Literature DB >> 21156049

Identification and evaluation of the role of the manganese efflux protein in Deinococcus radiodurans.

Hongxing Sun1, Guangzhi Xu, Hongdan Zhan, Huan Chen, Zongtao Sun, Bing Tian, Yuejin Hua.   

Abstract

BACKGROUND: Deinococcus radiodurans accumulates high levels of manganese ions, and this is believed to be correlated with the radiation resistance ability of this microorganism. However, the maintenance of manganese ion homeostasis in D. radiodurans remains to be investigated.
RESULTS: In this study, we identified the manganese efflux protein (MntE) in D. radiodurans. The null mutant of mntE was more sensitive than the wild-type strain to manganese ions, and the growth of the mntE mutant was delayed in manganese-supplemented media. Furthermore, there was a substantial increase in the in vivo concentration of manganese ions. Consistent with these characteristics, the mntE mutant was more resistant to H2O2, ultraviolet rays, and γ-radiation. The intracellular protein oxidation (carbonylation) level of the mutant strain was remarkably lower than that of the wild-type strain.
CONCLUSIONS: Our results indicated that dr1236 is indeed a mntE homologue and is indispensable for maintaining manganese homeostasis in D. radiodurans. The data also provide additional evidence for the involvement of intracellular manganese ions in the radiation resistance of D. radiodurans.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 21156049      PMCID: PMC3016326          DOI: 10.1186/1471-2180-10-319

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Deinococcus radiodurans is an extreme bacterium known for its resistance to ionizing radiation (IR), ultraviolet (UV) radiation, oxidative stress, and desiccation [1,2]. It has been reported that D. radiodurans can recover from exposure to γ-radiation at 15 kGy, a dose lethal to most life forms. IR can directly damage biomacromolecules and can also produce reactive oxygen species (ROS) that can indirectly attack both proteins and DNA [3,4]. Therefore, cellular defense against ROS-induced protein and DNA damage is proposed to be important to the radiation resistance of D. radiodurans [5]. Manganese plays an important role in the antioxidant systems of bacteria and can relieve the phenotypic deficit of sod-null Escherichia coli [6]. Interestingly, Daly and coworkers found that the Mn/Fe ratio of most IR-resistant bacteria is higher than that of IR-sensitive bacteria. The group also found that D. radiodurans grown in manganese-deficient medium was relatively more sensitive to IR than the bacteria grown in manganese-containing medium, suggesting that the accumulation of intracellular manganese ions can protect proteins from ROS-induced damage and can help in the survival of D. radiodurans in extreme environments [5,7,8]. Although manganese can improve cellular ROS resistance, excess manganese is toxic to cells. Thus, maintenance of the intracellular Mn concentration homoeostasis is a challenge. In bacteria, two main classes of manganese transporters have been identified--Nramp H+-Mn2+ transporters and the ATP-binding cassette (ABC) Mn2+ permeases [9]. Recently, a manganese efflux system was identified in Streptococcus pneumoniae, and this was found to play important roles in host pathogenesis and H2O2 resistance [10]. Many genes involved in the maintenance of manganese ion homeostasis have been reported in D. radiodurans, such as dr1709, dr2523 [11], dr2539 [12], and dr0615 [13]. Therefore, it would be very interesting to determine whether D. radiodurans possesses a similar manganese efflux system. In this study, we identified a manganese efflux gene (dr1236) in D. radiodurans and demonstrated that it plays an important role in maintaining the homeostasis of intracellular Mn. The null mutant mntE- was highly sensitive to manganese ions. When the intracellular level of manganese ions was increased by mutating dr1236, the mutant showed clearly enhanced resistance to oxidative stress. Our results also demonstrated that increased intracellular Mn levels could substantially suppress protein oxidation (carbonylation) in D. radiodurans exposed to H2O2, indicating that manganese transport and regulation may be involved in the cellular resistance of D. radiodurans to oxidative stress.

Results and discussion

D. radiodurans encodes a putative manganese efflux protein

By searching the D. radiodurans genome http://www.ncbi.nlm.nih.gov/, we identified a manganese efflux protein homologue that was annotated as the conserved hypothetical protein DR1236 based on its extensive sequence similarity (25% identity, 49% similarity) to the manganese efflux protein (sp1552) of Streptococcus pneumoniae [10]. Similar to most cation diffusion facilitator (CDF) proteins, DR1236 has six putative transmembrane domains (TMDs) http://www.ch.embnet.org/software/TMPRED_form.html. The most conserved region of the CDF protein is the TMD region, which is probably involved in metal transfer [14]. Sequence alignment was performed with the CLUSTAL W program available on the EMBL web page http://www.ebi.ac.uk. The alignment Sp1552 and DR1236 revealed the presence of highly conserved sequences in metal transfer regions III and VI (Figure 1). Moreover, the DXXXD motif, which is conserved in the manganese efflux protein, was also present in DR1236 (224 DAGVD 230).
Figure 1

Sequence alignment of the two manganese efflux proteins. DEIRA, Deinococcus radiodurans R1; STRPN, Streptococcus pneumoniae. The metal transfer regions III and VI are boxed. Identical amino acids and similar amino acids are denoted by black and gray backgrounds, respectively.

Sequence alignment of the two manganese efflux proteins. DEIRA, Deinococcus radiodurans R1; STRPN, Streptococcus pneumoniae. The metal transfer regions III and VI are boxed. Identical amino acids and similar amino acids are denoted by black and gray backgrounds, respectively.

mntE is essential for the manganese resistance of D. radiodurans

To confirm the specific substrate and roles of DR1236 in D. radiodurans, the null mutant of dr1236 (mntE) and wild-type revertant mntE strains were constructed (Figure 2). Metals including manganese are essential yet potentially toxic to bacteria [15]. Supplementation with certain metal ions can inhibit the growth of an exporter system mutant [16,17]; therefore, this phenotype is used to verify certain mutants. In this study, wild-type R1 and dr1236 (mntE) were grown on TGY plates overlaid with discs saturated with 10 μL of different metal ion solutions (1 M) containing manganese, magnesium, cobalt, calcium, copper, zinc, nickel, or iron ions. As shown in Figure 3A/B, the growth of the mntE- mutant was strongly inhibited by the manganese ions, but the mutant grew normally in the presence of other cations. Moreover, the wild-type revertant showed a growth phenotype similar to that of R1, indicating that growth inhibition of the mntE- mutant was due to the interruption of dr1236.
Figure 2

. (A) Ethidium-bromide-stained agarose gel illustrating that the mutant carries a homozygous deletion of dr1236::aadA. Lane 1, mntE- mutant; lane 2, R1; lane 3, DNA marker. Primers M1/M4 were used for PCR. (B) Verification of wild-type revertant mntE by PCR. Lane 1, DNA marker; lane 2, R1; lane 3, revertant mntE. Primers M5/M6 were used for PCR.

Figure 3

Manganese sensitivity assay for wild-type R1 and the . (A) Wild-type R1 (white bars), mntE- (black bars), and WT revertant (gray bars) were cultured on TGY plates overlaid with filter discs saturated with 1 M solutions of various cations. The zone of inhibition was measured from the edge of the disc after three days. *P < 0.01. ND, not determined. (B) The inhibition zone of R1 and mntE. Cells were cultured on TGY plates overlaid with filter discs saturated with 1 M manganese chloride. (C) Wild-type R1 and mntE- were inoculated in TGY supplemented with different concentrations of manganese chloride. The OD600 values were determined after 12 h. Data represent the means ± standard deviations of three independent experiments.

. (A) Ethidium-bromide-stained agarose gel illustrating that the mutant carries a homozygous deletion of dr1236::aadA. Lane 1, mntE- mutant; lane 2, R1; lane 3, DNA marker. Primers M1/M4 were used for PCR. (B) Verification of wild-type revertant mntE by PCR. Lane 1, DNA marker; lane 2, R1; lane 3, revertant mntE. Primers M5/M6 were used for PCR. Manganese sensitivity assay for wild-type R1 and the . (A) Wild-type R1 (white bars), mntE- (black bars), and WT revertant (gray bars) were cultured on TGY plates overlaid with filter discs saturated with 1 M solutions of various cations. The zone of inhibition was measured from the edge of the disc after three days. *P < 0.01. ND, not determined. (B) The inhibition zone of R1 and mntE. Cells were cultured on TGY plates overlaid with filter discs saturated with 1 M manganese chloride. (C) Wild-type R1 and mntE- were inoculated in TGY supplemented with different concentrations of manganese chloride. The OD600 values were determined after 12 h. Data represent the means ± standard deviations of three independent experiments. To further investigate the influence of manganese ions on the mntE- mutant, different concentrations of manganese ions were added to TGY medium, and the growth of the mntEwas measured (Figure 3C). The results showed that in comparison with R1, the growth of the mntE- mutant was clearly delayed in the presence of low concentrations of manganese ions. When the manganese concentration increased, the growth defect phenotype became more pronounced. This phenotype is similar to that observed in Rosch's study in which the growth of S. pneumoniae having a disrupted calcium efflux system was more severely inhibited at higher calcium concentrations [18].

The mntE- mutant shows high intracellular manganese concentrations

To confirm that the mntE- mutant had lost its ability to export manganese ions, the intracellular manganese ion levels of wild-type R1 and the mntE- mutant were measured by inductively coupled plasma-mass spectrometry (ICP-MS). As expected, when grown on TGY medium supplemented with manganese ions, the manganese ion level in the mntE- mutant was almost four-fold higher than that in wild-type R1. However, there was no significant difference in the intracellular Fe ion concentrations of R1 and the mutant (Figure 4A). Similar results were obtained when the mntE- mutant and wild-type R1 were grown on TGY medium (Figure 4B). This result indicates that Dr1236 is a manganese ion exporter.
Figure 4

Analysis of the intracellular ion content of wild-type R1 and . (A) R1 (white bars) and mntE- (grey bars) were cultured in TGY medium supplemented with 50 μM manganese, 10 μM ferric chloride, 100 mM magnesium, or 100 mM calcium chloride to determine the effects of these specific cations. (B) R1 (white bars) and mntE- (grey bars) were cultured in TGY medium without added cations. Cells (OD600 = 0.8) were harvested, and the extracellular cations were removed by washing in EDTA. The cation concentration was determined by ICP-MS. The data represent the means ± standard deviations of three independent experiments.

Analysis of the intracellular ion content of wild-type R1 and . (A) R1 (white bars) and mntE- (grey bars) were cultured in TGY medium supplemented with 50 μM manganese, 10 μM ferric chloride, 100 mM magnesium, or 100 mM calcium chloride to determine the effects of these specific cations. (B) R1 (white bars) and mntE- (grey bars) were cultured in TGY medium without added cations. Cells (OD600 = 0.8) were harvested, and the extracellular cations were removed by washing in EDTA. The cation concentration was determined by ICP-MS. The data represent the means ± standard deviations of three independent experiments.

The mntE- mutant shows higher resistance to γ-radiation, UV, and oxidative

Recently, there has been a debate on whether the high intracellular Mn/Fe ratio of D. radiodurans contributes to the extreme oxidative resistance of this microorganism. Daly et al proposed that the high Mn/Fe ratio can effectively suppress protein carbonylation and increase radiation resistance [7,8]. In contrast, Sukhi et al and Shashidhar et al argued that D. radiodurans exhibits the same radiation resistance even when the intracellular Mn/Fe ratio changed substantially [19,20]. Since the intracellular manganese ion level was significantly increased, a cell survival experiment was carried out to confirm whether the high intracellular manganese ion level could contribute to cellular resistance. The D10 value represents the irradiating dose required to reduce the population by 90%. Here, the D10 value was proposed to assess the resistant ability of R1 and mntE- mutant to different stresses. As shown in Figure 5 the resistance of the mntE- mutant under different stresses was higher than that of R1, and the D10 values of the mntE- mutant were 14000 Gy γ-radiation, 700 J/m2 UV, and 50 mM H2O2, whereas that for R1 was 11000 Gy γ-radiation, 600 J/m2 UV, and 40 mM H2O2. Moreover, when R1 and mntE- mutant were cultured in TGY supplemented with 50 μM manganese, their resistance to different stresses also increased remarkably, and it is consistent with their intracellular manganese level (Figure 5). The results suggest that there is a correlation between the intracellular manganese level and cellular oxidative resistance, which is consistent with the data from Daly's studies [8]. Although the role of manganese in the oxidative resistance of D. radiodurans remains unclear, our study implies that an increase in the intracellular manganese level may be one of the responses to oxidative stress. Moreover, it is notable that the UV resistance of the mntE- mutant also increased. Generally, UV light results in DNA damage, and only high doses of UV cause oxidative damage. Therefore, it is interesting to speculate that the UV resistance of the mntE- mutant may be indirectly enhanced by manganese ions. In fact, many important DNA repair enzymes use Mn2+ as the cofactor [21], and manganese accumulation may have a positive effect on gene function. Furthermore, a high intracellular manganese level is also known to have an important effect on the expression of many genes including stress response genes [10].
Figure 5

Survival curves for R1 (triangles) and . R1 and mntE- were cultured in TGY broth with or without 50 μM manganese. The values represent the means ± standard deviations of four independent experiments.

Survival curves for R1 (triangles) and . R1 and mntE- were cultured in TGY broth with or without 50 μM manganese. The values represent the means ± standard deviations of four independent experiments.

The mntE- mutant shows a lower protein oxidation level under oxidative stress

The protein carbonylation level is an important index of intracellular oxidative damage to proteins [8]. Previous reports have shown that the proteins of IR-sensitive bacteria are more vulnerable than those of D. radiodurans to ROS-induced protein oxidative damage [7]. Therefore, we measured and compared the levels of protein carbonylation in the mntE- mutant and wild-type R1. Notably, the level of protein carbonylation in the mntE- mutant decreased to nearly 50% of that in R1 after H2O2 treatment (Figure 6), indicating that the mutation of mntE resulted in a lower level of protein oxidation than that observed in the wild type. This suggests that the high level of intracellular manganese ions could enhance cellular resistance by protecting proteins against ROS damage.
Figure 6

Protein carbonylation levels in R1 (black bars) and . Cells (OD600 = 0.8) were harvested and treated with 40 mM H2O2 for 30 min. The protein carbonylation levels were determined by the DNPH assay. Data represent the means ± standard deviations of three independent experiments.

Protein carbonylation levels in R1 (black bars) and . Cells (OD600 = 0.8) were harvested and treated with 40 mM H2O2 for 30 min. The protein carbonylation levels were determined by the DNPH assay. Data represent the means ± standard deviations of three independent experiments.

Conclusions

Although it is known that the Mn/Fe ratio of D. radiodurans is higher than that of other bacteria, little is known regarding the maintenance of the intracellular manganese ion level in this bacterium. So far, only one manganese efflux system has been identified in bacteria [10], and it is still unknown whether this system exists in D. radiodurans [22]. In this study, we identified a MntE homolog in D. radiodurans. As expected, our results showed that the intracellular manganese ion level was almost four-fold higher in the mutant than in R1. Furthermore, we also found that the oxidative level of mntE- proteins decreased to almost one half that of R1. On the other hand, the data also revealed that manganese accumulation is dangerous to the mntE- mutant. Based on these data, we conclude that dr1236 is indeed a mntE homologue and is indispensable for maintaining manganese homeostasis in D. radiodurans. The results provide additional evidence that intracellular manganese ions are involved in the radiation resistance of D. radiodurans. However, because the intracellular Mn/Fe ratio and the Mn concentration of mntE- both increased in this study, we could not clarify whether the Mn/Fe ratio or the Mn concentration is more important for stress tolerance. Therefore, global analysis of the regulation of the intracellular manganese ion level is necessary in further studies.

Methods

Strains and media

All the strains and plasmids used in this study are listed in the supporting information (Table 1). The D. radiodurans strains were cultured at 30°C in TGY (0.5% Bacto tryptone, 0.1% glucose, and 0.3% Bacto yeast extract) medium with aeration or on TGY plates supplemented with 1.2% Bacto agar.
Table 1

Strains and plasmids used in this study

Strain or plasmidRelevant markerReference or resource
Strains
E. coli DH5αhsdR17 recA1 endA1 lacZΔM15Invitrogen
D. radiodurans R1ATCC13939
mntE-As R1, but mnE::aadAThis study
mntRAs mntE- mnE::aadA(pME mntEDr+)This study
Plasmids
pMD18-TTA cloning vectorTakara
pRADKE. coli-D. radiodurans shuttle vector carrying D. radiodurans groEL promoter[27]
pMEpRADK derivative expressing D. radiodurans mntEThis study
Strains and plasmids used in this study

Disruption and complementation of dr1236

The mutant dr1236 gene was constructed as described previously [23]. Briefly, ~600-bp DNA fragments immediately upstream and downstream from dr1236 were amplified from the genome of the R1 strain using the primer pairs ME1/ME2 and ME3/ME4, respectively (Table 2). These two fragments were digested with BamHI and HindIII, respectively, and cloned to the streptomycin-resistance DNA fragment from pKat-aadA [24] pretreated with the same enzymes. The ligation product was transformed into D. radiodurans R1, and mutant colonies were selected on TGY plates containing 8 μg/mL streptomycin. Null mutants were confirmed by PCR and sequencing, and the resulting mutant was designated mntE.
Table 2

Primers used in this study

Primer Sequence(5' → 3')
Construction of the mntE- mutant
ME1GCACGCGCTTTTCCTATGAC
ME2ATATGGATCCACCACCGCACTGAGGTATTC
ME3ATATAAGCTTCCGGCGCCAACGTCACCATT
ME4CGCCGACCAGGACACGATAG
Complementation of the mntE- mutant
ME5ATATCATATGCCGGTTTTCGTGGCG
ME6ATATGGATCCCAGGTCTATCAACTGTGGGA
Primers used in this study A complementary plasmid was constructed and transformed into the mntE- mutant as described previously [25]. Briefly, the dr1236 gene with the NdeI and BamHI sites was amplified with primers ME5/ME6. The PCR product was ligated to the pMD18-T simple vector (Takara, JP), and the product was designated pMDmntE. After digestion with NdeI and BamHI, the target gene MntE was ligated to NdeI- and BamHI-predigested pRADK [23]. The complementation plasmid was confirmed by PCR and DNA sequence analyses and transformed into the mntE- strain.

Cation sensitivity assay

Cation sensitivity assays were carried out as described previously [18]. Solutions (1 M) of manganese chloride, manganese sulfate, calcium chloride, magnesium chloride, zinc chloride, cobalt (II) chloride, copper chloride, ferric chloride, and ferrous sulfate (Sigma) were prepared in milli-Q water and filter-sterilized by passing through 0.22-μm filters. Cells grown to the early stationary phase in TGY broth were plated on TGY plates and overlaid with 5-mm sterile filter discs containing 10 μL of various cation solutions. The plates were incubated for three days, and the inhibition zone of each disc was measured. To measure the growth of mntE- and R1, 1 × 105 cfu mL-1 were grown in TGY supplemented with increasing concentrations of MnCl2. The OD600 value was measured 12 h post incubation (mean ± SD of three experiments).

Inductively coupled plasma-mass spectrometry (ICP-MS) assay

For the ICP-MS assays [26], the cells were cultured in TGY broth that had been pretreated with Chelex (Sigma) to remove any cations and supplemented with 50 μM manganese, 10 μM ferric chloride, 100 mM magnesium, or 100 mM calcium chloride. Cells (OD600 = 0.6-0.8) were harvested by centrifugation, washed three times with phosphate-buffered saline (PBS) containing 10 mM EDTA, and rinsed three times with PBS without EDTA. Cells (1/10 of the total volume) were withdrawn to measure the dry weight, and the remaining cells were treated with nitric acid and used for the ICP-MS assay.

Survival curves of the mntE- mutant and R1

R1 and mntE- cells were cultured in TGY broth with or without 50 μM manganese to OD600 = 1.0, centrifuged, and then resuspended in phosphate buffer. For the γ-irradiation treatment, the suspension was irradiated with different doses of 60Co γ-radiation for 1 h on ice. After the irradiation treatment, the cells were plated on TGY plates and incubated at 30°C for three days. The colonies were then counted. For the UV treatment, the cells were plated on TGY plates and exposed to different doses of UV radiation at 254 nm. For the H2O2 treatment, the cultures were treated with different concentrations of H2O2 for 30 min and then plated on TGY plates.

Protein carbonylation assay

Cells grown to OD600 = 0.5 were treated with H2O2 (30 mM), harvested, and resuspended in PBS containing 1% (by volume) β-mercaptoethanol and 1 mM phenylmethanesulfonyl fluoride. The cells were disrupted by sonication, and the cell-free extracts were used for the protein carbonylation assay. The protein concentrations were determined by the Bradford method. The cell-free extracts were incubated with 400 μL of 10 mM 2, 4-dinitrophenyl hydrazine (DNPH) in 2 M HCl for 2 h in the dark. After precipitation with ice-chilled 10% trichloroacetic acid (TCA), the precipitated proteins were washed three times with 50% ethyl acetate in ethanol. The decolorized precipitates were evaporated and dissolved in 1 mL of 6 M guanidine hydrochloride. The solution was centrifuged, and the absorbance of the supernatant was determined at 370 nm against a protein control that had been processed in parallel but with 2 M HCl instead of DNPH. The protein carbonyl content is defined as mM/mg protein.

Statistical analysis

Student's t-test was used to assess the significance between results, and p < 0.05 was considered as significant.

Authors' contributions

HXS and YJH conceived and designed the study. HXS performed the experiments and wrote the manuscript. GZX, BT and HC participated in the discussion of the experimental results. HDZ and ZTS carry out the protein carbonylation analysis. All authors read and approved the final manuscript.
  25 in total

Review 1.  Why is Deinococcus radiodurans so resistant to ionizing radiation?

Authors:  J R Battista; A M Earl; M J Park
Journal:  Trends Microbiol       Date:  1999-09       Impact factor: 17.079

Review 2.  Emerging themes in manganese transport, biochemistry and pathogenesis in bacteria.

Authors:  David G Kehres; Michael E Maguire
Journal:  FEMS Microbiol Rev       Date:  2003-06       Impact factor: 16.408

3.  PprI: a general switch responsible for extreme radioresistance of Deinococcus radiodurans.

Authors:  Yuejin Hua; Issay Narumi; Guanjun Gao; Bing Tian; Katsuya Satoh; Shigeru Kitayama; Binghui Shen
Journal:  Biochem Biophys Res Commun       Date:  2003-06-27       Impact factor: 3.575

Review 4.  New developments in the understanding of the cation diffusion facilitator family.

Authors:  Christopher J Haney; Gregor Grass; Sylvia Franke; Christopher Rensing
Journal:  J Ind Microbiol Biotechnol       Date:  2005-05-12       Impact factor: 3.346

5.  Phylogenetic diversity of the deinococci as determined by 16S ribosomal DNA sequence comparison.

Authors:  F A Rainey; M F Nobre; P Schumann; E Stackebrandt; M S da Costa
Journal:  Int J Syst Bacteriol       Date:  1997-04

6.  Characterization of pathways dependent on the uvsE, uvrA1, or uvrA2 gene product for UV resistance in Deinococcus radiodurans.

Authors:  Masashi Tanaka; Issay Narumi; Tomoo Funayama; Masahiro Kikuchi; Hiroshi Watanabe; Tsukasa Matsunaga; Osamu Nikaido; Kazuo Yamamoto
Journal:  J Bacteriol       Date:  2005-06       Impact factor: 3.490

7.  Accumulation of Mn(II) in Deinococcus radiodurans facilitates gamma-radiation resistance.

Authors:  M J Daly; E K Gaidamakova; V Y Matrosova; A Vasilenko; M Zhai; A Venkateswaran; M Hess; M V Omelchenko; H M Kostandarithes; K S Makarova; L P Wackett; J K Fredrickson; D Ghosal
Journal:  Science       Date:  2004-09-30       Impact factor: 47.728

8.  Involvement of reactive oxygen species in the action of ciprofloxacin against Escherichia coli.

Authors:  M Goswami; S H Mangoli; N Jawali
Journal:  Antimicrob Agents Chemother       Date:  2006-03       Impact factor: 5.191

9.  Dimethyl sulfoxide prevents DNA nicking mediated by ionizing radiation or iron/hydrogen peroxide-generated hydroxyl radical.

Authors:  J E Repine; O W Pfenninger; D W Talmage; E M Berger; D E Pettijohn
Journal:  Proc Natl Acad Sci U S A       Date:  1981-02       Impact factor: 11.205

10.  Bacterioferritin A modulates catalase A (KatA) activity and resistance to hydrogen peroxide in Pseudomonas aeruginosa.

Authors:  J F Ma; U A Ochsner; M G Klotz; V K Nanayakkara; M L Howell; Z Johnson; J E Posey; M L Vasil; J J Monaco; D J Hassett
Journal:  J Bacteriol       Date:  1999-06       Impact factor: 3.490

View more
  22 in total

1.  Bacillus subtilis MntR coordinates the transcriptional regulation of manganese uptake and efflux systems.

Authors:  Xiaojuan Huang; Jung-Ho Shin; Azul Pinochet-Barros; Tina T Su; John D Helmann
Journal:  Mol Microbiol       Date:  2016-11-02       Impact factor: 3.501

2.  Functional Determinants of Metal Ion Transport and Selectivity in Paralogous Cation Diffusion Facilitator Transporters CzcD and MntE in Streptococcus pneumoniae.

Authors:  Julia E Martin; David P Giedroc
Journal:  J Bacteriol       Date:  2016-01-19       Impact factor: 3.490

3.  Structure-function analysis of manganese exporter proteins across bacteria.

Authors:  Rilee Zeinert; Eli Martinez; Jennifer Schmitz; Katherine Senn; Bakhtawar Usman; Vivek Anantharaman; L Aravind; Lauren S Waters
Journal:  J Biol Chem       Date:  2018-02-13       Impact factor: 5.157

4.  The Escherichia coli MntR miniregulon includes genes encoding a small protein and an efflux pump required for manganese homeostasis.

Authors:  Lauren S Waters; Melissa Sandoval; Gisela Storz
Journal:  J Bacteriol       Date:  2011-09-09       Impact factor: 3.490

5.  The Cation Diffusion Facilitator Family Protein EmfA Confers Resistance to Manganese Toxicity in Brucella abortus 2308 and Is an Essential Virulence Determinant in Mice.

Authors:  Matthew J Johnsrude; Joshua E Pitzer; Daniel W Martin; R Martin Roop
Journal:  J Bacteriol       Date:  2019-12-06       Impact factor: 3.490

6.  Avoidance of protein oxidation correlates with the desiccation and radiation resistance of hot and cold desert strains of the cyanobacterium Chroococcidiopsis.

Authors:  Claudia Fagliarone; Claudia Mosca; Ilaria Ubaldi; Cyprien Verseux; Mickael Baqué; Annick Wilmotte; Daniela Billi
Journal:  Extremophiles       Date:  2017-08-30       Impact factor: 2.395

7.  Enterococcus faecalis Manganese Exporter MntE Alleviates Manganese Toxicity and Is Required for Mouse Gastrointestinal Colonization.

Authors:  Ling Ning Lam; Jun Jie Wong; Kelvin Kian Long Chong; Kimberly A Kline
Journal:  Infect Immun       Date:  2020-05-20       Impact factor: 3.441

Review 8.  Conservation and diversity of radiation and oxidative stress resistance mechanisms in Deinococcus species.

Authors:  Sangyong Lim; Jong-Hyun Jung; Laurence Blanchard; Arjan de Groot
Journal:  FEMS Microbiol Rev       Date:  2019-01-01       Impact factor: 16.408

9.  Regulation of MntH by a dual Mn(II)- and Fe(II)-dependent transcriptional repressor (DR2539) in Deinococcus radiodurans.

Authors:  Hongxing Sun; Mingfeng Li; Guangzhi Xu; Huan Chen; Jiandong Jiao; Bing Tian; Liangyan Wang; Yuejin Hua
Journal:  PLoS One       Date:  2012-04-16       Impact factor: 3.240

Review 10.  Experimental evolution of extremophile resistance to ionizing radiation.

Authors:  Steven T Bruckbauer; Michael M Cox
Journal:  Trends Genet       Date:  2021-06-01       Impact factor: 11.821

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.