Literature DB >> 20663204

Genomic characterization of large rearrangements of the LDLR gene in Czech patients with familial hypercholesterolemia.

Radan Goldmann1, Lukás Tichý, Tomás Freiberger, Petra Zapletalová, Ondrej Letocha, Vladimír Soska, Jirí Fajkus, Lenka Fajkusová.   

Abstract

BACKGROUND: Mutations in the LDLR gene are the most frequent cause of Familial hypercholesterolemia, an autosomal dominant disease characterised by elevated concentrations of LDL in blood plasma. In many populations, large genomic rearrangements account for approximately 10% of mutations in the LDLR gene.
METHODS: DNA diagnostics of large genomic rearrangements was based on Multiple Ligation dependent Probe Amplification (MLPA). Subsequent analyses of deletion and duplication breakpoints were performed using long-range PCR, PCR, and DNA sequencing.
RESULTS: In set of 1441 unrelated FH patients, large genomic rearrangements were found in 37 probands. Eight different types of rearrangements were detected, from them 6 types were novel, not described so far. In all rearrangements, we characterized their exact extent and breakpoint sequences.
CONCLUSIONS: Sequence analysis of deletion and duplication breakpoints indicates that intrachromatid non-allelic homologous recombination (NAHR) between Alu elements is involved in 6 events, while a non-homologous end joining (NHEJ) is implicated in 2 rearrangements. Our study thus describes for the first time NHEJ as a mechanism involved in genomic rearrangements in the LDLR gene.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20663204      PMCID: PMC2923121          DOI: 10.1186/1471-2350-11-115

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

Familial hypercholesterolemia (FH) is an autosomal dominant disease, caused predominantly by variants in the low density lipoprotein receptor (LDLR) gene. Pathogenic alternations in the LDLR protein cause a lack of functional receptors for LDL particles on the liver cell surface and give rise to increased serum LDL-cholesterol levels. The high LDL-cholesterol level frequently gives rise to tendon xanthomas, xanthelasmas, arcus lipoides corneae, and accelerated atherosclerosis resulting from cholesterol deposition in the arterial wall, thereby increasing the risk of premature coronary heart disease. The frequency of heterozygous FH in most populations is about 1/500, homozygous FH is rare (≤ 1/1000,000) [1]. The identification and treatment of FH patients and their affected relatives with effective lipid-lowering agents is important and as this has been shown to significantly reduce both coronary morbidity and mortality [2,3]. Genetic testing is the preferred diagnostic method in FH families because it provides an unequivocal diagnosis [1,4,5]. The LDLR gene is localized at 19p13.2, is composed of 18 exons spanning 45 kb, the transcript is 5.3 kb long and encodes a peptide containing 860 amino acids [6]. LDLR mutations have been reported along the whole length of the gene in FH patients from around the world. At present, the number of identified unique LDLR allelic variants is over 1000: 65% of the variants are DNA substitutions, 24% small DNA rearrangements (< 100 bp) and 11% large DNA rearrangements (> 100 bp) http://www.ucl.ac.uk/ldlr/Current/index.php?select_db=LDLR and [7]. Genesis of large DNA rearrangements in the LDLR gene is frequently associated with Alu elements, which are highly abundant in this particular locus [6,8,9]. Publication of the human genome DNA sequence has revealed that there are 98 Alu repeats within the LDLR gene (95 in intronic sequences and 3 in the 3'untranslated region) and Alu repeats accounted for 65% of LDLR intronic sequences [10]. Alu is the most abundant short interspersed nuclear element (SINE) of the human genome, occupying 10% of the genome content with a copy number estimated to be at least 1.3 million [11]. Consensus Alu sequence is approximately 300 bp in length, and consists of two similar, but distinct monomers. The longer right Alu monomer contains a 31 bp insert absent from the left Alu monomer. A functional RNA polymerase III promoter is present in the left monomer, but is absent from the right monomer [12,13]. Alu sequences are regarded as retrotransposons that have inserted into the human genome via a single-stranded RNA intermediate generated by RNA pol III transcription [14]. The Alu dimer is usually followed by a 3'A-rich region, a typical feature of SINEs, and the two monomers are separated by a middle A-rich region, an obvious remnant of an ancestral monomeric Alu's 3'A-rich tail [15]. Throughout Alu evolution, the source gene(s) accumulated mutations that were incorporated into the new copies made, creating new Alu subfamilies. Therefore, the Alu family is composed of a number of distinct subfamilies characterized by a hierarchical series of mutations that result in a series of subfamilies of different ages [16-20]. Alu repeat dispersion throughout the genome offers many opportunities for homologous recombinations. Nonallelic homologous recombination (NAHR) is the most common mechanism underlying disease associated genome rearrangements. NAHR can use either region-specific low-copy repeats or repetitive sequences (e.g., Alu) as homologous recombination substrates [21,22]. Another recombination mechanism causing genomic disorders is nonhomologous end joining (NHEJ). This process involves the double strand breakage of DNA followed by end joining in the absence of extensive sequence homology [23-25]. NHEJ is associated with very short stretches of sequence identity (a few bp) between the two ends of the breakpoint junctions [22,26,27]. In this study, we present results of analyses of large genomic rearrangements in Czech FH patients detected using Multiple Ligation dependent Probe Amplification (MLPA). In set of 1441 unrelated FH patients, large genomic rearrangements were detected in 37 probands. We found 8 different types of rearrangements, from them 6 types were novel, not described so far. In all rearrangements, we characterized their exact extent and breakpoint sequences. The results showed that 6 events were products of NAHR between Alu repeat sequences. The remaining 2 events apparently originated from NHEJ.

Methods

Patients

One thousand nine hundred and forty five probands with probable or definite diagnosis of FH, submitted to the database of the MedPed (Make Early Diagnoses to Prevent Early Deaths) project in the Czech Republic, were included into the study. MedPed is an international project joining together experts from more than 30 countries of the world. In the Czech Republic, the project is coordinated by the Czech Society for Atherosclerosis. Experimental research reported in this study has been performed with the approval of the Ethical Committee of the General University Hospital in Prague, the Czech Republic, and is in compliance with the Helsinki Declaration. All patients gave their informed consent with their participation in the study, which is a part of each patient's personal documentation. The text of the informed consent is available at: http://www.athero.cz/user_data/zpravodajstvi/obrazky/File/medped/informovany_souhlas.pdf The patient file in our study include a) patients with untreated total and/or LDL cholesterol serum levels above the 95th percentile of age, sex and population specific values; b) patients with elevated total and LDL cholesterol in serum but untreated levels unavailable or not exceeding the 95th percentile of age, sex and population specific values, and, in addition, with high clinical suspicion of FH based on personal history and/or family history of premature coronary heart disease and/or elevated total and LDL cholesterol serum levels in the first degree relatives. DNA analysis of FH patients is divided into several consecutive steps: 1) PCR-RFLP detection of the most common mutation in the APOB gene (p.Arg3527Gln) [28,29]; 2) PCR-RFLP detection of the most common mutations in the LDLR gene (p.Gly592Glu, p.Asp266Glu, and p.Arg416Trp); 3) PCR-sequencing of LDLR exon 4 (the exon with the greatest occurrence of mutations in Czech FH patients); 4) MLPA analysis of all LDLR exons; 5) PCR-sequencing of the promoter and LDLR exons 1, 5, 6, 9, 10, 12, 14; and 6) PCR-denaturing high performance liquid chromatography of LDLR exons 2, 3, 7, 8, 11, 13, 15, 16, 17, and 18, followed by sequencing of positively tested regions. The break of DNA analysis in case of a mutation finding depends on personal and family history of hypercholesterolemia, the presence of tendon xanthomas, xanthelasmas, early coronary artery disease and premature coronary heart disease. The DNA analysis continues in cases when i) a phenotype manifestation could be associated with the presence of two LDLR mutations or ii) a detected missense mutation is new with hardly predicted effect on the protein structure and function. This diagnostic process is common in FH diagnostics [30,31]. Only data obtained by MLPA analysis are present in this study.

Analysis of deletion and duplication breakpoints in the LDLR gene

DNA was isolated according to the standard salting-out method. MLPA was performed using SALSA MLPA KIT P062-C1 LDLR (MRC-Holland), according to the manufacturer's instruction, and analysed on CEQ 8000 Genetic Analysis System (Beckman Coulter). To characterize the precise locations of genomic breakpoints, a number of amplifications and PCR product analyses were performed. Primers for initial long-range amplifications are given in Table 1 together with approximate sizes of PCR fragments of mutated alleles and nested primers for precise determination breakpoints using DNA sequencing. Long-range PCR were performed using Expand Long Template PCR System Kit (Roche) and PCR amplifying fragments around breakpoints using AmpliTaq Gold polymerase (Applied Biosystems). PCR products were purified and sequenced on ABI PRISM 310 DNA-sequencer (Applied Biosystems). Repetitive sequences were identified using RepeatMasker version-3.1.5 available at http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker.
Table 1

Primers for LDLR breakpoint analysis

Mutation at cDNA levelPrimers for long-range PCR(5'→ 3'direction)Size* (kb)Primers for precise breakpoint determination(5'→ 3'direction)
promoter_ex2delF: TGTCGCAAATGGCATAAGGAAR: CGGATTTGCAGGTGACAGACA2.0F: AAGGCTGCAGTGAAGTATGATGGR: GAGACGGAGTCTCACTCTGTCG
exon2_6dupF: AGTTCAAGTGTCACAGCGGCR: GTCTTGGCACTGGAACTCGT8.0F: AGTTCAAGTGTCACAGCGGCR: CAAGGTTGGCGTTTTTCATATT
exon3_12delF: CCAGAAGATTCCAGAAATTTCCAGR: CCTTTCTCCTTTTCCTCTCTCTCA3.5F: TGGCTCACTGCAAGCTCCGR: AGGCTGGAGTCCAGTGGTACC
exon4_8dupF: CAAGTGCCAGTGTGAGGAAGGR: CCCTTGGAACACGTAAAGACCC2.5F: CACGTGACTTCAAGGGGTTAAAGR: TTCTCTAAAATGCTTGGGACCA
exon5_10delF: CACCTGCATCCCCCAGCTGTGGGC R:TGGCTGGGACGGCTGTCCTGCGAAC3.0F: TTTGTACAGACACAGGCTGGTCR: CAGATGTCACCTGACAGGTACAG
exon9_14delF: GGAGTGACTTCAAGGGGTTAAAGR: AGGTGGCTCAGGCTGGGC0.5F: GGAGTGACTTCAAGGGGTTAAAGR: AGGTGGCTCAGGCTGGGC
exon9_15delF: CACGTGATCGTCCCGCCTAR: AAATTCTTGTCAACCTACTTGTGC0.8F: AAATTCTTGTCAACCTACTTGTGCR: CACGTGATCGTCCCGCCTA
exon16_18dupF: CGTGAACATCTGCCTGGAGTCR: TCTTCTCATTTCCTCTGCCAGC3.0F: TCGTGTGTGTTGGGATGGGAR: ACCCCAGCCCCCAAACTAAA

F - forward primer; R - reverse primer; * size of PCR fragment of mutated allele. The genomic sequence of the LDLR gene was obtained from http://www.ucl.ac.uk/ldlr/LOVDv.1.1.0/refseq/LDLR_codingDNA.html.

Primers for LDLR breakpoint analysis F - forward primer; R - reverse primer; * size of PCR fragment of mutated allele. The genomic sequence of the LDLR gene was obtained from http://www.ucl.ac.uk/ldlr/LOVDv.1.1.0/refseq/LDLR_codingDNA.html.

Results

For DNA analysis, 1945 FH probands were selected: 252 probands (13,0%) had the APOB mutation; 186 probands (9,6%) had the mutation p.Gly592Glu or p.Asp266Glu or p.Arg416Trp; 66 probands (3,4%) had a mutation in exon 4. 1441 patients were analyzed by MLPA and in 37 probands (1,9%) a deletion/duplication was detected. At present time, the DNA analysis continues in 1404 patients. Using MLPA, we found 8 types of large genomic rearrangements - 5 deletions and 3 duplications (Table 2). Six types of rearrangements were novel, so far not described: exon2_6dup, exon3_12del, exon4_8dup, exon5_10del, exon9_15del, and exon16_18dup (The terminology used should be read e.g., in exon2_6dup as duplication of exon 2 to exon 6). Using long-range PCR, PCR, and DNA sequencing, we analysed breakpoints of deletions and duplications identified in our FH patients. In Table 2, we show correct sizes of deletions and duplications together with terms of repetitive elements surrounding breakpoints. Schematic illustration of recombination events are given in Figure 1 and 2. As new rearrangements, we denote deletions/duplications which have not been described in literature so far in terms of exons involved. In this denotation, we do not take into account the exact sequence position of breakpoints determined in this work.
Table 2

Genomic characteristics of deletion and duplication breakpoints in the LDLR gene in Czech FH patients

Mutation at cDNA levelMutation at DNA levelDeletion/duplication sizeRecombination mechanismRepetitive element 5'/class/familyRepetitive element 3'/class/familyNo. of probands
promoter_2exondelc. -1823_190+566del13186bpNAHRAluY/SINE/AluAluY/SINE/Alu1
exon2_6dupc. 67+3968_940+296dup14228bpNAHRAluSx1/SINE/AluAluSx3/SINE/Alu9
exon3_12delc.190+984_1846-1160del17604bpNAHRFLAM_A/SINE/AluAluY/SINE/Alu1
exon4_8dupc.314-446_1187-386dup8119bpNHEJAluSx1/SINE/AluMER83/LTR/ERV11
exon5_10delc. 695-67_1586+371del7636bpNHEJAluJo/SINE/AluAluSx1/SINE/Alu4
exon9_14delc.1186+700_2141-545del10291bpNAHRAluYa5/SINE/AluAluY/SINE/Alu10
exon9_15del)c.1187-169_2312-790del14110bpNAHRAluJb/SINE/AluAluSx1/SINE/Alu8
exon16_18dup)c.2311+1941_*1216dup7248bpNAHRAluYb8/SINE/AluAluSq2/SINE/Alu3

Newly described rearrangements are in bold letters; NAHR: nonallelic homologous recombination; NHEJ: nonhomologous end joining.

Figure 1

Schematic illustration of rearrangements in the . A: promoter_exon2del, B: exon2_6dup, C: exon3_12del and D: exon4_8dup. Consensus Alu sequences are depicted as red and blue boxes, their monomer subunits are given in dark and light tones. Sense orientation is marked by a darker tone of the first monomer of the Alu consensus sequence, the opposite order marks antisense orientation. MER83 repeat is depicted as a green box. Grey boxes represent sequence overlaps between 5'end and 3' end of the reference sequence.

Figure 2

Schematic illustration of rearrangements in the . A: exon5_10del, B: exon9_14del, C: exon9_15del and D: exon16_18dup. Consensus Alu sequences are depicted as red and blue boxes, their monomer subunits are given in dark and light tones. Sense orientation is marked by a darker tone of the first monomer of the Alu consensus sequence, the opposite order marks antisense orientation. Grey boxes represent sequence overlaps between 5' end and 3' end of the reference sequence.

Schematic illustration of rearrangements in the . A: promoter_exon2del, B: exon2_6dup, C: exon3_12del and D: exon4_8dup. Consensus Alu sequences are depicted as red and blue boxes, their monomer subunits are given in dark and light tones. Sense orientation is marked by a darker tone of the first monomer of the Alu consensus sequence, the opposite order marks antisense orientation. MER83 repeat is depicted as a green box. Grey boxes represent sequence overlaps between 5'end and 3' end of the reference sequence. Schematic illustration of rearrangements in the . A: exon5_10del, B: exon9_14del, C: exon9_15del and D: exon16_18dup. Consensus Alu sequences are depicted as red and blue boxes, their monomer subunits are given in dark and light tones. Sense orientation is marked by a darker tone of the first monomer of the Alu consensus sequence, the opposite order marks antisense orientation. Grey boxes represent sequence overlaps between 5' end and 3' end of the reference sequence. Genomic characteristics of deletion and duplication breakpoints in the LDLR gene in Czech FH patients Newly described rearrangements are in bold letters; NAHR: nonallelic homologous recombination; NHEJ: nonhomologous end joining. NAHR was detected in six DNA rearrangements (promoter_exon2del, exon2_6dup, exon3_12del, exon9_14del, and exon9_15del, exon16_18dup). In four NAHRs (promoter_exon2del, exon2_6dup, exon9_14del, and exon16_18dup), extensive sequence identity was detected between the breakpoints. In all four cases, the rearrangements were caused by recombination between consensus Alu repeats and novel complete recombinant Alu sequence was formed in the mutation breakpoint. In contrast, sequence identity around breakpoints of rearrangements exon3_12del and exon9_15del was not so extensive like in previous cases. These mutations were caused by recombination between an Alu repeat in monomer status and a consensus Alu repeat (dimer status). The recombination between FLAM_A (free left Alu monomer, size: 133 bp) and AluY (size: 315 bp) was detected in exon3_12del. The recombination between AluJb (size: 137 bp) and AluSx1 (size: 311 bp) was identified in exon9_15del. The deletion breakpoints of both consensus Alu repeats were localised in right monomer and so novel complete monomer recombinant Alu sequence was formed in the mutation breakpoint. Promoter_exon2del, exon2_6dup, exon9_14del and exon9_15del were formed between Alu repeats in the antisense orientation, exon3_12del and exon16_18dup between Alu repeats in the sense orientation. NHEJ was detected in two DNA rearrangements (exon5_10del and exon4_8dup). In exon5_10del, the breakpoint localized in intron 4 was present at the end of the AluJo repeat in antisense orientation, and the breakpoint localized in intron 10 was at the end of the AluSx1 repeat in the sense orientation. In exon4_8dup, the breakpoint in intron 3 was localized in the MER83 repeat (ERV1 family repeat) and the breakpoint in intron 8 in the AluSx1 sequence. There is no sequence homology between these repeats.

Discussion

The 117 large DNA rearrangements are listed on http://www.ucl.ac.uk/ldlr/Current/index.php?select_db=LDLR[7]: 100 deletions and 17 duplications. In the view of 98 Alu repeats within the LDLR gene [10], it is probable that DNA rearrangement breakpoints are located inside of Alu repetitive sequences. In the set of our FH patients, we detected 37 large DNA rearrangements in the LDLR gene and performed the precise characterization of breakpoints in all types of deletions and duplications. Results define most of breakpoints inside of Alu repeats (except one localised in ERV1 repeat) and NAHR and NHEJ as responsible for these rearrangements. Our results thus demonstrate that Alu mediated recombination leads to massive disturbances in the structural and functional integrity of the LDLR gene region. Promoter_exon2del is 13186 bp long and was detected in one Czech FH proband. Approximately 20 kb and 18 kb deletions of promoter, exon 1 and 2 were described previously [32,33]. Exon3_12del detected in one Czech FH proband was not described previously but deletions involving exon 3 were identified (exon3del [34], exon3_5del [35], exon3_6del [34], exon3_8del [36], and exon3_10del [37]). Exon5_10del was found in 4 Czech FH probands and was not described previously. Deletions encompassing exon 5 (exon5del and exon5_6del) were detected in studies [34,38], respectively. Exon9_14del was detected in 10 Czech FH probands. Niessen et al. found exon9_14del in Danish FH patients and performed also analysis of breakpoints. The correct size of the deletion described by Niessen was 9713 bp and both deletion breakpoints were localised in repetitive elements AluSq [39]. Exon9_14del determined in our FH probands sized 10291 bp and breakpoints were localised in repetitive elements AluYa5 and AluY. Exon9_10del and exon9_12del were also detected in literature [40]. Exon9_15del was present in 8 Czech FH probands and was not described previously. All duplications detected in our FH patients were new, not described so far. Exon2_6dup was detected in 9 Czech FH probands, exon4_8dup was found in one Czech FH proband, and exon16_18dup was determined in 3 Czech FH probands. The duplications exon2_8dup, exon4_5dup, and exon16_17dup were described [41-43]. It is interesting that exon2_6dup and exon9_15del were not described in literature and on http://www.ucl.ac.uk/ldlr/Current/index.php?select_db=LDLR, but in Czech FH patients these are relatively frequent (9 and 8 probands, respectively). In the above mentioned work, Nissen et al. [39] described 5 genomic deletions in the LDLR gene and defined the breakpoints of each deletion. The five deletions were flanked by Alu elements, supporting a mutation mechanism involving unequal homologous recombination between highly similar Alu elements. The deletion exon13_15del described by Nissen et al. was flanked by two AluSg elements and 15 bp had been inserted at the site of the deleted DNA. This short insertion did not show similarity to any interspersed repeats or any other DNA sequence in the LDLR gene. However, the sequence shows partial homology to several sites in human genome. It is possible to speculate, that in this particular case, the final sequence arrangement has been generated by a more complex mechanism of double strand break repair, involving several recombination steps (e.g., resection and invasion of one DNA strand to a site of a partial homology and its elongation, which was not followed by the single-strand annealing step of homologous recombination, but instead by synthesis-dependent NHEJ). Alternatively, this kind of deletion could have been produced by NHEJ alone, without previous steps of homologous recombination). However, this cannot be clearly distinguished from the final sequence. In this respect it should be mentioned that deletion and duplication spectra as the outcomes of recombination events in a given genomic locus are influenced not only by the DNA sequence context in the region itself (e.g., abundance and orientation of repeats and their variability) [44,45], but also by epigenetic factors. It corresponds to the fact that it is chromatin template, not a naked DNA, which is a subject of recombination. In the particular case of Alu repeats, the role of heterochromatic marks such as DNA methylation, or histone H3K9 methylation in suppression of recombination by these elements has been suggested in recent studies [46-48].

Conclusions

Eight different types of large genomic rearrangements were detected in the LDLR gene, from them 6 types were novel, not described so far. Sequence analysis of deletion and duplication breakpoints indicates that both intrachromatid non-allelic homologous recombination (NAHR), and non-homologous end joining (NHEJ) are involved in LDLR genomic rearrangements. While NAHR has been described in relation to the LDLR gene, this study as the first describes NHEJ in LDLR genomic rearrangements.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

RG performed detection of deletions/duplications in the LDLR gene using MLPA and detailed characterization of breakpoints, LT performed detection of deletions/duplications in the LDLR gene using MLPA and administrated database of patients, PZ and OL performed molecular analysis of the LDLR gene using PCR-RFLP, DNA sequencing and denaturing high performance liquid chromatography. TF and VS performed clinical examination, selection of patients with suspicion for familial hypercholesterolemia, and blood collections for DNA isolation. LF designed and coordinated the study and has been involved in evaluation of results and manuscript preparation. JF has been involved in evaluation of results and manuscript preparation. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2350/11/115/prepub
  47 in total

1.  The fine-scale and complex architecture of human copy-number variation.

Authors:  George H Perry; Amir Ben-Dor; Anya Tsalenko; Nick Sampas; Laia Rodriguez-Revenga; Charles W Tran; Alicia Scheffer; Israel Steinfeld; Peter Tsang; N Alice Yamada; Han Soo Park; Jong-Il Kim; Jeong-Sun Seo; Zohar Yakhini; Stephen Laderman; Laurakay Bruhn; Charles Lee
Journal:  Am J Hum Genet       Date:  2008-01-24       Impact factor: 11.025

2.  Epigenetic nucleosomes: Alu sequences and CG as nucleosome positioning element.

Authors:  F Salih; B Salih; S Kogan; E N Trifonov
Journal:  J Biomol Struct Dyn       Date:  2008-08

Review 3.  Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information.

Authors:  A M Weiner; P L Deininger; A Efstratiadis
Journal:  Annu Rev Biochem       Date:  1986       Impact factor: 23.643

4.  Standardized nomenclature for Alu repeats.

Authors:  M A Batzer; P L Deininger; U Hellmann-Blumberg; J Jurka; D Labuda; C M Rubin; C W Schmid; E Zietkiewicz; E Zuckerkandl
Journal:  J Mol Evol       Date:  1996-01       Impact factor: 2.395

5.  Comparison of genetic versus clinical diagnosis in familial hypercholesterolemia.

Authors:  Fernando Civeira; Emilio Ros; Estibaliz Jarauta; Nuria Plana; Daniel Zambon; Jose Puzo; Juan P Martinez de Esteban; Juan Ferrando; Sergio Zabala; Fatima Almagro; Jose A Gimeno; Luis Masana; Miguel Pocovi
Journal:  Am J Cardiol       Date:  2008-08-27       Impact factor: 2.778

6.  Mutation detection rate and spectrum in familial hypercholesterolaemia patients in the UK pilot cascade project.

Authors:  A Taylor; D Wang; K Patel; R Whittall; G Wood; M Farrer; R D G Neely; S Fairgrieve; D Nair; M Barbir; J L Jones; S Egan; R Everdale; Y Lolin; E Hughes; J A Cooper; S G Hadfield; G Norbury; S E Humphries
Journal:  Clin Genet       Date:  2010-03-13       Impact factor: 4.438

7.  Small deletion variants have stable breakpoints commonly associated with alu elements.

Authors:  Adam J de Smith; Robin G Walters; Lachlan J M Coin; Israel Steinfeld; Zohar Yakhini; Rob Sladek; Philippe Froguel; Alexandra I F Blakemore
Journal:  PLoS One       Date:  2008-08-29       Impact factor: 3.240

8.  Efficacy of statins in familial hypercholesterolaemia: a long term cohort study.

Authors:  Jorie Versmissen; Daniëlla M Oosterveer; Mojgan Yazdanpanah; Joep C Defesche; Dick C G Basart; Anho H Liem; Jan Heeringa; Jacqueline C Witteman; Peter J Lansberg; John J P Kastelein; Eric J G Sijbrands
Journal:  BMJ       Date:  2008-11-11

9.  Reductions in all-cause, cancer, and coronary mortality in statin-treated patients with heterozygous familial hypercholesterolaemia: a prospective registry study.

Authors:  Andrew Neil; Jackie Cooper; John Betteridge; Nigel Capps; Ian McDowell; Paul Durrington; Mary Seed; Steve E Humphries
Journal:  Eur Heart J       Date:  2008-10-07       Impact factor: 29.983

10.  Mapping insertions, deletions and SNPs on Venter's chromosomes.

Authors:  Maria Costantini; Giorgio Bernardi
Journal:  PLoS One       Date:  2009-06-22       Impact factor: 3.240

View more
  9 in total

Review 1.  On the sequence-directed nature of human gene mutation: the role of genomic architecture and the local DNA sequence environment in mediating gene mutations underlying human inherited disease.

Authors:  David N Cooper; Albino Bacolla; Claude Férec; Karen M Vasquez; Hildegard Kehrer-Sawatzki; Jian-Min Chen
Journal:  Hum Mutat       Date:  2011-09-02       Impact factor: 4.878

2.  Systematic analysis of variants related to familial hypercholesterolemia in families with premature myocardial infarction.

Authors:  Ingrid Brænne; Mariana Kleinecke; Benedikt Reiz; Elisabeth Graf; Tim Strom; Thomas Wieland; Marcus Fischer; Thorsten Kessler; Christian Hengstenberg; Thomas Meitinger; Jeanette Erdmann; Heribert Schunkert
Journal:  Eur J Hum Genet       Date:  2015-06-03       Impact factor: 4.246

3.  Disruption of ldlr causes increased LDL-c and vascular lipid accumulation in a zebrafish model of hypercholesterolemia.

Authors:  Elizabeth A O'Hare; Xiaochun Wang; May E Montasser; Yen-Pei C Chang; Braxton D Mitchell; Norann A Zaghloul
Journal:  J Lipid Res       Date:  2014-09-08       Impact factor: 5.922

4.  Use of next-generation sequencing to detect LDLR gene copy number variation in familial hypercholesterolemia.

Authors:  Michael A Iacocca; Jian Wang; Jacqueline S Dron; John F Robinson; Adam D McIntyre; Henian Cao; Robert A Hegele
Journal:  J Lipid Res       Date:  2017-09-05       Impact factor: 5.922

5.  Mutational Spectrum of LDLR and PCSK9 Genes Identified in Iranian Patients With Premature Coronary Artery Disease and Familial Hypercholesterolemia.

Authors:  Arman Moradi; Majid Maleki; Zahra Ghaemmaghami; Zahra Khajali; Feridoun Noohi; Maryam Hosseini Moghadam; Samira Kalyinia; Seyed Javad Mowla; Nabil G Seidah; Mahshid Malakootian
Journal:  Front Genet       Date:  2021-02-11       Impact factor: 4.599

6.  Identification of New Copy Number Variation and the Evaluation of a CNV Detection Tool for NGS Panel Data in Polish Familial Hypercholesterolemia Patients.

Authors:  Lena Rutkowska; Iwona Pinkier; Kinga Sałacińska; Łukasz Kępczyński; Dominik Salachna; Joanna Lewek; Maciej Banach; Paweł Matusik; Ewa Starostecka; Andrzej Lewiński; Rafał Płoski; Piotr Stawiński; Agnieszka Gach
Journal:  Genes (Basel)       Date:  2022-08-10       Impact factor: 4.141

7.  Whole genome sequence analysis of blood lipid levels in >66,000 individuals.

Authors:  Margaret Sunitha Selvaraj; Xihao Li; Zilin Li; Akhil Pampana; David Y Zhang; Joseph Park; Stella Aslibekyan; Joshua C Bis; Jennifer A Brody; Brian E Cade; Lee-Ming Chuang; Ren-Hua Chung; Joanne E Curran; Lisa de Las Fuentes; Paul S de Vries; Ravindranath Duggirala; Barry I Freedman; Mariaelisa Graff; Xiuqing Guo; Nancy Heard-Costa; Bertha Hidalgo; Chii-Min Hwu; Marguerite R Irvin; Tanika N Kelly; Brian G Kral; Leslie Lange; Xiaohui Li; Martin Lisa; Steven A Lubitz; Ani W Manichaikul; Preuss Michael; May E Montasser; Alanna C Morrison; Take Naseri; Jeffrey R O'Connell; Nicholette D Palmer; Patricia A Peyser; Muagututia S Reupena; Jennifer A Smith; Xiao Sun; Kent D Taylor; Russell P Tracy; Michael Y Tsai; Zhe Wang; Yuxuan Wang; Wei Bao; John T Wilkins; Lisa R Yanek; Wei Zhao; Donna K Arnett; John Blangero; Eric Boerwinkle; Donald W Bowden; Yii-Der Ida Chen; Adolfo Correa; L Adrienne Cupples; Susan K Dutcher; Patrick T Ellinor; Myriam Fornage; Stacey Gabriel; Soren Germer; Richard Gibbs; Jiang He; Robert C Kaplan; Sharon L R Kardia; Ryan Kim; Charles Kooperberg; Ruth J F Loos; Karine A Viaud-Martinez; Rasika A Mathias; Stephen T McGarvey; Braxton D Mitchell; Deborah Nickerson; Kari E North; Bruce M Psaty; Susan Redline; Alexander P Reiner; Ramachandran S Vasan; Stephen S Rich; Cristen Willer; Jerome I Rotter; Daniel J Rader; Xihong Lin; Gina M Peloso; Pradeep Natarajan
Journal:  Nat Commun       Date:  2022-10-11       Impact factor: 17.694

8.  Lipid levels in HIV-positive men receiving anti-retroviral therapy are not associated with copy number variation of reverse cholesterol transport pathway genes.

Authors:  Rebecca B Marino; Lawrence A Kingsley; Shehnaz K Hussain; Jay H Bream; Sudhir Penogonda; Priya Duggal; Jeremy J Martinson
Journal:  BMC Res Notes       Date:  2015-11-21

Review 9.  Alu mobile elements: from junk DNA to genomic gems.

Authors:  Sami Dridi
Journal:  Scientifica (Cairo)       Date:  2012-12-16
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.