Literature DB >> 20705731

Mechanisms behind variation in the Clostridium difficile 16S-23S rRNA intergenic spacer region.

Alexander Indra1, Marion Blaschitz2, Silvia Kernbichler2, Udo Reischl3, Guenther Wewalka2, Franz Allerberger2.   

Abstract

Clostridium difficile infection is an increasing problem in hospitals worldwide, mainly due to the recent emergence of a hypervirulent C. difficile strain. C. difficile PCR ribotyping, based on size variation of the 16S-23S rRNA intergenic spacer region (16S-23S ISR), is widely used in Europe for molecular epidemiological investigation. The mechanism underlying the 16S-23S ISR size variations in the genome of C. difficile is currently not completely understood. To elucidate this mechanism, isolates of six different PCR ribotypes were analysed by cloning and sequencing the 16S-23S ISR. A direct repeat, IB, of 9 bp was detected up to five times in the 16S-23S ISR in all 47 clones investigated. Thirty-five clones displayed differences either by ribotype or by nucleotide sequence. The sequences of the 16S-23S ISR of C. difficile showed a uniformly organized structure, composed of a tRNA(Ala) gene and spacers of 33 and 53 bp separated by the 9 bp direct repeat IB. The results of the study support the hypothesis that this composition is responsible for the length variations seen in the 16S-23S ISR, and indicate that these length variations result from slipped-strand mispairing and intra- and possibly interchromosomal homologous recombination.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20705731      PMCID: PMC3090617          DOI: 10.1099/jmm.0.020792-0

Source DB:  PubMed          Journal:  J Med Microbiol        ISSN: 0022-2615            Impact factor:   2.472


INTRODUCTION

In recent years, Clostridium difficile infection has become a major problem in hospital environments worldwide. The occurrence of a hypervirulent strain, PCR ribotype 027, toxinotype III, North American pulsed-field type 1 (NAP1), was first described in Canada (Pépin ). In the USA, cases of C. difficile type 027 infection have been reported from at least 38 states. By 2008, type 027 had been detected throughout Europe (Kuijper ). Nosocomial transmission and the use of antibiotics are the main drivers of C. difficile infection (Pépin ). Recently, an assumption of zoonotic transmission was corroborated by repeated demonstrations of an epidemiological connection between PCR ribotype 078 infections emerging in the Netherlands and its occurrence in pigs (Debast ; Goorhuis ). Disease due to C. difficile is associated with a wide range of clinical manifestations ranging from mild diarrhoea, through moderately severe illness with watery diarrhoea, to life-threatening and sometimes fatal pseudomembranous colitis, which can be accompanied by toxic megacolon or perforation of the bowel. Several typing methods, such as PFGE, repetitive extragenic palindromic PCR, restriction endonuclease analysis and PCR ribotyping, have been developed for C. difficile; however, they are hampered by problems concerning interlaboratory exchangeability, reproducibility and comparability (Killgore ). Slipped-strand mispairing, point mutations and insertion of transposon elements are the main mechanisms for the occurrence of distinguishable bacterial subtypes (Brígido ; Deurenberg ; Levinson & Gutman, 1987). C. difficile PCR ribotyping, the most widely used method in Europe, exploits differences in the length of the 16S–23S rRNA intergenic spacer region (16S–23S ISR) (Bidet ; Stubbs ). The mechanism behind the differences in 16S–23S ISR evolution is currently not completely understood. It has been reported that C. difficile has a highly mobile mosaic genome consisting of mobile genetic elements, mainly as conjugative transposons (Sebaihia ). This mosaic nature has been confirmed, but no transposon activity was found as the cause of the 16S–23S ISR size variations in several analysed sequences (Sadeghifard ). To elucidate the mechanisms underlying the length variations of 16S–23S ISR sequences in C. difficile, we analysed six C. difficile isolates of six PCR ribotypes.

METHODS

Micro-organisms.

Six isolates comprising six PCR ribotypes were chosen from the strain collection of the Austrian National Reference Center for C. difficile in Vienna, Austria. The isolate of ribotype 001 was initially provided by Ed J. Kuijper (Leiden, The Netherlands) and ribotype 176 by one of the authors (U. R.). The remaining isolates, PCR ribotypes AI5 (Austrian isolate 5), 027, 053 and 078, originated from patients in Austria. The pattern of PCR ribotype AI5 was different from that of available reference strains. All isolates were recultivated on cycloserine-cefoxitine agar plates (C. difficile agar; bioMérieux) in an anaerobic atmosphere at 37 °C for 48 h.

Capillary gel electrophoresis-based PCR ribotyping.

Capillary gel electrophoresis-based PCR ribotyping was carried out with primers as described elsewhere (Indra ) to confirm the above-mentioned PCR ribotypes. The 16S primer was labelled at the 5′ end with tetrachlorofluorescein. The sample mixture comprised 25 μl HotStar Taq Master Mix (Qiagen), 0.3 μl each primer (10 pmol μl−1), 20.7 μl water and 1.5 μl DNA. Samples were amplified in a PCR thermocycler by heating at 95 °C for 15 min for initial enzyme activation, followed by 22 cycles of 1 min at 95 °C, 1 min at 57 °C and 1 min at 72 °C, with a final elongation step for 30 min at 72 °C. The PCR fragments were analysed using a 310 Genetic Analyzer (Applied Biosystems) with a 41 cm capillary loaded with a POP4 gel (Applied Biosystems). A 50–625 bp TAMRA ladder (Chimerx) was used as an internal marker for each sample. Injection of samples was carried out at 5 kV over 5 s, with a total running time of 28 min at a run voltage of 15 kV. The size of each peak was determined using Peakscanner software 1.0 (Applied Biosystems).

Amplification of the 16S–23S ISR.

DNA was extracted from cultures using a MagNA Pure Compact instrument (Roche Diagnostics) according to the manufacturer's recommendations. PCR ribotyping was performed with primers 16S (10 pmol μl−1; 5′-GTGCGGCTGGATCACCTCCT-3′) and 23S (10 pmol μl−1; 5′-CCCTGCACCCTTAATAACTTGACC′) as described by Bidet . Samples were amplified in a PCR thermocycler by heating at 95 °C for 15 min for initial enzyme activation, followed by 35 cycles of 1 min at 95 °C, 1 min at 57 °C and 1 min at 72 °C, with a final elongation step of 5 min for 72 °C. The amplified products were checked by electrophoresis on 1.5 % agarose gels for 4 h at 100 V using a 100–1000 bp ladder (Fermentas) as size standard every ten lanes. The PCR products were purified using a MinElute PCR Purification kit (Qiagen) according to the manufacturer's recommendations.

Cloning and sequencing of the 16S–23S ISR.

The purified PCR products were ligated into a pDrive cloning vector and transformed into competent cells using a PCR Cloning Plus kit (Qiagen) in accordance with the manufacturer's instructions. Recombinant colonies were picked and grown in thioglycolate broth. Plasmid DNA was extracted from 47 clones showing an insert using a QIAprep Spin Miniprep kit (Qiagen), following the manufacturer's instructions. The 16S–23S ISR was reamplified using the following PCR program: 95 °C for 15 min (hot start), 35 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min, and 10 min at 72 °C for final elongation. The 50 μl PCR mixture comprised 25 μl Hotstar Master Mix, 1 μl each primer [10 pmol μl−1; M13 forward (−40) (5′-GTTTTCCCAGTCACGAC-3′) and M13 reverse (5′-AACAGCTATGACCATG-3′)], 21 μl PCR-grade water and 2 μl extracted plasmid DNA. The PCR products were purified using a MinElute PCR purification kit following the manufacturer's instructions. Each sequencing reaction contained 4 μl BigDye Terminator v1.1 (Applied Biosystems), 4 μl template DNA, 2 μl M13 forward or M13 reverse primer (10 pmol μl−1), 2 μl sequencing buffer and 8 μl water. After an initial activation step at 96 °C, samples underwent 30 cycles of 96 °C for 10 s, 50 °C for 55 s and 60 °C for 4 min. After the sequencing PCR, products were purified using Centri-Sep columns (Princeton Separations) according to the manufacturer's instructions. Sequences were analysed in a 310 Genetic Analyzer, with a 41 cm capillary loaded with a POP6 gel. Injection of samples was carried out at 2 kV over 30 s, with a total running time of 36 min at a run voltage of 15 kV.

Analysis of sequence data.

Vector sequences were trimmed from all sequences using the program kodon 3.5 (Applied Maths) and, with the same program, sequences were assembled and checked for any conflicts between the overlapping sequences generated with the forward and reverse primers. Sequences were then aligned and stored. The 16S–23S ISR sequence alignment was revised with the GeneDoc multiple sequence alignment program as described elsewhere (Nicholas ).

RESULTS AND DISCUSSION

Molecular typing methods are valuable tools for outbreak investigation and elucidation of evolutionary relatedness (Faria ; Ragon ). Nevertheless, differing typing methods can yield discordant results (Hanekom ). PCR ribotyping is based on fragment length variations in the 16S–23S ISR, although the detailed mechanism underlying the formation of the variations in C. difficile is currently unknown. Differences in 16S–23S ISR fragment lengths observed in PCR ribotyping reflect the allelic variants of the rRNA (rrn) operon present in the genome of the respective C. difficile ribotype (Hanekom ). In the present study, the 16S–23S ISRs of 47 clones were primarily investigated: eight clones from C. difficile isolate PCR ribotype 001, 14 clones from 027, three from 053, seven from 078, six from 176 and nine from AI5. The 16S–23S ISR sequences ranged in length from 185 to 503 bp. Thirty-five clones showed differences either by PCR ribotype or by nucleotide sequence; 12 clones yielded indistinguishable sequences and these were not included in further investigations. The distribution of sequenced ISR sequences in relation to peaks produced by capillary gel electrophoresis-based PCR ribotyping is shown in Fig. 1. The direct repeat IB with the sequence TTAGCACTT was detected in all cloned 16S–23S ISRs. The direct repeats of a total of five clones displayed point mutations. Clone 4 (366 bp), clone 5 (364 bp) and clone 11 (322 bp) of ribotype 078 showed a T→G (GTAGCACTT) point mutation in the first direct repeat, whilst clone 5 showed an additional C→T (TTAGTACTT) point mutation in the fourth direct repeat. Clone 11 (501 bp) of ribotype 001 showed a T→C (CTAGCACTT) point mutation in the third direct repeat (Fig. 2).
Fig. 1.

Graphical representation of PCR-ribotyping patterns of all six different PCR ribotypes used in this study carried out by capillary gel electrophoresis-based PCR ribotyping. Cloned and sequenced ISRs are labelled according to the numbers given in Table 3.

Fig. 2.

Schematic alignment showing the variants of the 16S–23S ISR of C. difficile ribotypes 001, 027, AI5, 176, 053 and 078. ISRstart and ISRend sequences were labelled according to Table 2 and spacer sequences according to Table 1. Direct repeats were designated ‘IB’ and point mutations in the direct repeats were designated ‘IB’ plus the respective mutation.

Sequences between direct repeats (spacer sequences) were either 33 or 53 bp in length (Table 1). Table 2 lists the eight sequences detected at the beginning (before the first repeat or the tRNAAla; ISRstart) and the nine sequences detected at the end of the 16S–23S ISR (after the last repeat; ISRend).
Table 1.

Spacer sequence variations found in six C. difficile PCR ribotypes

PCR ribotypes are in bold. Spacer sequence variants are labelled with consecutive numbers and a prefix of the spacer size in bp and v (variant).

PCR ribotype-cloneSpacer variantSpacer nucleotide sequence
001-6, -8 AI5-8 053-2, -333 bp v1TAAGCAACGGAATTTATTCGTTGGCGCTGTGCG
001-8, -10, -1233 bp v2TAAGCAACGGGATTTATTCGTTGGCGCTGTGCG
027-3, -4, -10 176-3, -533 bp v3TTAGCAACGGGATTTATCCGTTGGCGCCGTGCT
027-19 053-333 bp v4TAAGCAACGGGATTTATCCGTTGGCGCCGTGCT
027-7, -17 176-433 bp v5TAAGCAACGGAATTTATTCGTTGGCGCCGTGCT
001-1133 bp v6TAAGCAACGGAATTTATTTGTTGGCGCCGTGCT
176-233 bp v7TAAGCAACGGAATTTATTCGTTGGCGACGTGCT
053-133 bp v8TAAGCAACGGAATTTATTCATTGGTGCCGTGCT
078-333 bp v9TAAGCAACGGAATTTATTCGTTGGCGCTGTGCT
078-4, -5, -9, -1133 bp v10TAAGCAACGGAATTTATTCGTTGGCGCTGTGCA
078-9 176-233 bp v11TAAGCAACGGGATTTATCCGTTGGCGCTGTGCG
078-3, -4, -533 bp v12TAAGCAACGTGATTTATCCGTTGGCGCTGTGCA
078-1133 bp v13TAAGCAACGGGATTTATCCGTTGGCGCTGTGCT
AI5-1333 bp v14TAAGCAACGGGATTTATCCGTTGGCGACGTGCT
027-7, -17 AI5-1353 bp v1TTAGCAACAGAATAAACTGAACGCATGTGAAGTTTGTTTGTTGGCGCTGTGCG
078-7, -853 bp v2TAAGCAACAGAATAAACTGAACACATGTGAAGTTTGTTTGTTGGCGCTGTGCG
001-6 AI5-853 bp v3TTAGCAACAAAATAAACTGAACGCATGTGAAGTTTGTTTGTTAGCGCTGTGCA
053-2, -353 bp v4TTAGCAACAGAATAAACTGAACGCATGTGAAGTTTGTTTGTTGGCGCTGTGCA
027-1953 bp v5TTAGCAACAGAATAAACTGAACGCATGTGAAGTTTGTTTGTTGGCGTTGTGCG
001-11 053-153 bp v6TAAGTAACGGAATAATCTGAGTGAATACGAAGGTTGTTCGTTGACGTGGTGCG
001-11 053-1 176-253 bp v7TAAGCAACAGAATAAACTGAACGCATGTGAAGTTTGTTTGTTGGCGCTGTGCG
078-3, -4, -553 bp v8TAAGCAACAGAATAAACTGAACGCATGTGAAGTTTGTTTGTTGGCGCTGTGTG
078-1153 bp v9TAAGCAACAGAATAAACTGAACGCATGTGAAGTTCGTTTGTTGGCGCTGTGTG
001-11171 bp v1CTTTATATTTGGGGTGTAGCTCAGTTGGGAGAGCACTTGCCTTGCAAGCAAGGGGTCAGGAGTTCGACTCTCCTCATCTCCACCATTTAAGAGTATATTACTTAAATCTTTGATTTACTTAGTAGCCTCTTACAATGCACTTATAGCTTAAATTTATACAAGCTTTGTGTG
176-4 053-1172 bp v1CTTTATATATGGGGGTGTAGCTCAGTTGGGAGAGCACTTGCCTTGCAAGCAAGGGGTCAGGAGTTCGACTCTCCTCATCTCCACCATTTAAGAGTATATTACTTAAATCTTTGATTTACTTAGTAGCCTCTTACAATGCACTTATAGCTTAAATTTATACAAGCTTTGTGCG
078–7, -8172 bp v2CTTTATATATGGGGGTGTAGCTCAGTTGGGAGAGCACTTGCCTTGCAAGCAAGGGGTCAGGAGTTCGACTCTCCTCATCTCCACCATTTAAGAGTATATTACTTAAATCTTTGATTTACTTAGTAGCCTCTTACAATGCACTTATAGCTTAAATTTATACAGGCTTTGTGCG
Table 2.

Sequence variations at the beginning and end of the 16S–23S ISR

Nucleotide sequences were given numbers with the prefix ‘ISRstart’, ‘ISRend’ and v (variant) for either the beginning or the end sequence of the 16S–23S ISR. PCR ribotypes are in bold.

PCR ribotype-cloneISR start/end variantSequence similarity (%) to ISRstart v1 or ISRend v1Start/end of 16S–23S ISR sequence
027-1, -7, -17, -19001-5, -6, -7, -8, -12176-1, -2, -5AI5-1, -8, -13053-2, -3078-3ISRstart v1(100)AAGGAGAATTACCTACTGTTTAATTTTGAGGGTTCGTTTTTACGAATACTCAAAA
001-10ISRstart v298AAGGAGAATTACCTACTGTTTAATTTTGAGGGTTCGTTTTTACGAGTACTCAAAA
176-3 027-3, -10ISRstart v398AAGGAGAATTACCTACTGTTTAATTTTGAGGGTTTGTTTTTACGAATACTCAAAA
176-4 053-1 001-11ISRstart v472AAGGAGAATTGCCTACTGTTTAATTTTGAAAGTTCTTTACGAA
078-9ISRstart v598AAGGAGAATTACCTACTGTTTAATTTTGAGGGTTCGTTTTTACGAATGCTCAAAA
AI5-2, -6 001-17078-4, -5, -11ISRstart v698AAGGAGAATTGCCTACTGTTTAATTTTGAGGGTTCGTTTTTACGAATACTCAAAA
027-4ISRstart v798AAGGAGAATCACCTACTGTTTAATTTTGAGGGTTCGTTTTTACGAATACTCAAAA
078-7, -8ISRstart v874AAGGAGAATTACCTACTGTTTAATTTTGAAAGTTTTTTACGAA
001-5, -6, -10, -11, -12, -17027-1, -3, -4, -17078-8176-1, -4, -5AI5-1, -6, -8, -13053-2ISRend v1(100)TGAAAACTGCATATATATTTAGTGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAAC
001-7 AI5-2ISRend v299TGAAAACTGCATATATACTTAGTGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAAC
027-19 053-3078-3, -4, -7, -9ISRend v398TGAAAACTGCATATATATATTTAGTGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAC
001-8ISRend v499TGAAAACTGCATATATATTTAGTGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAGC
027-7 176-2, -3ISRend v596TGAAAACTGCATATATATTTAGTGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTAAAAATTATCAAGTTGATAGACTTTAATCTATCAAACCTTTTTAAC
027-10ISRend v699TGAAAACTGCATATATATTTAGCGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAAC
053-1ISRend v795TGAAAACTGCATATATATATTTAGTGATATGACATCTAATTTGTAATATATAAAGCTGATAACTTTTTAAAATTATCAAGTTGATAGACTTTAATCTATCAAACCTTTTTAAC
078-5ISRend v895TGAAAGCTGCATATATATATTTAGTGATATGACATCTAATTTGTAATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAAC
078-11ISRend v996TGAAAACTGCATATATATATTTAGTGATATGACATCTAATTTGTAATATAAAGCTGATAACTTTTTAAAATTATCGAAGTTGATAGCTTCTAATCTATCAAACCTTTTTAAC
In 30 clones from isolates of ribotypes 001, 027, 053, 176, 078 and AI5, sequence lengths correlated with the number of direct repeats (two to five) present in the 16S–23S ISR: the more direct repeats found, the longer the sequence. However, five clones (176-4, 078-7, 078-8, 001-11 and 053-1) did not correspond to this pattern (italic in Table 3). These five clones had fewer or the same number of repeats than shorter ISR sequences (e.g. clones 078-4 and 001-8; see Table 3) but contained a tRNAAla gene (73 bp) included in a 172 bp sequence (171 bp in 001-11) located between ISRstart (the beginning of the 16S–23S ISR) and the first direct repeat (Fig. 2).
Table 3.

Sequence lengths and numbers of direct repeats in six C. difficile PCR ribotypes

PCR ribotypes are in bold. The five clones in which sequence length did not correlate with the number of direct repeats are indicated in italics (see text).

PCR ribotype-cloneSequence length (bp)Direct repeats (n)
001-5, -7, -17027-1176-1AI5-1, -2, -61852
176-32172
001-8, -10, -12027-3, -4, -10176-52182
078-92623
027-72793
001-6027-17053-2AI5-8,-132803
027-192823
176-23214
078-113224
053-3078-33244
078-53645
078-43665
176-43782
078-83982
078-74002
001-115014
053-15034
The occurrence of this gene in the 16S–23S ISR of C. difficile has already been described by Sadeghifard ; moreover, they proposed a mosaic nature for the C. difficile 16S–23S ISR, although the issue of the heterogeneity was not addressed. According to the results of our study, the differences in fragment lengths of the C. difficile 16S–23S ISR are based on the number of 9 bp direct repeats in the 16S–23S ISR, indicating a highly structured organization of this sequence, in contrast to the findings of Sadeghifard . Our study demonstrated that there are basically two types of 16S–23S ISR in the C. difficile genome: 16S–23S ISR sequences with and without the tRNAAla gene. It remains to be determined whether the gene was originally present in all 16S–23S ISR sequences and subsequently lost during evolution or whether these two types of sequence (with and without tRNAAla gene) have always existed as two distinct families. We hypothesize that the structure of the 16S–23S ISR is a product of three mechanisms responsible for variations in rrn operons: slipped-strand mispairing, intrachromosomal homologous recombination and possibly interchromosomal recombination. Slipped-strand mispairing occurs infrequently at positions of direct repeats during bacterial replication (Gürtler, 1999; van Belkum, 1999) and has been described as a mechanism leading to 16S–23S ISR rearrangements in several bacteria of medical importance, such as Enterococcus faecalis, Staphylococcus aureus and Escherichia coli (Gürtler, 1999). The process of slipped-strand mispairing approaches a frequency of 1×10−4 per bacterial cell division, resulting in insertion or deletion of short sequence repeats depending on the location of the mispairing (template strand: deletion; nascent strand: insertion; van Belkum, 1999). Intrachromosomal homologous recombination in rrn operons has been described previously (Petit, 2005). Our findings showed an inverse spacer arrangement in clone AI5-13 (spacer v1 with 53 bp and spacer v14 with 33 bp) when compared with clones 00-6 and AI5-8 (Fig. 2), typical for intrachromosomal homologous recombination events and shown schematically for C. difficile in Fig. 3. This explains why PCR ribotype AI5 was indistinguishable from ribotype 001 by capillary gel electrophoresis-based PCR ribotyping, but showed one band difference in classic agarose gel electrophoresis. This band is a product of incorrect hybridization of different ISRs with similar sequences, as described by Indra . The extra band was hypothesized previously to be a result of ‘incorrect’ hybridization of different 16S–23S ISR fragments, as we have now shown with our findings of the inverse spacer arrangement in clone AI5-13, a product of intrachromosomal homologous recombination.
Fig. 3.

(a) Two identical copies of an rrn operon present on the C. difficile chromosome. (b) Recombination (shown as an X) at direct repeat positions (shaded line) behind the replication fork. (c) Recombination results in a 16S–23S ISR with a deletion of spacer sequences and another with a duplicated spacer or inverted spacer (depending on the orientation of the two copies to each other).

The product of interchromosomal recombination as a chromosome in which the incoming DNA is flanked by direct repeats, also called a ‘pop-in’ recombinant, tends to be unstable, and DNA can ‘pop out’ again unless there is a selective advantage for the newly formed ‘pop-in’ recombinant (Petit, 2005). It is therefore likely that such events seldom lead to stable variations in the 16S–23S ISR. Some strains of C. difficile are stated to show interchromosomal recombination (Zaiss ); however, we could not find signs of such recombination in the investigated 16S–23S ISRs. Interestingly, tRNA genes have been described as frequently used sites for bacteriophage DNA insertion (Reiter ); thus, the tRNAAla gene in the 16S–23S ISR of C. difficile indicates an insertion site for foreign DNA. Overall, our study revealed that the 16S–23S ISRs of C. difficile show a uniformly organized structure composed of a tRNAAla gene, spacer sequences of two different lengths and the direct repeat IB of 9 bp. This composition is responsible for the length variations of the 16S–23S ISR used in PCR ribotyping and has evolved as the result of several mechanisms that occur frequently during DNA replication and recombination: slipped-strand mispairing and intra- and possibly interchromosomal homologous recombination.
  13 in total

1.  Multilocus Variable-Number Tandem-Repeat Analysis of Clostridioides difficile Clusters in Ribotype 027 Isolates and Lack of Association with Clinical Outcomes.

Authors:  Julian R Garneau; Claire Nour Abou Chakra; Louis-Charles Fortier; Annie-Claude Labbé; Andrew E Simor; Wayne Gold; Matthew Muller; Allison McGeer; Jeff Powis; Kevin Katz; Jacques Pépin; Louis Valiquette
Journal:  J Clin Microbiol       Date:  2019-04-26       Impact factor: 5.948

2.  DNA microarray-based PCR ribotyping of Clostridium difficile.

Authors:  Alexander Schneeberg; Ralf Ehricht; Peter Slickers; Vico Baier; Heinrich Neubauer; Stefan Zimmermann; Denise Rabold; Antina Lübke-Becker; Christian Seyboldt
Journal:  J Clin Microbiol       Date:  2014-11-19       Impact factor: 5.948

3.  Comparison of two capillary gel electrophoresis systems for Clostridium difficile ribotyping, using a panel of ribotype 027 isolates and whole-genome sequences as a reference standard.

Authors:  Meng Xiao; Fanrong Kong; Ping Jin; Qinning Wang; Kelin Xiao; Neisha Jeoffreys; Gregory James; Gwendolyn L Gilbert
Journal:  J Clin Microbiol       Date:  2012-06-12       Impact factor: 5.948

4.  Simultaneous detection and characterization of toxigenic Clostridium difficile directly from clinical stool specimens.

Authors:  Hanjiang Lai; Chen Huang; Jian Cai; Julian Ye; Jun She; Yi Zheng; Liqian Wang; Yelin Wei; Weijia Fang; Xianjun Wang; Yi-Wei Tang; Yun Luo; Dazhi Jin
Journal:  Front Med       Date:  2017-10-17       Impact factor: 4.592

5.  Folding of 16S rRNA in a signal-producing structure for the detection of bacteria.

Authors:  Yulia V Gerasimova; Dmitry M Kolpashchikov
Journal:  Angew Chem Int Ed Engl       Date:  2013-09-03       Impact factor: 15.336

6.  C. difficile ribotype 027 or 176?

Authors:  Marcela Krutova; Jana Matejkova; Otakar Nyc
Journal:  Folia Microbiol (Praha)       Date:  2014-06-27       Impact factor: 2.099

7.  Macro and micro diversity of Clostridium difficile isolates from diverse sources and geographical locations.

Authors:  Richard A Stabler; Lisa F Dawson; Esmeralda Valiente; Michelle D Cairns; Melissa J Martin; Elizabeth H Donahue; Thomas V Riley; J Glenn Songer; Ed J Kuijper; Kate E Dingle; Brendan W Wren
Journal:  PLoS One       Date:  2012-03-02       Impact factor: 3.240

8.  Sequence similarity of Clostridium difficile strains by analysis of conserved genes and genome content is reflected by their ribotype affiliation.

Authors:  Hedwig Kurka; Armin Ehrenreich; Wolfgang Ludwig; Marc Monot; Maja Rupnik; Frederic Barbut; Alexander Indra; Bruno Dupuy; Wolfgang Liebl
Journal:  PLoS One       Date:  2014-01-23       Impact factor: 3.240

9.  Transition From PCR-Ribotyping to Whole Genome Sequencing Based Typing of Clostridioides difficile.

Authors:  Helena M B Seth-Smith; Michael Biggel; Tim Roloff; Vladimira Hinic; Thomas Bodmer; Martin Risch; Carlo Casanova; Andreas Widmer; Rami Sommerstein; Jonas Marschall; Sarah Tschudin-Sutter; Adrian Egli
Journal:  Front Cell Infect Microbiol       Date:  2021-06-01       Impact factor: 5.293

10.  Structure of rrn operons in pathogenic non-cultivable treponemes: sequence but not genomic position of intergenic spacers correlates with classification of Treponema pallidum and Treponema paraluiscuniculi strains.

Authors:  Darina Čejková; Marie Zobaníková; Petra Pospíšilová; Michal Strouhal; Lenka Mikalová; George M Weinstock; David Šmajs
Journal:  J Med Microbiol       Date:  2012-10-18       Impact factor: 2.472

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.