAGCCATTTGTCATC3′ and 5′AGGGCTTTCTCAGGCTCTT3′) amplifies a 350 bp fragment from exon 5.

PCR amplifications were carried out in 25 μL reaction volumes containing at the following final concentrations: 50 ng of template DNA, 400 μM of dNTPs (Sangon, China), 0.25 μM of each primer and 1 unit (U) of Taq polymerase (TaKaRa, Japan). The PCR protocol consisted of an initial denaturation at 94 °C for 5 min, followed by 36 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for PPARγ2-P1 or 51 °C for PPARγ2-P2 for 30 s, and extension at 72 °C for 30 s, with a final extension at 72 °C for 10 min.

The porcine PPARγ2 alleles were detected using PCR-SSCP. A 5 μL aliquot of each amplicon was diluted in denaturing solution (98% formamide, 10 mM EDTA, 0.025% bromophenol blue, 0.025% xylene-cyanol) denatured at 95 °C for 5 min, rapidly cooled on ice and resolved in acrylamide:bisacrylamide (29:1) (Bio-Rad) gels at 400 V for 4 h at 4 °C, in 1 x TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0). The gels were silver-stained according to the method of Bassam .

Sequence analysis

Nucleotide sequence translation and comparisons were carried out using the DNAMAN software. The BLAST algorithm of NCBI was used to search homologous sequences in the NCBI GenBank database.

Statistical analysis

Linkage disequilibria between all pairs of biallelic loci were calculated using measures of Lewontin’s D’ and r (Pritchard and Przeworski, 2001) in the PJF2 population. Haplotypes were determined by the Linkage algorithm of the HaploView software (V 2.01). The genotype and allele distributions in purebreds were tested for Hardy-Weinberg equilibrium using the χ2 test.

For studying the association between the PPARγ2 gene haplotypes and recorded traits in the PJF2 crossbred animals, the following model was used: where Y is the observation of the trait; μ is the population mean; S is the fixed effect of sex; F is the fixed effect of the father; G is the fixed effect of the kth haplotype; l is the random effect of litter; β is the regression coefficient of the slaughter weight; X is the slaughter weight as covariate, and e is the random residual error. The least square means method of the GLM (General Linear Model) procedure (SPSS 16.0) was used for association analysis between the PPARγ2 haplotypes and recorded traits.

Results

Detection of single nucleotide polymorphisms

Two fragments, PPARγ2-P1 (204 bp) and PPARγ2-P2 (350 bp) were amplified from genomic DNA. These were then assayed by the SSCP technique and products with unique patterns were sequenced to detect any single base substitution. One substitution located in exon 1 at position 177 (c.+177 A > G, GenBank accession No. NM_214379) causes an amino acid change from methionine to valine (Met59Val). This SNP has already been described in previous studies (Emnett ; Grindflek ). The primer PPARγ2-P2 detected a novel polymorphism in exon 5 at position 876 (c.+876 G > A, GenBank accession No. NM_214379) of the porcine PPARγ2 gene. This SNP represents a silent mutation.

Genotype frequencies in different pig populations

The combined effects of the exon 1 and exon 5 substitutions were estimated as haplotype substitution effects. Genotype and allele frequencies of the SNPs A177G and G876A within pure breeds are shown in Table 1.

At A177G, allele A had a high frequency (> 75%) in European pig breeds, especially fixed in Pietrain swine, and a relatively lower frequency in Chinese native breeds (< 67%). In Jinhua, Jiaxing Black, Landrace and Yorkshire breeds, the alleles were at Hardy-Weinberg equilibrium. Interestingly, at G876A, allele A was found only in Jinhua pigs, whereas allele G was fixed in all other breeds. Therefore, allele A appears to be Jinhua-specific, and, consequently, the breeds were not at Hardy-Weinberg equilibrium with respect to this marker.

Haplotype analysis

Four haplotypes, H1 (A-G), H2 (A-A), H3 (G-G), and H4 (G-A), were found in PJF2 animals and had their frequencies and linkage disequilibria estimated (Table 2). Of the four types, the A-G haplotype (H1) was found to represent the majority. Linkage analysis indicated that there were certain linkage disequilibria between the two SNPs A177G and G876A (D’ = 0.504).

Table 2

Haplotype frequency and linkage disequilibrium in a Pietrain x Jinhua F2 (PJF2) population.

Haplotype	Frequency
A-G	0.671
A-A	0.093
G-G	0.147
G-A	0.089
D’	0.504
r2	0.249

Relationship between PPARγ2 gene haplotypes and recorded traits

The results of the association analysis of PPARγ2 gene haplotypes and recorded carcass and meat traits within the PJF2 population are shown in Table 3. PPARγ2 gene haplotypes were found to be significantly associated with BFT at the shoulder and gluteus medius (p = 0.029 and 0.042, respectively), with significant effects observed on ham weight and BFT at the 6–7th ribs and last rib (p = 0.000, 0.003, and 0.003, respectively). Pigs with the H1H3 genotype had lower ham weight compared to the other genotypes (p < 0.01). H2H3 genotype pigs had higher BFT at the 6–7th ribs, last rib and gluteus medius (p < 0.01), while for BFT at the shoulder, the H2H3 genotype had relatively higher thickness, just slightly lower than that of the H1H3 genotype.

Table 3

Association of haplotypes with recorded traits.

Traits	Haplotypes (Least square means ± standard deviation)					p-value
	H1H1 (n = 122)	H1H2 (n = 45)	H1H3 (n = 5)	H2H3 (n = 40)	H3H4 (n = 36)
BFT at shoulder (cm)	4.270 ± 0.883	4.249 ± 0.935	4.720 ± 0.311	4.569 ± 0.809	4.534 ± 0.867	0.029
BFT at 6–7th ribs (cm)	2.964B± 0.772	3.019AB± 0.832	3.260AB± 0.261	3.518A± 0.637	3.322AB± 0.775	0.003
BFT at last rib (cm)	2.126B± 0.578	2.233AB± 0.864	2.560A± 0.230	2.562A± 0.672	2.377AB± 0.694	0.003
BFT at gluteus medius (cm)	2.170B± 0.624	2.130AB± 0.836	2.260AB± 0.207	2.540A± 0.714	2.330AB± 0.578	0.042
Protein content (%)	23.968 ± 0.921	24.233 ± 0.865	23.845 ± 0.408	24.401 ± 0.817	24.243 ± 0.693	0.962
Water content (%)	73.700 ± 1.439	73.514 ± 1.143	74.209 ± 0.672	72.851 ± 1.785	73.813 ± 1.204	0.984
Intramuscular fat content (%)	2.724 ± 1.259	2.544 ± 0.796	2.267 ± 0.349	3.012 ± 1.650	2.365 ± 0.983	0.977
Water-holding capacity	0.424 ± 0.095	0.435 ± 0.081	0.408 ± 0.117	0.420 ± 0.108	0.418 ± 0.153	0.813
Loin eye area (cm2)	32.993 ± 6.329	32.217 ± 5.971	32.220 ± 4.894	30.537 ± 5.629	31.723 ± 5.924	0.148
LD pH	6.2495 ± 0.344	6.2379 ± 0.289	6.2180 ± 0.135	6.1545 ± 0.410	6.2351 ± 0.288	0.601
LD temperature (°C)	38.699 ± 1.422	38.633 ± 1.579	38.170 ± 1.058	38.810 ± 1.604	38.346 ± 1.488	0.507
Ham weight (kg)	7.541B± 1.021	7.528B± 1.149	6.680A± 2.442	7.671B± 0.852	7.569B± 0.986	0.000

Means with different superscripts A and B are statistically different at p <0.01.

Discussion

The Jinhua and Pietrain breeds are significantly different in carcass and meat quality phenotypes. As a Chinese domesticated breed, the Jinhua pig has a reputation for its thin skin, fine bones and tender meat, but has higher BFT and IMF content than other breeds. In contrast, the Pietrain type, which has a relatively lower BFT and IMF content, is famous for its high quality and high proportion of lean meat vs. fat content, and has been used worldwide as a sire breed. Observed differences in carcass and meat quality phenotypes are probably related to protein accretion and lipid synthesis (Renaudeau and Mourot, 2007). In this regard, it has been suggested that certain genes may play important physiological roles in fat-related pathways (Agarwal and Garg, 2006). Therefore we hypothesized that fat-related genes that are at considerable linkage disequilibrium may produce distinct phenotypes in a Pietrain x Jinhua F2 (PJF2) population. In this study, we found that genotype and allele frequencies for two analyzed polymorphisms differed between the Chinese native pig and the European pig, indicating that the two types of breeds had been subject to different genetic selection regimes.

Lai demonstrated that the region of the PPARγ2 promoter comprising nucleotide base pair positions −457 to +129 is essential for the CEBPD (CCAAT/Enhancer binding protein D) response which activates PPARγ2 transcription. They furthermore suggested that the A177G SNP might affect binding efficiency and thus the gene expression level at this site. Although the G876A SNP is a silent mutation, there is substantial evidence indicating that silent mutations may affect mRNA secondary structure and stability (Shen ; Duan ), mRNA decay rates, and ultimately lead to disease (Capon ).

The porcine PPARγ2 gene was mapped to chromosome 13 (Grindflek ) and found to be close to several quantitative trait loci (QTL) and candidate genes for birth weight, daily weight gain and BFT (Andersson ; Yu ; Evans ). Since it plays a key role in proliferation and preadipocyte differentiation, PPARγ2 is an excellent target for studying growth and fat deposition traits. Experiments with homologous PPARγ2-deficient mice showed that genetic ablation of PPARγ2 decreased adipose tissue expandability and the capacity for buffering toxic lipids in peripheral organs (Medina-Gomez ). In humans, several SNPs within the PPARγ2 locus (Pro12Ala, C1431T, C2821T, A2819G) have been identified in different populations, and their alleles demonstrated to be associated with obesity, type 2 diabetes, increased insulin sensitivity and decreased receptor activity (Deeb ; González Sánchez ; Meirhaeghe and Amouyel, 2004; Costa ).

A total of five mutations have previously been identified in the porcine PPARγ2 gene promoter and coding regions, these being A177G (M59V), G78A, A42G, A220G and G324A (Emnett ; Grindflek ). In our study we identified a novel Jinhua-specific SNP (A876G), as well as the previously reported A177G (M59V) polymorphism, and investigated haplotype effects in a PJF2 population.

Haplotypes can be used to correlate a specific phenotype with a specific gene in a small sample population (Drysdale ) and can provide more information on the complex relationship between DNA variation and phenotype than single SNPs may afford (Stephens ). Thus, we used haplotype information to evaluate the relationship between PPARγ2 polymorphisms and candidate traits in swine. Our results showed significant effects on ham weight (p < 0.01), consistent with previous results obtained by Grindflek . We also found in the PJF2 population significant differences between the different haplotypes with respect to BFT at the 6–7th ribs (p < 0.01), the last rib (p < 0.01) and the gluteus medius (p < 0.01). No significant association was found between haplotypes and IMF.

Grant first reported that exposure to the PPARγ agonist troglitazone (TRO) resulted in a 6.4-fold increase in the percentage of differentiated subcutaneous preadipocytes compared to intramuscular preadipocytes, and they conjectured that inherent differences in the capacity for adipose differentiation may exist between bovine subcutaneous and intramuscular preadipocytes. Thus, PPARγ2 gene regulation is thought to favor subcutaneous fat deposition over intramuscular fat content.

The association observed in our study may arise from linkage between the PPARγ2 gene and specific polymorphisms that are in linkage disequilibrium and may be located in another region of the PPARγ2 gene, or by interaction with other quantitative trait loci. Furthermore, the linkage disequilibrium between A177G and G876A in the PJF2 population was unstable (r = 0.249). Consequently, additional studies are needed to better assess the real impact of the effects of the PPARγ2 gene on carcass and meat quality traits.