Literature DB >> 21088000

Epigenetic control of a VDR-governed feed-forward loop that regulates p21(waf1/cip1) expression and function in non-malignant prostate cells.

James L Thorne1, Orla Maguire, Craig L Doig, Sebastiano Battaglia, Leah Fehr, Lara E Sucheston, Merja Heinaniemi, Laura P O'Neill, Christopher J McCabe, Bryan M Turner, Carsten Carlberg, Moray J Campbell.   

Abstract

In non-malignant RWPE-1 prostate epithelial cells signaling by the nuclear receptor Vitamin D Receptor (VDR, NR1I1) induces cell cycle arrest through targets including CDKN1A (encodes p21((waf1/cip1))). VDR dynamically induced individual histone modification patterns at three VDR binding sites (R1, 2, 3) on the CDKN1A promoter. The magnitude of these modifications was specific to each phase of the cell cycle. For example, H3K9ac enrichment occurred rapidly only at R2, whereas parallel accumulation of H3K27me3 occurred at R1; these events were significantly enriched in G(1) and S phase cells, respectively. The epigenetic events appeared to allow VDR actions to combine with p53 to enhance p21((waf1/cip1)) activation further. In parallel, VDR binding to the MCM7 gene induced H3K9ac enrichment associated with rapid mRNA up-regulation to generate miR-106b and consequently regulate p21((waf1/cip1)) expression. We conclude that VDR binding site- and promoter-specific patterns of histone modifications combine with miRNA co-regulation to form a VDR-regulated feed-forward loop to control p21((waf1/cip1)) expression and cell cycle arrest. Dissection of this feed-forward loop in a non-malignant prostate cell system illuminates mechanisms of sensitivity and therefore possible resistance in prostate and other VDR responsive cancers.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 21088000      PMCID: PMC3064804          DOI: 10.1093/nar/gkq875

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


INTRODUCTION

Collectively, nuclear receptors (NRs) regulate a significant proportion of the human genome to exert diverse cellular function. Several NRs are attractive chemotherapy targets as the gene programs they control broadly inhibit cell proliferation and/or induce programmed cell death. For example, the anticancer actions of 1α,25(OH)2D3, the natural VDR (NR1I1) ligand, have been established for 30 years (1–3) and in certain cancer cell types including some prostate cancer cell lines (4–7), and xenograft and transgenic prostate cancer models (8,9). These effects are not universal and insensitivity is also apparent (10,11). In parallel, large-scale epidemiological studies found inverse associations between circulating levels of the pre-ligand, 25OH-D3, and prostate cancer risk (12–20). However, despite these links between VDR signaling and broad anticancer activities, clinical exploitation in cancer has been slow. Gene target expression by NRs has been intensively investigated from the perspective of receptor binding to response elements (21–24). These dynamics contribute to the patterns of target gene mRNA, however, the cycles vary considerably in timing and magnitude of response between different target genes and NRs. A complete understanding of the mechanisms that entrain these patterns and their biological significance remain elusive. Against this backdrop, elucidating NR gene expression control mechanisms is important to illuminate mechanisms of resistance in cancer cells. In particular epigenetic resistance mechanisms have been explored. For example elevated levels of the NCOR2/SMRT co-repressor suppress VDR’s ability to regulate a subset of target genes that mediate antiproliferative actions (25–27). In turn the accumulation of repressive histone modifications at suppressed target genes may allow for hypermethylation at adjacent CpG regions (28) and development of stable patterns of gene silencing [reviewed in refs. (29,30)]. MiRNA also contribute negative regulatory aspects to normal gene regulation, for example, as part of feed-forward loop motifs (31,32). Also NRs, including the VDR, are able to govern miRNA expression, and this in turn may contribute to resistance (33–37). The extent to which NR-regulated miRNA form feed-forward loops remains uncertain. Previously, we established that 1α,25(OH)2D3 regulates the DNA helicase MCM7 (25) and others have established that miR-106b, located on intron 13 of the MCM7 gene, inhibits the VDR target gene, CDKN1A (encodes p21(waf1/cip1)) (38,39). Together these findings suggest that co-regulated miRNA may form an integral part of VDR signaling to control gene expression. To investigate how VDR-regulated epigenetic events control target gene expression, we interrogated non-malignant RWPE-1 prostate epithelial cells (40) undergoing G1 cell cycle arrest in response to 1α,25(OH)2D3 [reviewed in ref. (41)]. Specifically, we undertook a series of experiments to establish, if and to what extent VDR governed both histone modifications and miRNA expression to control gene expression. We focused on the circuitry that controls the CDKN1A gene and revealed that mRNA and protein modulation was determined by the spatial-temporal binding sequence of the VDR complex to two target genes; namely the CDKN1A gene itself and the MCM-7 gene that gives rise to the miR-106b cluster. In this manner, p21( regulation arises due to the interplay of three processes: (i) gene- and response element-specific VDR-induced histone modifications, (ii) cell cycle status and (iii) co-regulation of miR-106b. These events generate a VDR feed-forward loop that regulates the magnitude, timing and sensitivity of p21( expression and hence cell cycle arrest. The regulation and function of this feed-forward loop provides insight into mechanisms of VDR sensitivity and resistance in prostate other VDR-responsive cancers.

MATERIALS AND METHODS

Agents, cell culture and antibodies

1α25(OH)2D3 [gift of Dr Milan Uskokovic (BioXell S.p.A., Italy)] used at 100 nM concentration for all experiments. RWPE-1 non-malignant prostate epithelial cells and RWPE-2 cells were maintained in KSF media supplemented with EGF and BPE (Invitrogen, Paisley, UK). P69SV40T cells were cultured in RPMI with 10% FCS. Antibodies for immunoblot: p21(, beta-actin (Abcam, ab7960, ab8229). Antibodies for ChIP assays—VDR, NCOR1, RNA Pol II (Abcam ab3508, ab24552, ab26721), NCOR2/SMRT (Santa Cruz Biotechnologies sc1610), H3K27me3 (Upstate ABE44), H3K9ac, H3K9me2 and H3K4me3 [in house antibodies (42)]

Mice

Wild-type C57 BL/6xFVB mice were treated with EtOH or 20 μg/kg 1α,25(OH)2D3 for 12 or 24 h. Nine mice were used per treatment group. Prostate tissues pooled into three groups of three. RNA was isolated using TRIzol (Invitrogen).

Live cell sorting

Cells were stained with Hoechst 33342 (Invitrogen), which is a well-tolerated stain for DNA(43), fractionated using a MoFlo cell sorter (Beckman-Coulter, High Wycombe, UK) and Summit V4.3 software (Beckman-Coulter, UK) and 5 × 105 cells/phase were collected.

q-RT–PCR

RNA was isolated using TRizol (Invitrogen). Target gene expression was quantitated on an ABI 7900 [Applied Biosystems (http://www.appliedbiosystems.com)] machine. All primers and probes were as described previously (25). For miRNA quantitation, q-PCR was performed using Assay-on-Demand miR-106b and RNU48 probes. Measurements were performed in technical and biological triplicate.

Immunoblot analysis

Fifty microgram total protein extracts separated on 10% SDS gels, and blots probed with antibodies described above. Proteins detected using ECL (Amersham) and autoradiography.

ChIP protocols

X-ChIP was used to measure the association of VDR, NCOR1 and NCOR2/SMRT and RNA Pol II binding as described previously (44). Briefly, chromatin from 1.5 × 106 mid-exponential cells was cross-linked. Pre-cleared inputs were immunoprecipited with: VDR (Abcam ab3508), NCOR1 (Abcam ab24552), NCOR2/SMRT (Santa Cruz 1610), RNA Pol II (Abcam ab26721). Complexes were recovered using magnetic beads, washed, crosslinking reversed and further cleared DNA was recovered by standard precipitation approaches. Twenty-five nanogram DNA was used per Q-PCR reaction using SYBRgreen with pre-optimized primers (Table 1). To measure the interaction of VDR with co-repressors Re-ChIP was used. VDR immunocomplexes prepared with the VDR indicated in the X-ChIP section were eluted and immunoprecipitated with antibodies to NCOR1 or NCOR2/SMRT, new immuno-complexes were formed and detection was as indicated for X-ChIP. N-ChIP was performed as previously described (45). Briefly, chromatin from 5 × 107 cells was harvested from nuclei and digested by micrococcal nuclease (Pharmacia, Milton Keynes, UK) and immunoprecipited with H3K27me3 (Upstate) (Abcam ab27472) or H3K9ac, H3K9me2 and H3K4me3 [in house antibodies (42)] or IgG control. DNA was purified and analyzed as for X-ChIP. C-ChIP was adapted from N-ChIP as previously described (46) by ‘spiking’ with SL2 cells prior to chromatin extraction and using human specific primers (Table 1).
Table 1.

Primer sequences used for Q-PCR and ChIP analyses

Gene regionForwardReverse
Q-PCR
    MCM7CGGTGCTGGTAGAAGGAGAGAAACCCTGTACCACCTGTCG
    MCM7 probeGCCAATCCTGCGCACTGGGT
X and N-ChIP
    MCM7, –7995TACTTGGGAGGCTGAGATGGCAGGCTGGAGTGCAGTGTTA
    MCM7, –589CCTAGCCCACCCAACCTTATTAATTCACAGTGCCCACAGG
    CDKN1A, –7049 (R3)AGCAGCACTGAAGCCTAACCGAGAGGCCTACCAGCTTCAG
    CDKN1A, –4496 (R2)TAGAGATGCTCAGGCTGCTGAGAGCTTCACCGACATAGCC
    CDKN1A, –2137 (R1)GAGGAAGGGGATGGTAGGAGCTGGCAGATCACATACCCTGT
    CDKN1A, TSSTATATCAGGGCCGCGCTGGGCTCCACAAGGAACTGACTTC
C-ChIP
    CDKN1A, TSSCCGAAGTCAGTTCCTTGTGGCGCTCTCTCACCTCCTCTGA
    CDKN1A, –2137 (R1)GCCTGTTTTCAGGTGAGGAACTGGCAGATCACATACCCTGT
Primer sequences used for Q-PCR and ChIP analyses

MiR-106b knockdown

si-miR-106b (MI0000734, Dharmacon) and scrambled constructs (IN-001005-01-05, Dharmacon) transiently transfected into cells at 100 nM. Cells seeded into 6-well plates for treatment with EtOH or 1α,25(OH)2D3 (100 nM) and RNA isolated using TRizol (Invitrogen). For FACS analysis, cells were stained with Propidium Iodide solution, and run through a FACScan II (Becton Dickinson Biosciences). DNA histograms were analyzed using ModFit software (Verity Software House).

RESULTS

1α,25(OH)2D3 induces cell cycle arrest associated with dynamic target gene regulation

1α,25(OH)2D3 induced cell cycle arrest in RWPE-1 cells after 24 h exposure to ligand (Supplementary Figure S1). Co-incident with the cell cycle arrest, known VDR target genes (23,39,47,48) revealed significant 1α,25(OH)2D3-induced regulation, in bulk cell populations, compared to EtOH time-matched controls (Figure 1A). These patterns of mRNA accumulation were not readily predicted from the arrangement and location of vitamin D response elements (VDREs) in the promoter regions (23,39,47). These analyses suggested common and unique aspects of mRNA regulation. CDKN1A, GADD45A and IGFBP3 displayed rapid modulation that returned to basal levels whereas CYP24A1 displayed more sustained accumulation to a greater magnitude. CYP24A1, GADD45A and CDKN1A all displayed sequential repression, accumulation at 0.5 h, followed by repression. IGFBP3 displayed no repression, but instead more immediate accumulation. Post 1 h, all genes displayed modulating accumulation with some degree of synchrony at 2 h that was generally reduced subsequently, although another peak was generally apparent at 12 h. P21( (encoded by CDKN1A) expression displayed distinct peaks at 1 and 3 h and a broader peak from 16 h onwards reflecting increased mRNA levels at 0.5, 2 and 12 h (Figure 1B). The dynamic regulation of CDKN1A over the first 1 h was also observed in the RAS-transformed variant of RWPE-1 cells, namely RWPE-2 (40) and in another prostate epithelial immortalized cell line, namely P69SV40T (49). These common VDR-regulated mRNA accumulation patterns in different prostate epithelial cell models suggest the mechanisms underlying this behavior are also common and shared (Supplementary Figure S2).
Figure 1.

Dynamic regulation of VDR target genes. (A) RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM) or EtOH and mRNA was extracted at the indicated time points, and accumulation of indicated genes measured by TaqMan Q-RT–PCR. Accumulation of each target is given as log2 (fold change). Each data point represents the mean of triplicate experiments in triplicate wells ±SEM (*P < 0.05, **P < 0.01, ***P < 0.001). All measurements performed in technical and biological triplicate. (B) Total cell proteins were isolated from cells treated as above at the indicated time points (+D3) and subjected to western immunoblotting. Representative blots are shown for p21( (Abcam, ab7960). β-Actin used as a loading control (Abcam, ab8229). For quantification of signal Odyssey infrared imaging system (LI-COR, Lincoln, NE) was used and the quantification for the fold changes are under each image.

Dynamic regulation of VDR target genes. (A) RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM) or EtOH and mRNA was extracted at the indicated time points, and accumulation of indicated genes measured by TaqMan Q-RT–PCR. Accumulation of each target is given as log2 (fold change). Each data point represents the mean of triplicate experiments in triplicate wells ±SEM (*P < 0.05, **P < 0.01, ***P < 0.001). All measurements performed in technical and biological triplicate. (B) Total cell proteins were isolated from cells treated as above at the indicated time points (+D3) and subjected to western immunoblotting. Representative blots are shown for p21( (Abcam, ab7960). β-Actin used as a loading control (Abcam, ab8229). For quantification of signal Odyssey infrared imaging system (LI-COR, Lincoln, NE) was used and the quantification for the fold changes are under each image.

VDR-regulated histone modifications underpin CDKN1A regulation

Time-resolved quantitative ChIP approaches (0.5, 1, 4 and 12 h) at three VDRE regions (R1, R2, R3) (Figure 2A) (39). The spatial–temporal re-distribution of VDR and co-repressors was measured in parallel with regulation of a panel of histone modifications. Histone modifications measured were associated with either gene maintenance, namely H3K4me3 (the trithorax mark) and H3K27me3 (the polycomb mark), or others associated with dynamic regulation of transcription (H3K9ac and H3K9me2). These approaches revealed that 1α,25(OH)2D3 induced tightly regulated gene activating epigenetic events at only one response element on CDKN1A, namely R2 [from −4505 to −4489 from transcription start site (TSS)] (Figure 2B).
Figure 2.

VDR-regulated epigenetic events on the promoter of CDKN1A. (A) The genomic location of the VDR binding regions (R3, R2 and R1) on CDKN1A and the transcription start site (TSS). (B) Left graphs. RWPE-1 bulk populations treated with 1α,25(OH)2D3 (100 nM) or EtOH for indicated time points. Association of RNA Pol II, VDR, NCOR1 and NCOR2/SMRT was measured at each region by X-ChIP using ChIP grade antibodies and normalized and given as fold enrichment over input as described previously (44). Primers are shown in Table 1. Enrichment was measured by Q-PCR with primers specific to these regions that amplified a product <150 bp. Right graphs. Parallel changes to histone modifications (H3K9me2, H3K27me3, H3K4me3 and H3K9ac) were assayed using N-ChIP and normalized using bound over unbound DNA pulled down with specific ChIP grade antibodies (42). N-ChIP was performed as previously described (53). Enrichment was measured by Q-PCR as above. All measurements performed in technical duplicate and biological triplicate.

VDR-regulated epigenetic events on the promoter of CDKN1A. (A) The genomic location of the VDR binding regions (R3, R2 and R1) on CDKN1A and the transcription start site (TSS). (B) Left graphs. RWPE-1 bulk populations treated with 1α,25(OH)2D3 (100 nM) or EtOH for indicated time points. Association of RNA Pol II, VDR, NCOR1 and NCOR2/SMRT was measured at each region by X-ChIP using ChIP grade antibodies and normalized and given as fold enrichment over input as described previously (44). Primers are shown in Table 1. Enrichment was measured by Q-PCR with primers specific to these regions that amplified a product <150 bp. Right graphs. Parallel changes to histone modifications (H3K9me2, H3K27me3, H3K4me3 and H3K9ac) were assayed using N-ChIP and normalized using bound over unbound DNA pulled down with specific ChIP grade antibodies (42). N-ChIP was performed as previously described (53). Enrichment was measured by Q-PCR as above. All measurements performed in technical duplicate and biological triplicate. VDR accumulated rapidly at R2 after 0.5 and 1 h in response to 1α,25(OH)2D3 treatment and was associated with release of both co-repressors at 0.5 h (Figure 2B). N-ChIP approaches revealed parallel enrichment of H3K9ac and loss of repressive H3K9me2 at 0.5 h. At this time point, at the other response elements, 1α,25(OH)2D3 actively induced association with co-repressor and/or enriched for repressive histone modifications. Thus significant enrichment of NCOR2/SMRT occurred at R3 (from −7059 to −7036) and of NCOR1 at R1 (from −2146 to −2129), the latter is associated with a loss of H3K9ac and enrichment of H3K9me2. The activation state at R2 was rapid and reversed after 1 h. Thus following the initial accumulation at 0.5 h of an ‘active’ receptor and epigenetic signature (Figure 2B) and mRNA and protein accumulation (Figure 1), NCOR2/SMRT and H3K9me2 were re-enriched for 1 h at R2, with loss of H3K9ac levels, underscoring the tight control of these activation events. In contrast, the repressive events at R3 and R1 were more sustained, notably at R1 where H3K27me3 accumulated from 1 h onwards through to 12 h (Figure 2B). It is also interesting to note that NCOR/SMRT enrichment appears to move along the promoter from R3 (0.5 h) to R2 (1 h) to R1 (12 h) also suggesting longer term effects on the promoter. The TSS also displayed sustained H3K4me3 enrichment after 0.5 h as NCOR1 and NCOR2/SMRT levels declined. H3K4me3 enrichment continued to 12 h, as did RNA Pol II and accompanied mRNA and protein accumulation at 12 h. Re-ChIP analyses were undertaken at R2 and R1 as these regions reflected the parallel but distinct activation and repression observed upon 1α,25(OH)2D3 treatment. These analyses under scored the role of co-repressor release and recapture. NCOR1 interactions with VDR were significantly reduced at both regions after 0.5 h although this was only co-incident with H3K9ac gain at R2 (Figure 3A). Subsequently, NCOR1 significantly re-associated with VDR, most noticeably at R2, at 1 h onwards, co-incident with increased H3K9me2 in this region (Figure 2). NCOR2/SMRT did not dissociate from the VDR, but rather trended to accumulation at 4 h at R2 and reflected the co-repressor enrichment in this region at this time point (Figure 2).
Figure 3.

VDR interactions with co-repressors and the enhancement of 1α,25(OH)2D3-induced target gene expression. (A) RWPE-1 cells were treated as above, and X-ChIP performed and VDR DNA–protein complexes were eluted and immunoprecipitated with antibodies to NCOR1 or NCOR2/SMRT. Enrichment was measured by Q-PCR with primers specific to these regions that amplified a product less than 150 bp. Primers are shown in Table 1. All measurements performed in technical duplicate and biological triplicate. (B) RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM), 5-flurouracil (Fl-U) (50 nM), or combination (DF) for 1 h. Accumulation of CDKN1A and IGFBP3 measured by TaqMan Q-PCR. All measurements performed in technical and biological triplicate (*P < 0.05, **P < 0.01, ***P < 0.001).

VDR interactions with co-repressors and the enhancement of 1α,25(OH)2D3-induced target gene expression. (A) RWPE-1 cells were treated as above, and X-ChIP performed and VDR DNA–protein complexes were eluted and immunoprecipitated with antibodies to NCOR1 or NCOR2/SMRT. Enrichment was measured by Q-PCR with primers specific to these regions that amplified a product less than 150 bp. Primers are shown in Table 1. All measurements performed in technical duplicate and biological triplicate. (B) RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM), 5-flurouracil (Fl-U) (50 nM), or combination (DF) for 1 h. Accumulation of CDKN1A and IGFBP3 measured by TaqMan Q-PCR. All measurements performed in technical and biological triplicate (*P < 0.05, **P < 0.01, ***P < 0.001). At certain time points the CDKN1A locus displayed both activating and repressing histone modifications, whereas mRNA expression was at basal levels. For example, after 1 h the TSS and body of the gene displayed enrichment for H3K9ac and H3K4me3 (Figure 2 and data not shown), whereas regions R2 and R1 were enriched for H3K9me2 and H3K27me3, respectively. We investigated whether this represented a so-called poised state and whether the CDKN1A locus could be activated by further transcriptional activators. Regions R1 and R2 are within close proximity to p53 binding sites (39,50). We therefore tested if the p53 activator 5-flurouracil enhanced 1α,25(OH)2D3-induced CDKN1A mRNA accumulation over a 4 h time course and revealed significantly co-operative actions at 1 h (Figure 3B). The combination of agents yielded a significant combined effect at 1 h; comparable events were observed with IGFBP3, another target regulated by VDR and p53 (Figure 3B) (51).

Cell cycle status determines the magnitude of histone modifications on the CDKN1A promoter

Previous Q-PCR approaches in FACS-sorted RWPE-1 cells revealed S-phase elevation of co-repressors (for example NCOR1, NCOR2/SMRT) and HDACs (for example HDACs 2 and 3), whereas VDR and was broadly equivalent through the cell cycle [(52) and data not shown]. We therefore reasoned that the mixture of activating and repressing histone modifications may represent cells in different cell cycle states, for example, that S-phase cells would not be epigenetically responsive to VDR activation. To address this possibility, we FACS-sorted cells into different phases of the cell cycle and examined VDR-induced changes in histone modifications through the cell cycle using Carrier-ChIP (C-ChIP) approaches (53) (Figure 4).
Figure 4.

The cell cycle determines the magnitude of VDR-regulated histone modification. RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM) for 0.5 h prior to being FACS-sorted into the different phases of the cell cycle. Cells stained with Hoechst 33342 (Invitrogen), fractionated using a MoFlo cell sorter (Beckman-Coulter, High Wycombe, UK) and Summit V4.3 software (Beckman-Coulter, UK) and 5 × 105 cells/phase collected. Induced changes to repressive (H3K27me3) and activating (H3K4me3 and H3K9ac) histone modifications at R1 and the TSS on the CDKN1A promoter were interrogated using Carrier-ChIP protocols, C-ChIP was adapted from N-ChIP as previously described (46) by ‘spiking’ with SL2 cells prior to chromatin extraction and using human specific primers (Table 1). Histone modifications were assayed using N-ChIP and normalized using bound over unbound DNA pulled down with specific antibodies. Each data point represents the mean of triplicate experiments in duplicate wells ± S.E.M. (*P < 0.05, **P < 0.01).

The cell cycle determines the magnitude of VDR-regulated histone modification. RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM) for 0.5 h prior to being FACS-sorted into the different phases of the cell cycle. Cells stained with Hoechst 33342 (Invitrogen), fractionated using a MoFlo cell sorter (Beckman-Coulter, High Wycombe, UK) and Summit V4.3 software (Beckman-Coulter, UK) and 5 × 105 cells/phase collected. Induced changes to repressive (H3K27me3) and activating (H3K4me3 and H3K9ac) histone modifications at R1 and the TSS on the CDKN1A promoter were interrogated using Carrier-ChIP protocols, C-ChIP was adapted from N-ChIP as previously described (46) by ‘spiking’ with SL2 cells prior to chromatin extraction and using human specific primers (Table 1). Histone modifications were assayed using N-ChIP and normalized using bound over unbound DNA pulled down with specific antibodies. Each data point represents the mean of triplicate experiments in duplicate wells ± S.E.M. (*P < 0.05, **P < 0.01). Again, focusing on two response regions that displayed distinct activation events at 0.5 h, we revealed that after 0.5 h, 1α,25(OH)2D3 induced significant H3K27me3 enrichment at R1 in S and G2/M phase cells only (Figure 4A). At the basal level there were two pronounced differences in G1 cells compared to the other phases, with H3K9ac enrichment at R1 at the TSS (data not shown). Interestingly in bulk culture upon treatment with 1α,25(OH)2D3 H3K27me3 levels trended to enrichment after 0.5 h, however it was not significant, but this became significant when considering the individual phases of the cell cycle. Similar phase-specific patterns of H3K9ac enrichment occurred in G1 cells only at the TSS, and again this was not significant when considering bulk population cells but was when considering G1 phase cells only (Figure 4B).

Co-regulation of miR-106b is critical to regulate p21(expression

1α,25(OH)2D3 treatment up-regulated MCM7, and consequently miR-106b, in a highly similar manner to CDKN1A. That is, MCM7 accumulated at 0.25 h, miR-106b at 0.33 h, prior to the initial CDKN1A expression at 0.5 h (Figure 5A). Two VDR binding regions on the MCM7 promoter were identified in silico and demonstrated the same rate of VDR binding over the first 0.5 h compared to R2 of CDKN1A (Figure 5B). We also examined the enrichment of the same four histone modifications as measured at the CDKN1A promoter and found that only H3K9ac was clearly enriched at −7995 (0.5 h) and the TSS (1 h) (Figure 5C). In contrast the repressive histone modifications (H3K9me2 and H3K27me3) were not significantly altered at either the two VDR binding regions or the TSS. These data suggest that MCM7 has an intrinsically more responsive promoter. However, the rate is similar of VDR binding kinetics to the critical activating response elements, either R2 of the CDKN1A gene or at position −7995 of the MCM7 gene. Therefore the receptor binding kinetics alone do not explain the altered mRNA accumulation rate between the genes CDKN1A and MCM7 (Figure 5A).
Figure 5.

MiR-106b co-expression governs p21( expression and cell cycle arrest. (A) RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM) or EtOH control for indicated time points, mRNA extracted, and levels of accumulation of indicated genes measured by TaqMan Q-PCR. For miRNA quantitation, Q-PCR performed using Assay-on-Demand miR-106b and RNU48 probes. All measurements performed in technical and biological triplicate. (B) Cells were treated as in A, chromatin extracted and VDR binding to the indicated VDREs in the MCM7 promoter, and R2 on the CDKN1A promoter was measured, as indicated in Figure 2. (C) Changes to H3K9ac were assayed using N-ChIP and normalized using bound over unbound DNA pulled down with specific ChIP grade antibodies (42). N-ChIP was performed as previously described (53). Enrichment was measured by Q-PCR as above. All measurements performed in technical and biological triplicate. (D) 100nM si-miR-106b (MI0000734, Dharmacon) and scrambled constructs (IN-001005-01-05, Dharmacon) transiently transfected into cells. Following transfection, cells were treated as above. CDKN1A mRNA expression was measured by TaqMan Q-PCR as in Figure 1A. All data points on panels A and D represent the mean of triplicate experiments amplified in triplicate wells ± SEM (*P < 0.05, **P < 0.01, ***P < 0.005). (E) The effect of mir-106b knockdown on p21( expression. Cells were treated as in panel C and p21( detected by western blot as in Figure 1B, and both scr and siRNA blots exposed for 30 s. (F) The effect of 1α,25(OH)2D3 treatment on cell cycle arrest was measured in the indicated treatment groups. For FACS analysis, cells were stained with Propidium Iodide solution and run through a FACScan II (Becton Dickinson Biosciences). DNA histograms were analyzed using ModFit software (Verity Software House). Results were plotted as percent of cells seen in G1 phase and each data point represents the mean of three separate experiments ± SEM (*P < 0.05, **P < 0.01, ***P < 0.005).

MiR-106b co-expression governs p21( expression and cell cycle arrest. (A) RWPE-1 cells were treated with 1α,25(OH)2D3 (100 nM) or EtOH control for indicated time points, mRNA extracted, and levels of accumulation of indicated genes measured by TaqMan Q-PCR. For miRNA quantitation, Q-PCR performed using Assay-on-Demand miR-106b and RNU48 probes. All measurements performed in technical and biological triplicate. (B) Cells were treated as in A, chromatin extracted and VDR binding to the indicated VDREs in the MCM7 promoter, and R2 on the CDKN1A promoter was measured, as indicated in Figure 2. (C) Changes to H3K9ac were assayed using N-ChIP and normalized using bound over unbound DNA pulled down with specific ChIP grade antibodies (42). N-ChIP was performed as previously described (53). Enrichment was measured by Q-PCR as above. All measurements performed in technical and biological triplicate. (D) 100nM si-miR-106b (MI0000734, Dharmacon) and scrambled constructs (IN-001005-01-05, Dharmacon) transiently transfected into cells. Following transfection, cells were treated as above. CDKN1A mRNA expression was measured by TaqMan Q-PCR as in Figure 1A. All data points on panels A and D represent the mean of triplicate experiments amplified in triplicate wells ± SEM (*P < 0.05, **P < 0.01, ***P < 0.005). (E) The effect of mir-106b knockdown on p21( expression. Cells were treated as in panel C and p21( detected by western blot as in Figure 1B, and both scr and siRNA blots exposed for 30 s. (F) The effect of 1α,25(OH)2D3 treatment on cell cycle arrest was measured in the indicated treatment groups. For FACS analysis, cells were stained with Propidium Iodide solution and run through a FACScan II (Becton Dickinson Biosciences). DNA histograms were analyzed using ModFit software (Verity Software House). Results were plotted as percent of cells seen in G1 phase and each data point represents the mean of three separate experiments ± SEM (*P < 0.05, **P < 0.01, ***P < 0.005). Therefore, we investigated the contribution of miR-106b to control p21( expression and cell cycle arrest. Firstly intervention with miRNA knockdown approaches resulted in ∼50% knockdown and caused 1α,25(OH)2D3 treatment to induce CDKN1A accumulation to the same extent, but at a significantly earlier time point (Figures 1A, 5A and D) thus suggesting a role to control mRNA accumulation rates. In parallel, we established that the same miRNA knockdown approaches allowed p21 to be induced to a higher level (Figure 5E) leading to an enhanced 1α,25(OH)2D3 driven G1 arrest (Figure 5F). These data suggest that miR-106b also plays a role in governing translation rates, as the area under the curve of mRNA accumulation did not differ significantly with miR-106b siRNA (Figure 5D). Interestingly at later time points (22 h) miR-106b also accumulated and appears to correlate with the loss of p21( expression after 22 h (Figure 1B and Supplementary Figure S3). Finally, the relationship between Cdkn1a and miR-106b appears detectable in the prostates of normal C57 BL/6xFVB mice at 12 and 24 h post-treatment with 1α25(OH)2D3 (20 μg/kg). Notably at 12 h there was a significant increase in miR-106b and corresponding repression of Cdkn1a (Figure 6).
Figure 6.

In vivo regulation of Cdkn1a and miR-106b in murine prostate. C57 BL/6xFVB WT mice were treated with 1α,25(OH)2D3 (20 μg/kg) or equal volume of EtOH for 12 or 24 h. Mice (n = 9) in each control and treatment group were sacrificed and the prostate removed and pooled into three groups of three, mRNA extracted using TRIzol (Invitrogen), and Cdkn1a and miR-106b levels were measured by TaqMan Q-PCR. Accumulation of each target is given as log2 (fold change). Each data point represents the mean ± SEM. A significant induction of miR-106b was observed at 12 h, and at 12 and 24 h Cdkn1a was significantly repressed. (**P < 0.01).

In vivo regulation of Cdkn1a and miR-106b in murine prostate. C57 BL/6xFVB WT mice were treated with 1α,25(OH)2D3 (20 μg/kg) or equal volume of EtOH for 12 or 24 h. Mice (n = 9) in each control and treatment group were sacrificed and the prostate removed and pooled into three groups of three, mRNA extracted using TRIzol (Invitrogen), and Cdkn1a and miR-106b levels were measured by TaqMan Q-PCR. Accumulation of each target is given as log2 (fold change). Each data point represents the mean ± SEM. A significant induction of miR-106b was observed at 12 h, and at 12 and 24 h Cdkn1a was significantly repressed. (**P < 0.01).

DISCUSSION

Transcriptional kinetics, even for the same NRs, are highly variable depending upon the cell type and target gene. These ambiguities are compounded by the frequent use of cancer cell lines to study these kinetics. Problematically, these cells frequently contain corruptions to the very mechanisms being studied, including elevated NCOR1 and NCOR2/SMRT expression (25,26,54,55). This is apparent when considering the VDR where, in malignant systems, 1α,25(OH)2D3 induced CDKN1A accumulation appears highly variable, often being either significantly delayed or absent despite apparently adequate receptor expression (44,56,57). Analogous studies on the estrogen receptor α revealed rapid binding to target genes, occurring in the order of minutes, but is non-functional as it results in neither mRNA nor protein expression changes (22,58). In contrast, other NRs, interrogated with different technologies, have suggested highly rapid cycling (59). The current study informs these debates by utilizing an endogenous promoter, in a non-malignant cell system, where the response to ligand approximates closely to a normal response. Rapid and dynamic patterns of mRNA accumulation occurred for four VDR target genes, and there was a degree of response synchrony especially in early events. We established for one target, CDKN1A, that the patterns of mRNA accumulation reflected receptor and co-repressor exchanges occurring in a unique manner at each of three VDREs. In turn, these events drove unique patterns of histone modifications. Activation events occurred at only one response element (R2) after 0.5 h and were reflected by increased mRNA accumulation and protein expression. It is tempting to speculate that the immediate repressive events occurring at R3 and R1 contribute to the reduced mRNA levels for CDKN1A that occur at earlier time points. Collectively, these results support the concept that in non-malignant systems NR transcriptional responses can be rapid and functional, and faithfully lead to changes in protein. The transition through activated epigenetic states appears to allow the integration of transcriptional signals, for example through co-operation with p53 at 1 h and suggests an epigenetic basis for the observed co-operation between these two pathways (39,60–63). The co-operative effects at 1 h also support the p53 functional status of RWPE-1 cells and reflects the fact human papillomavirus 18 (HPV 18) immortalized cells do not necessarily target p53 (40). We undertook univariate linear regression analyses to identify patterns of associations within these data sets. These approaches identified the most significant association occurred after 4 h, where the locus appeared to return to a resting state, characterized by a significant association at between VDR, NCOR1 and H3K27me3 (P < 0.05) at the TSS and R1 (data not shown). These findings support an emerging view of this histone mark being more dynamically regulated than previously appreciated (64,65) and suggest its regulation is part of sequential epigenetic steps in the control of transcription. These data suggest that the regulation of H3K27me3 at specific response elements act as a marker of the return to the basal state and forms part of a biological ratchet to regulate dynamic transcriptional patterns (66). We made the further discoveries that the magnitude of epigenetic modulation was refined by the cell cycle status. ChIP approaches in FACS-sorted cells revealed that G1 phase cells were characterized by enhanced VDR-induced activating histone modifications (for example H3K9ac), with S and G2/M phases being largely repressive, for example, with H3K27me3 enrichment at region R1. Thus events, which were not significant when considering bulk populations, emerged with significant clarity when considering each specific cell cycle phase and underscore the fact that bulk culture findings represent an average event of potentially very different populations. While other NRs have been demonstrated to display cell cycle-specific phases of activation (67,68), the current study supports an underlying role for differential regulation of histone modifications through the cell cycle to govern these actions. Together these data suggest the magnitude of the CDKN1A activation, at least at early time points, is influenced significantly by the stage of the cell cycle. We added further to this understanding by establishing VDR-dependent co-regulation of miR-106b to modulate the precise timing of CDKN1A accumulation and also the expression of p21(, and consequential cell cycle arrest. Together these data demonstrate that VDR induced regulation of p21( is determined by interplay of histone modifications and miRNA expression that combine in a feed-forward loop. Key regulatory aspects of this loop are the re-distribution of VDR binding and co-repressor associations to govern histone modifications of two gene targets and the status of the cell cycle. The cell cycle component appears to open windows with which other activators may exert an effect, for example p53, to modulate the magnitude of effects. Given that the MCM7 gene is a key target of S-phase transcription factors such as the E2F family members, this loop represents a balance between transcription factors that promote either G1 arrest or S-phase progression (summarized in Figure 7). Given that NR biology appears illustrative of basic mechanisms of transcription factor control the current findings may apply generally to gene regulatory mechanisms.
Figure 7.

A proposed VDR governed feed-forward loop to control p21(. The VDR complex binds to both the CDKN1A gene [encodes p21(] and the DNA helicase gene MCM7. Over the first hour of activation only one response element on CDKN1A responds in a positive manner with loss of co-repressors and increased H3K9ac levels. The other response elements display repressive events. In parallel increased H3K9ac enrichment is observed at all response elements and the TSS of the MCM7 gene. The mixture of regulated epigenetic events on the CDKN1A promoter is significantly influenced by the status of the cell cycle and allows for cross-talk with p53, which also targets CDKN1A directly (response elements not shown) to sustain cell cycle arrest. The MCM7 gene is a target of S-phase transcription factors such as E2F family members and therefore this feed-forward loop fine tunes p21( expression in the context of cell cycle progression.

A proposed VDR governed feed-forward loop to control p21(. The VDR complex binds to both the CDKN1A gene [encodes p21(] and the DNA helicase gene MCM7. Over the first hour of activation only one response element on CDKN1A responds in a positive manner with loss of co-repressors and increased H3K9ac levels. The other response elements display repressive events. In parallel increased H3K9ac enrichment is observed at all response elements and the TSS of the MCM7 gene. The mixture of regulated epigenetic events on the CDKN1A promoter is significantly influenced by the status of the cell cycle and allows for cross-talk with p53, which also targets CDKN1A directly (response elements not shown) to sustain cell cycle arrest. The MCM7 gene is a target of S-phase transcription factors such as E2F family members and therefore this feed-forward loop fine tunes p21( expression in the context of cell cycle progression. The expression of miRNA contained within feed-forward motifs is disrupted in cancer (69,70). For example, the cellular advantage to retaining the MCM-7 promoter selectively in an active state (25) has recently been underscored in prostate cancer by establishing that miR-106b is a proto-oncogene (71). A strong emerging literature now supports the concept that tumors changes in miRNA regulation is translated to altered serum expression and therefore offers an important diagnostic and prognostic therapeutic window (72–75). In this manner, the regulation of miRNA such as miR-106b in feed-forward loop motifs may be critical biomarkers to monitor VDR responsiveness. The current studies open up the door to the possibility that serum expression of VDR tumor-regulated miRNA define molecular phenotypes associated with prostate cancer aggressiveness and responsiveness to vitamin D compound treatment.

SUPPLEMENTARY DATA

Supplementary Data are available at NAR Online.

FUNDING

Funding for open access charge: M.J.C. acknowledges the support of NucSys, a European Community FP6-Marie Curie Research Training Network, the Biotechnology and Biological Sciences Research Council, and in part, support from National Institute of Health grants RO1 CA095367-06 and 2R01-CA-095045-06, and the NCI Cancer Center Support Grant to the Roswell Park Cancer Institute [CA016056]. B.M.T. is supported by program grant C1015/A9077 from Cancer Research UK. Conflict of interest statement. None declared.
  74 in total

1.  Synergistic growth inhibition of prostate cancer cells by 1 alpha,25 Dihydroxyvitamin D(3) and its 19-nor-hexafluoride analogs in combination with either sodium butyrate or trichostatin A.

Authors:  S F Rashid; J S Moore; E Walker; P M Driver; J Engel; C E Edwards; G Brown; M R Uskokovic; M J Campbell
Journal:  Oncogene       Date:  2001-04-05       Impact factor: 9.867

2.  Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation.

Authors:  Laura Poliseno; Leonardo Salmena; Luisa Riccardi; Alessandro Fornari; Min Sup Song; Robin M Hobbs; Paolo Sportoletti; Shorheh Varmeh; Ainara Egia; Giuseppe Fedele; Lucia Rameh; Massimo Loda; Pier Paolo Pandolfi
Journal:  Sci Signal       Date:  2010-04-13       Impact factor: 8.192

3.  Circulating microRNAs as stable blood-based markers for cancer detection.

Authors:  Patrick S Mitchell; Rachael K Parkin; Evan M Kroh; Brian R Fritz; Stacia K Wyman; Era L Pogosova-Agadjanyan; Amelia Peterson; Jennifer Noteboom; Kathy C O'Briant; April Allen; Daniel W Lin; Nicole Urban; Charles W Drescher; Beatrice S Knudsen; Derek L Stirewalt; Robert Gentleman; Robert L Vessella; Peter S Nelson; Daniel B Martin; Muneesh Tewari
Journal:  Proc Natl Acad Sci U S A       Date:  2008-07-28       Impact factor: 11.205

4.  Do sunlight and vitamin D reduce the likelihood of colon cancer?

Authors:  C F Garland; F C Garland
Journal:  Int J Epidemiol       Date:  1980-09       Impact factor: 7.196

5.  Kinetic complexity of the global response to glucocorticoid receptor action.

Authors:  Sam John; Thomas A Johnson; Myong-Hee Sung; Simon C Biddie; Saskia Trump; Christine A Koch-Paiz; Sean R Davis; Robert Walker; Paul S Meltzer; Gordon L Hager
Journal:  Endocrinology       Date:  2009-01-08       Impact factor: 4.736

6.  Coregulator recruitment and histone modifications in transcriptional regulation by the androgen receptor.

Authors:  Zhigang Kang; Olli A Jänne; Jorma J Palvimo
Journal:  Mol Endocrinol       Date:  2004-08-12

7.  Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-dihydroxyvitamin D3.

Authors:  E Abe; C Miyaura; H Sakagami; M Takeda; K Konno; T Yamazaki; S Yoshiki; T Suda
Journal:  Proc Natl Acad Sci U S A       Date:  1981-08       Impact factor: 11.205

8.  Effect of Hoechst 33342 staining on developmental competence of prepubertal goat oocytes.

Authors:  Esther Velilla; Manel López-Béjar; Elisabet Rodríguez-González; Francesca Vidal; Maria-Teresa Paramio
Journal:  Zygote       Date:  2002-08       Impact factor: 1.442

9.  1,25-dihydroxyvitamin D3 receptors in human epithelial cancer cell lines.

Authors:  K Colston; M J Colston; A H Fieldsteel; D Feldman
Journal:  Cancer Res       Date:  1982-03       Impact factor: 12.701

10.  p53-Repressed miRNAs are involved with E2F in a feed-forward loop promoting proliferation.

Authors:  Ran Brosh; Reut Shalgi; Atar Liran; Gilad Landan; Katya Korotayev; Giang Huong Nguyen; Espen Enerly; Hilde Johnsen; Yosef Buganim; Hilla Solomon; Ido Goldstein; Shalom Madar; Naomi Goldfinger; Anne-Lise Børresen-Dale; Doron Ginsberg; Curtis C Harris; Yitzhak Pilpel; Moshe Oren; Varda Rotter
Journal:  Mol Syst Biol       Date:  2008-11-25       Impact factor: 11.429

View more
  35 in total

Review 1.  Vitamin D and cancer: a review of molecular mechanisms.

Authors:  James C Fleet; Marsha DeSmet; Robert Johnson; Yan Li
Journal:  Biochem J       Date:  2012-01-01       Impact factor: 3.857

2.  MicroRNA-32 upregulation by 1,25-dihydroxyvitamin D3 in human myeloid leukemia cells leads to Bim targeting and inhibition of AraC-induced apoptosis.

Authors:  Elzbieta Gocek; Xuening Wang; Xiuping Liu; Chang-Gong Liu; George P Studzinski
Journal:  Cancer Res       Date:  2011-08-04       Impact factor: 12.701

Review 3.  Vitamin D receptor and RXR in the post-genomic era.

Authors:  Mark D Long; Lara E Sucheston-Campbell; Moray J Campbell
Journal:  J Cell Physiol       Date:  2015-04       Impact factor: 6.384

Review 4.  Inflammation and Nutritional Science for Programs/Policies and Interpretation of Research Evidence (INSPIRE).

Authors:  Daniel J Raiten; Fayrouz A Sakr Ashour; A Catharine Ross; Simin N Meydani; Harry D Dawson; Charles B Stephensen; Bernard J Brabin; Parminder S Suchdev; Ben van Ommen
Journal:  J Nutr       Date:  2015-04-01       Impact factor: 4.798

5.  Inecalcitol, an analog of 1α,25(OH)(2) D(3) , induces growth arrest of androgen-dependent prostate cancer cells.

Authors:  Ryoko Okamoto; Remi Delansorne; Naoki Wakimoto; Ngan B Doan; Tadayuki Akagi; Michelle Shen; Quoc H Ho; Jonathan W Said; H Phillip Koeffler
Journal:  Int J Cancer       Date:  2011-08-27       Impact factor: 7.396

Review 6.  1α,25(OH)2D3 differentially regulates miRNA expression in human bladder cancer cells.

Authors:  Yingyu Ma; Qiang Hu; Wei Luo; Rachel N Pratt; Sean T Glenn; Song Liu; Donald L Trump; Candace S Johnson
Journal:  J Steroid Biochem Mol Biol       Date:  2014-09-26       Impact factor: 4.292

7.  Dexamethasone enhances 1alpha,25-dihydroxyvitamin D3 effects by increasing vitamin D receptor transcription.

Authors:  Alejandro A Hidalgo; Kristin K Deeb; J Wesley Pike; Candace S Johnson; Donald L Trump
Journal:  J Biol Chem       Date:  2011-08-25       Impact factor: 5.157

8.  VDR regulation of microRNA differs across prostate cell models suggesting extremely flexible control of transcription.

Authors:  Prashant K Singh; Mark D Long; Sebastiano Battaglia; Qiang Hu; Song Liu; Lara E Sucheston-Campbell; Moray J Campbell
Journal:  Epigenetics       Date:  2015-01-29       Impact factor: 4.528

9.  Pan-cancer analyses of the nuclear receptor superfamily.

Authors:  Mark D Long; Moray J Campbell
Journal:  Nucl Receptor Res       Date:  2015-12-15

Review 10.  The sum of many small changes: microRNAs are specifically and potentially globally altered by vitamin D3 metabolites.

Authors:  Angeline A Giangreco; Larisa Nonn
Journal:  J Steroid Biochem Mol Biol       Date:  2013-01-16       Impact factor: 4.292

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.