Worldwide diversity of Klebsiella pneumoniae that produce beta-lactamase blaKPC-2 gene.

Klebsiella pneumoniaeisolates that produce carbapenemases (KPCs) are rapidly disseminating worldwide. To determine their genetic background, we investigated 16 blaKPC-2-harboring K. pneumoniae isolates from 5 countries. The isolates were multidrug resistant, possessed the blaKPC-2 gene, and differed by additional Beta-lactamase content. They harbored a naturally chromosome-encoded bla gene (blaSHV-1 [12.5%], blaSHV-11 [68.7%], or blaOKP-AVB [18.8%]) and several acquired and plasmid-encoded genes (blaTEM-1 [81.3%], blaCTX-M-2 [31.3%], blaCTX-M-12 [12.5%], blaCTX-M-15 [18.7%], and blaOXA-9 [37.5%]). The blaKPC-2 gene was always associated with 1 of the Tn4401 isoforms (a, b, or c). Tn4401 was inserted on different-sized plasmids that belonged to different incompatibility groups. Several blaKPC-containing K. pneumoniae clones were found: 9 different pulsotypes with 1 major (sequence type 258) and 7 minor distinct allelic profiles. Different clones harboring different plasmids but having identical genetic structure, Tn4401, could be at the origin of the worldwide spread of this emerging resistance gene.

Resistance of Klebsiella pneumoniae to carbapenems is mainly associated with acquired carbapenem-hydrolyzing β-lactamases (). These β-lactamases can be metallo β-lactamases (IMP, VIM), expanded-spectrum oxacillinases (OXA-48), or Ambler class A enzymes (NMCA, IMI, SME, GES, and KPC) (–). The most common class A carbapenemases in K. pneumoniae are the K. pneumoniae carbapenemases (KPCs) (). KPCs in carbapenem-resistant K. pneumoniae strains were first reported in 2001 in North Carolina (), and until 2005, the geographic distribution of these enzymes in Enterobacteriaceae, including K. pneumoniae, was limited to the eastern part of the United States (,). Now, KPC-producing K. pneumoniae isolates are frequently identified among nosocomial pathogens (). Recently, dissemination of a single major clone of KPC-producing K. pneumoniae (sequence type [ST] 258) in the eastern United States has been suggested (). KPCs have been observed more rarely among other gram-negative rods such as Pseudomonas spp (,).

Outside the United States, KPC-producing K. pneumoniae are also being reported more often. The first case of KPC-producing K. pneumoniae infection was reported in 2005 in France and had a US origin (). The first outbreak of KPC-producing K. pneumoniae outside the United States was in Israel (). In South America, dissemination of KPC-producing K. pneumoniae was initially reported in 2006 in Colombia () and then in Brazil and Argentina (,). KPC enzymes have also been identified in P. aeruginosa isolates from Colombia (). In the People’s Republic of China, KPC enzymes in several enterobacterial species are being increasingly reported (). Finally, in Europe a few cases of KPC-producing K. pneumoniae infection have been described, but in Greece, outbreaks have occurred (). In Europe, different variants of KPCs (KPC-2 and KPC-3) have been described; some patients carrying KPC-positive isolates had been transferred from the United States, Israel, or Greece (–).

Reports of this β-lactamase being found in novel locations are increasing worldwide, probably signaling active spread. The genetic element carrying the blaKPC-2 gene, Tn4401, was recently elucidated (). Three isoforms of this Tn3-like transposon (a, b, and c) are known. Several other genetic environments of blaKPC gene have been described; other insertion sequences have been found upstream of the blaKPC gene (,). Nevertheless, the downstream sequences of the blaKPC gene matched perfectly with Tn4401, which suggests that these insertion sequences have been inserted into Tn4401.

Insertion sequences may play major roles in the evolution of Tn4401, but little information is available about the bacterial strains and the plasmids that may explain this rapid spread. Our goal, therefore, was to characterize the genetic background of several blaKPC-2- harboring K. pneumoniae isolates from various geographic origins.

Materials and Methods

Bacterial Strains

K. pneumoniae isolates used in this study and their origin are listed in Table 1 (,,,,). Electrocompetent Escherichia coli DH10B (Invitrogen, Eragny, France) was used as a recipient in electroporation experiments. E. coli J53AzR, which is resistant to sodium azide, was used for conjugation experiments. E. coli 50192 was used as a reference strain for plasmid extraction ().

Table 1

Geographic origin and structure of Tn4401 and other β-lactamases of Klebsiella pneumoniae isolates*

Isolate no.	Isolate type	Origin	PCR result
			KPC-2	Tn4401					Other β-lactamases
				TnpA	ISKPN7	ISKPN6	Deletion, bp		SHV	TEM	CTX-M	OXA
1	YC	USA	+	+	+	+	–100		SHV-11	TEM-1	–	OXA-9
2	GR	Greece	+	+	+	+	–100		SHV-11	TEM-1	–	OXA-9
3	K271	Sweden	+	+	+	+	–100		SHV-11	TEM-1	–	OXA-9
4	KN2303	Colombia	+	+	+	+	None		SHV-11	–	–	–
5	KN633	Colombia	+	+	+	+	None		OKP-A	TEM-1	CTX-M-12	–
6	INC H1521-6	Colombia	+	+	+	+	None		SHV-1	TEM-1	CTX-M-15	–
7	INC H1516-6	Colombia	+	+	+	+	None		SHV-1	TEM-1	CTX-M-15	–
8	HPTU 27635	Colombia	+	+	+	+	None		OKP-B	–	–	–
9	HPTU 2020532	Colombia	+	+	+	+	None		OKP-A	TEM-1	CTX-M-12	–
10	A28006	Brazil	+	+	+	+	None		SHV-11	TEM-1	CTX-M-2	–
11	A28008	Brazil	+	+	+	+	None		SHV-11	TEM-1	CTX-M-2	–
12	A28009	Brazil	+	+	+	+	None		SHV-11	TEM-1	CTX-M-2	–
13	A28011	Brazil	+	+	+	+	None		SHV-11	TEM-1	CTX-M-2	OXA-9
14	A33504	Brazil	+	+	+	+	None		SHV-11	TEM-1	CTX-M-2	OXA-9
15	475	Israel	+	+	+	+	–200		SHV-11	–	CTX-M-15	–
16	588	Israel	+	+	+	+	–200		SHV-11	TEM-1	–	OXA-9

*KPC, K. pneumoniae carbapenemase.

Antibiograms and MIC Determinations

Antibiograms were created by using the disk-diffusion method on Mueller-Hinton agar (Bio-Rad Laboratories, Marnes-La-Coquette, France), and susceptibility break points were determined as previously described and interpreted as recommended by the Clinical and Laboratory Standards Institute (,). All plates were incubated at 37°C for 18 h. MICs of β-lactams were determined by using the Etest technique (bioMérieux, Marcy l’Etoile, France).

Electroporation and Plasmid Extraction

Direct transfer of resistance into azide-resistant E. coli J53 was attempted as reported (). Plasmids were introduced by electroporation into E. coli DH10B () by using a Gene Pulser II (Bio-Rad Laboratories).

Plasmid DNA was extracted by using a QIAGEN Plasmid Maxi Kit (QIAGEN, Courtaboeuf, France) and analyzed by agarose gel electrophoresis (Invitrogen, Paris, France). Natural plasmids were extracted by using the Kieser extraction method () and subsequently analyzed by electrophoresis on a 0.7% agarose gel.

Hybridization

DNA–DNA hybridization was performed as described by Sambrook et al. () with Southern transfer of an agarose gel containing Kieser method–extracted total DNA. The probe consisted of a 796-bp PCR-generated fragment from recombinant plasmid pRYC-1 () and was internal to the blaKPC-2 gene. Labeling of the probe and detection of signal were conducted by using an ECL nonradioactive labeling and detection kit according to the manufacturer's instructions (Amersham Biosciences, Orsay, France).

PCR Amplification and Sequencing

The blaCTX-M-, blaSHV-, blaTEM-, and blaOXA-1/9-like genes were searched for and characterized as described (). PCR experiments were performed on an ABI 2700 thermocycler (Applied Biosystems, Les Ulis, France) by using laboratory-designed primers (Table 2). PCR products were then analyzed on agarose gel and sequenced.

Table 2

Primers used for PCR of Klebsiella pneumoniae isolates producing β-lactamase blaKPC-2 gene*

Primer name	Primer no.†	Sequence, 5′ → 3′
KpcA	1	CTGTCTTGTCTCTCATGGCC
KpcB	2	CCTCGCTGTGCTTGTCATCC
4281	3	GGCACGGCAAATGACTA
4714	4	GAAGATGCCAAGGTCAATGC
EcoRIout	5	CACCCGACCTGGACGAACTA
3′YCEnd	6	GCATCAAACGGAAGCAAAAG
3781L	7	CACAGCGGCAGCAAGAAAGC
3098U	8	TGACCCTGAGCGGCGAAAGC
905L	9	GCGACCGGTCAGTTCCTTCT
816U	10	CACCTACACCACGACGAACC
141R-6	11	TCACCGGCCCTCACCTTTGG
5′endYC	12	CTTAGCAAATGTGGTGAACG
Pre-SHV-5 U	–	GGTCAGCGCGAGAAGCATCC
Pre-SHV-5 L	–	AAATAGCGTTCATCGTCAAT
Pre-TEM 1	–	GTATCCGCTCATGAGACAATA
Pre-TEM 2	–	TCTAAAGTATATATGAGTAAACTTGGTCTG
OXA-9 A	–	TTCGTTTCCGCCACTCTCCC
OXA-9 B	–	ACGAGAATATCCTCTCGTGC
CTX-M A	–	CGCTTTGCGATGTGTCAG
CTX-M B	–	ACC GCG ATA TCG TTG GT

*Primers from ().
†Numbers correspond to those in Figure 1, panel A. – indicates primer not shown in Figure 1, panel A.

Figure 1

A) Schematic representation of Tn4401 isoforms on plamids of Klebsiella pneumoniae isolates that produce K. pneumoniae carbapenemases (KPCs). Genes and their corresponding transcription orientations are indicated by horizontal arrows. Gray triangles represent the inverted repeats left (IRL) and right (IRR) of Tn4401. Small and empty triangles represent the inverted repeats of ISKpn6 and ISKpn7. Target site duplications (TSD) are indicated above the sequence. Primers listed in Table 2 are shown below, with results of PCRs for each isolate. B) PCR results with primers 7 and 8 (Table 2). Lane 1, K. pneumoniae YC (); lane 2, K. pneumoniae GR (); lane 3, K. pneumoniae K271 (); lane 4, K. pneumoniae KN2303 (); lane 5, K. pneumoniae KN633 (); lane 6, K. pneumoniae INC H1521-6; lane 7, K. pneumoniae INC H1516-6; lane 8, K. pneumoniae HPTU 27635; lane 9, K. pneumoniae HPTU 2020532; lane 10, K. pneumoniae A28006 (); lane 11, K. pneumoniae A28008 (); lane 12, K. pneumoniae A28009 (); lane 13, K. pneumoniae A28011 (); lane 14, K. pneumoniae A33504 (); lane 15, K. pneumoniae 475; lane 16, K. pneumoniae 588.

Both strands of the PCR products were sequenced by using laboratory-designed primers with an automated sequencer (ABI PRISM 3100; Applied Biosystems). The nucleotide and the deduced protein sequences were analyzed by using software from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov).

Isoelectrofocusing

Crude β-lactamase extracts, obtained as described () from 10-mL cultures of clinical isolates and their E. coli transconjugants or electroporants were subjected to analytical isoelectrofocusing on an ampholine-containing polyacrylamide gel, pH 3.5–9.5 (Ampholine PAG plate; GE Healthcare, Orsay, France) for 90 min at 1,500 volts, 50 milliamps, and 30 watts. The focused β-lactamases were detected by overlaying the gel with 1 mmol nitrocefin (Oxoid, Dardilly, France). Isoelectric points were determined and compared with those of known β-lactamases ().

Pulsed-field Gel Electrophoresis

Pulsed-field gel electrophoresis (PFGE) was performed by using XbaI (GE Healthcare) as described (). XbaI-macrorestriction patterns were interpreted according to the recommendations of Tenover et al. ().

Multilocus Sequence Typing

Multilocus sequence typing (MLST) with 7 housekeeping genes (rpoB, gapA, mdh, pgi, phoE, infB, and tonB) was performed according to Diancourt et al. (). Allele sequences and STs were verified at http://pubmlst.org/kpneumoniae. A different allele number was given to each distinct sequence within a locus, and a distinct ST number was attributed to each distinct combination of alleles.

Replicon and Transposon Typing

PCR-based replicon typing of the main plasmid incompatibility groups reported for Enterobacteriaceae was performed as described (). Genetic structures surrounding the blaKPC-2 gene were determined according to the Tn4401 PCR-mapping scheme as described ().

Results

Pulsotypes

Molecular typing by PFGE identified 9 major pulsotypes among the isolates (Table 3). The first pulsotype (pulsotype A) corresponded to the strains from the United States and Greece. We found 4 different pulsotypes (B–E) among strains from Colombia, which suggested polyclonal diffusion inside this country. We also identified 2 different clones among strains from Brazil (pulsotypes F and G) and from Israel (pulsotypes H and I). These results indicate much heterogeneity among KPC-producing isolates from various geographic regions.

Table 3

Plasmid analysis, pulsotype, and sequence type of Klebsiella pneumoniae isolates from 5 countries*

Isolate no.	Isolate name	Plasmids		PFGE type	MLST							ST
		Size, kb	Inc		gap	infB	mdh	pgi	phoE	rpo	tonB
1	YC	80	FiiAS	A	3	3	1	1	1	1	79	258
2	GR	80	FiiAS	A	3	3	1	1	1	1	79	258
3	K271	80	FiiAS	A	3	3	1	1	1	1	79	258
4	KN2303	75, 35	N	B	2	1	11	1	1	1	13	337
5	KN633	12	ND	C	17	19	22†	39	34†	21	52	338
6	INC H1521-6	75	L/M	D	1	6	1	1	1	1	1	14
7	INC H1516-6	75	L/M	D	1	6	1	1	1	1	1	14
8	HPTU 27635	35	L/M	E	18	15	25†	24	11†	13	51	339
9	HPTU 2020532	12	ND	C	17	19	22†	39	34†	21	52	338
10	A28006	12	L/M	F	3	3	1	1	1	1	4	11
11	A28008	12	L/M	F	3	3	1	1	1	1	4	11
12	A28009	12	L/M	F	3	3	1	1	1	1	4	11
13	A28011	12	L/M	F	3	3	1	1	1	1	4	11
14	A33504	50	ND	G	3	3	1	1	1	1	4	11
15	475	80	N	H	3	1	1	1	1	1	43	277
16	588	70	N	I	3	3	1	1	1	1	18	340

*Countries shown in Table 1. PFGE, pulsed-field gel electrophoresis; MLST, multilocus sequence type; ST, sequence type; ND, could not be determined with the Inc primers tested.
†Alleles are variants of previously described alleles (Figure 2).

Figure 2

A) Plasmid extractions of culture of clinical Klebsiella pneumoniae isolates that produce β-lactamase blaKPC-2 gene. B) Southern hybridization of transferred plasmid extraction, conducted with an internal probe for blaKPC-2. Lane 1, K. pneumoniae YC (); lane 2, K. pneumoniae GR (); lane 3, K. pneumoniae K271 (); lane 4, K. pneumoniae KN2303 (); lane 5, K. pneumoniae KN633 (); lane 6, K. pneumoniae INC H1521-6; lane 7, K. pneumoniae INC H1516-6; lane 8, K. pneumoniae HPTU 27635; lane 9, K. pneumoniae HPTU 2020532; lane 10, K. pneumoniae A28006 (); lane 11, K. pneumoniae A28008 (); lane 12, K. pneumoniae A28009 (); lane 13, K. pneumoniae A28011 (); lane 14, K. pneumoniae A33504 (); lane 15, K. pneumoniae 475; lane 16, K. pneumoniae 588; and lane 17, Escherichia coli 50192 harboring 4 plasmids (7, 48, 66, and 154 kb).

MLST of the 16 isolates resulted in 8 distinct allelic profiles: ST 258 (allelic profile 3–3-1–1-1–1-79) corresponding to isolates K. pneumoniae YC (United States), K. pneumoniae GR (Greece), and K. pneumoniae K271 (Greece); ST 14 (allelic profile 1–6-1–1-1–1-1) corresponding to isolates K. pneumoniae INC H1521–6 and K. pneumoniae INC H1516–6 (Colombia); ST 11 (allelic profile 3–3-1–1-1–1-4) corresponding to isolates from Brazil; ST 277 (allelic profile 3–1-1–1-1–1-43) corresponding to isolate K. pneumoniae 475 (Israel); novel ST 337 (allelic profile 2–1-11–1-1–1-13) corresponding to isolate K. pneumoniae KN2303 (Colombia); ST 338 (allelic profile 17–19–22–39–34–21–52) corresponding to isolates K. pneumoniae KN633 and K. pneumoniae HPTU 2020532 (Colombia); ST 339 (allelic profile 18–15–25–24–11–13–51) corresponding to isolate K. pneumoniae HPTU 27635 (Colombia); and ST 340 (allelic profile 3–3-1–1-1–1-18) corresponding to isolate K. pneumoniae 588 (Israel). The analysis of STs by eBURST (http://pubmlst.org) showed that ST 11 and ST 340 are single-locus variants of ST 258 and that ST 277 is a double-locus variant of ST 258. These results matched perfectly with PFGE results. One isolate from Brazil (K. pneumoniae A33504) showed a different pattern by PFGE but the same ST (ST 11) as other isolates from the same origin, which suggests a strong genetic relatedness.

Antimicrobial Drug Susceptibility

All isolates were resistant to penicillins and cephalosporins but showed varying levels of susceptibility to carbapenems (Table 4). Resistance to other drug classes varied among the isolates. For aminoglycosides, 2 clones (A and I) were susceptible to gentamicin only, 1 clone (H) was susceptible to amikacin only, and 3 clones (C, D, and G) were resistant to all tested aminoglycosides. Six clones (A, C, D, F, G, and I) showed resistance to fluoroquinolones. Percentages of nonsusceptible isolates to the non–β-lactam drugs were as follows: gentamicin, 75%; amikacin, 81.3%; ciprofloxacin, 81.5%; trimethoprim/sulfamethoxazole, 81.5%; and tetracycline, 87.5%. Two isolates were also resistant to colistin (K. pneumoniae GR and K. pneumoniae K271); each was from Greece, where this drug is often used ().

Table 4

MICs of carbapenems for clinical Klebsiella pneumoniae isolates expressing KPC-2 β-lactamase*

Isolate type	Carbapenem MIC, mg/L
	Imipenem	Meropenem	Ertapenem
YC	4	2	24
GR	12	6	12
K271	4	4	16
KN2303	>32	>32	>32
KN633	>32	4	>32
INC H1521-6	6	3	8
INC H1516-6	4	4	32
HPTU 27635	4	2	12
HPTU 2020532	16	16	24
A28006	16	32	24
A28008	24	16	32
A28009	>32	>32	>32
A28011	>32	>32	>32
A33504	>32	>32	>32
475	16	>32	>32
588	24	16	32

*KPC, K. pneumoniae carbapenemase.

β-Lactamase Genes

Positive results of CTX-M–, TEM-, SHV-, and OXA-specific PCRs are indicated in Table 1. All isolates possessed the blaKPC-2 gene and a naturally chromosome-encoded bla gene: blaSHV-1 (12.5%), blaSHV-11 (68.7%), or blaOKP-A/B (18.8%). The blaOKP genes are 1 of the 3 families of the chromosomal β-lactamase genes found in K. pneumoniae () with blaSHV and blaLEN and share 88% similarity with blaSHV-1. K. pneumoniae isolates also harbored several acquired and plasmid-encoded genes: blaTEM-1 (81.3%), blaCTX-M-2 (31.3%), blaCTX-M-12 (12.5%), blaCTX-M-15 (18.7%), and blaOXA-9 (37.5%).

Characterization Results for Tn4401

Primer couples specific for the different genes found on Tn4401 (Table 2; Figure 1, panel A) obtained similar-sized fragments for all strains, which suggests that the strains have a similar genetic organization. For only 1 primer pair, hybridizing in ISKpn7 and blaKPC gene (primers 7 and 8 in Figure 1, panel A), located upstream of the blaKPC gene, an ≈100-bp (K. pneumoniae YC, K. pneumoniae GR, and K. pneumoniae 271) or 200-bp (K. pneumoniae 475 and K. pneumoniae 588) shorter fragment was observed, compared with the Tn4401b structure, thus indicating that the 3 isoforms of Tn4401 were present in this collection of isolates (Figure 1, panel B).

To investigate the flanking sequences of Tn4401, we used PCR primers located in the Tn4401 structure and in the flanking sequences derived from K. pneumoniae YC (). PCR products of expected size were obtained for K. pneumoniae GR and K. pneumoniae K271 isolates only. For all other strains, no PCR product could be obtained, suggesting that the Tn4401 insertion site might differ from that found in K. pneumoniae YC.

Genetic Support for blaKPC in the Isolates

The carbapenem-resistant K. pneumoniae isolates contained several plasmids of different sizes, ranging from <5 kb to >170 kb (Figure 2, left panel). At least 1 plasmid hybridized with an internal probe for blaKPC-2 gene in each isolate, ranging from 13 kb to 80 kb (Figure 2, right panel; Table 3). We observed 2 hybridization signals (35 kb and 75 kb) for K. pneumoniae KN2303, as described (). Plasmid location of the blaKPC genes was confirmed by electroporation of these plasmids into E. coli DH10B, but no transformant could be obtained for K. pneumoniae 2020532. The E. coli transformants had a β-lactam resistance pattern that corresponded to the expression of a blaKPC-like gene. Electroporation of 4 plasmids harboring the blaKPC-like gene into E. coli DH10B conferred resistance to at least an aminoglycoside molecule; pINC-H1521–6, pA33504, and p588 conferred resistance to all aminoglycosides except gentamicin, and electroporation of p475 into E. coli DH10B led to resistance to all aminoglycosides tested. No other antimicrobial drug resistance marker was cotransferred; the transformants remained susceptible to nalidixic acid, levofloxacin, ciprofloxacin, rifampin, tetracycline, trimethoprim/sulfamethoxazole, and colistin.

Mating-out assays showed that the ≈75–80-kb plasmids harboring blaKPC-2 from K. pneumoniae YC, GR, K271, and KN2303 were self-transferable to E. coli. The smaller plasmid from K. pneumoniae KN633 was not transferred to E. coli.

Origin of Replication

PCR-based replicon typing of the major plasmid incompatibility groups showed that the blaKPC-2-positive plasmids belonged to at least 3 incompatibility groups (IncFIIAS, IncN, and IncL/M) (Table 3). The plasmids of K. pneumoniae KN633, HPTU-2020532 from Colombia and K. pneumoniae A33504 from Brazil gave negative results with the Inc primers tested and could not be classified into a major plasmid incompatibility group.

Discussion

Rapid spread of KPC-producing K. pneumoniae is a major clinical and public health concern. These broad-spectrum β-lactamases are increasing in new locations worldwide, indicating an ongoing process. Recently, a novel Tn3-based transposon, Tn4401, was identified in nonclonally related KPC-producing K. pneumoniae and P. aeruginosa isolates (). This transposon is in most recently described isolates (,,), although a recently characterized novel variant from China had another insertion sequence inserted upstream of blaKPC gene (). Identification of Tn4401 inserted at different loci, on different plasmids, and flanked by different 5-bp target site duplications indicates a frequent and dynamic process of transposition. It has been suggested that this novel transposon is at the origin of blaKPC-like gene acquisition and dissemination (). Sixteen K. pneumoniae isolates that express the blaKPC gene from 5 countries were characterized here.

PFGE and MLST showed that several clones are currently spreading in different geographic locations. In Colombia, 3 pulsotypes could be identified. Overall, among the 16 isolates, 1 major ST (258) and its derivative ST 11 seemed to predominate. In a recent study that gathered isolates from 10 US states, ST 258 accounted for 70% of isolates, according to a database of KPC-producing K. pneumoniae PFGE results maintained by the Centers for Disease Control and Prevention (). This ST has also been identified for KPC-producing K. pneumoniae in Sweden (in isolates imported from Greece and Israel) and more recently in Poland (,). These findings suggest possible international dissemination of KPC-producing ST 258. Apparently, the K. pneumoniae clone that contains the extended-spectrum β-lactamase (ESBL) determinant CTX-M-15 belongs to ST 11 ().

KPC-producing K. pneumoniae contained diverse β-lactamases. All except 2 isolates harbored at least another β-lactamase; blaTEM-1 and a blaCTX-M-type ESBLs were expressed by >80% and 62.5% of isolates, respectively. KPC producers have already been associated with other β-lactamase genes, such as the widespread ESBL gene blaCTX-M-15 (). SHV ESBLs have been found among isolates, as has been described for strains from the United States () and Norway (). These additional β-lactamases are likely to complicate phenotype-based identification of KPC producers. Three isolates harbored the chromosome-encoded blaOKP-A/B genes and belonged to phylogenetic group KpII, which accounts for <10% of K. pneumoniae strains (). Coexpression of OKP enzymes and ESBLs has rarely been reported.

Isolates also demonstrated diversity in their molecular features. In this study, the KPC-2 genes were encoded on a broad variety of plasmids, as shown by previous studies (,). These plasmids differed in size and incompatibility groups. Similar plasmids were observed among isolates with the same ST, whereas different plasmids were also associated with similar STs. Therefore, epidemiologic investigation of KPC producers should be performed at different molecular levels.

Tn4401 was present in all tested strains. The overall structure of Tn4401 seemed to be conserved, except for the 100-bp to 200-bp deletion. Of the 16 isolates, 11 encoded the full-length Tn4401b isoform, 3 encoded the Tn4401a isoform containing a 100-bp deletion (ST 258), and 2 encoded the Tn4401c isoform containing a 200-bp deletion upstream of the blaKPC gene. These types of transposons tend to evolve by capturing various insertion sequences, as illustrated for the vanA-containing Tn1546 transposon (). For Tn4401, three descriptions have been published in which different insertion sequences were present upstream of blaKPC-2 (–). None of these atypical structures were found in our strains. Observation of Tn4401 on different plasmids further supports the hypothesis that this transposon contributes to the mobilization and dissemination of the blaKPC genes.

Our analysis of several K. pneumoniae isolates from 5 geographic origins indicates the spread of different clones that were harboring different plasmids but with an identical genetic structure, Tn4401, that sustained a blaKPC gene acquisition, which could likely be at the origin of the worldwide spread of this emerging resistance gene. Finally, taken together, our findings and those of recent studies report a major KPC-producing clone with ST 258, even if novel ST types could also be evidenced, especially from Colombia. Our data suggest that KPC genes benefit all molecular ingredients (transposon location, self-transferable plasmids, efficient STs) by facilitating their rapid spread to K. pneumoniae and other bacterial species.