Literature DB >> 20507741

Astrovirus encephalitis in boy with X-linked agammaglobulinemia.

Phenix Lan Quan1, Thor A Wagner, Thomas Briese, Troy R Torgerson, Mady Hornig, Alla Tashmukhamedova, Cadhla Firth, Gustavo Palacios, Ada Baisre-De-Leon, Christopher D Paddock, Stephen K Hutchison, Michael Egholm, Sherif R Zaki, James E Goldman, Hans D Ochs, W Ian Lipkin.   

Abstract

Encephalitis is a major cause of death worldwide. Although >100 pathogens have been identified as causative agents, the pathogen is not determined for up to 75% of cases. This diagnostic failure impedes effective treatment and underscores the need for better tools and new approaches for detecting novel pathogens or determining new manifestations of known pathogens. Although astroviruses are commonly associated with gastroenteritis, they have not been associated with central nervous system disease. Using unbiased pyrosequencing, we detected an astrovirus as the causative agent for encephalitis in a 15-year-old boy with agammaglobulinemia; several laboratories had failed to identify the agent. Our findings expand the spectrum of causative agents associated with encephalitis and highlight unbiased molecular technology as a valuable tool for differential diagnosis of unexplained disease.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20507741      PMCID: PMC4102142          DOI: 10.3201/eid1606.091536

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


The economic cost of encephalitis is profound. Among the general population of western industrialized countries, the annual incidence of acute encephalitis is 7.3 cases per 100,000 persons (). Although some persons recover from encephalitis without apparent sequelae, up to 71.0% experience lasting sequelae and up to 7.4% die (,). Khetsuriani et al. reported that each year in the United States alone, encephalitis is associated with ≈19,000 hospitalizations (average hospital stay 12 days), 1,400 deaths, and a cost of ≈$650 million for encephalitis-associated hospitalization (). Encephalitis is associated with a wide spectrum of infectious agents, including viruses, bacteria, fungi, and parasites (). The most commonly implicated viruses are herpes simplex, varicella-zoster, Epstein-Barr, mumps, measles, and enteroviruses (). Despite the use of various diagnostic methods (culture, molecular, immunohistochemical, or serologic), a causative agent is not identified for a high proportion of encephalitis cases (up to 75%) (). This diagnostic failure may reflect the absence of a known agent or its molecular footprint at time of sampling, suboptimal specimen handling, lack of assay sensitivity, or presence of an unexpected or novel agent not considered in conventional assays. A better understanding of emerging and reemerging pathogens implicated in outbreaks of encephalitis (e.g., West Nile virus, Hendra virus, Nipah virus, Australian bat lyssavirus, and enterovirus 71) indicates an urgent need for novel tools for rapid differential diagnostic testing and surveillance (,). The advent of unbiased molecular discovery technologies offers new opportunities to identify novel pathogens without the constraints imposed by assays selective for known or expected agents. We used unbiased high-throughput pyrosequencing to detect an astrovirus in a patient who died with unexplained encephalitis.

Materials and Methods

The Patient

In 2007, a 15-year-old boy with X-linked agammaglobulinemia (XLA) caused by a missense mutation (Thr35Pro) in the Bruton tyrosine kinase (Btk) gene was admitted to a psychiatric facility in Seattle, WA, USA, because of suicidal and homicidal ideation, headache, memory loss, and ataxia. He had progressive cognitive decline, was unable to walk or communicate within 4 weeks of admission, became comatose, and died 71 days after admission.

Samples

Patient samples available for examination were fresh-frozen biopsy specimens of frontal cortex and postmortem tissues (brain stem, frontal lobe, kidney, liver, and spleen). Also available for immunohistochemical and neuropathologic examination were formalin-fixed postmortem samples of cerebral cortex, basal ganglia, and cerebellum from the patient and from other persons without encephalitis or brain inflammation.

Unbiased High-Throughput Sequencing

RNA (0.5 μg) from the frontal cortex biopsy specimen was treated with DNase I (Ambion DNA-free; Austin, TX, USA) and reverse transcribed by using Superscript II (Invitrogen, Carlsbad, CA, USA) with random octamer primers linked to an arbitrary defined 17-mer primer sequence (Eurofins MWG Operon, Huntsville, AL, USA). cDNA was treated with RNase H before random PCR amplification with a 9:1 mixture of a 17-mer random sequence primer and an octamer-linked 17-mer random sequence primer (). Products with >70 bp were purified by using MinElute (QIAGEN, Valencia, CA, USA) and ligated to linkers for sequencing on a GSL FLX Sequencer (454 Life Sciences, Branford, CT, USA). After primers were trimmed and highly repetitive sequences eliminated, reads were clustered and assembled into contiguous fragments for comparison by BLAST () with the GenBank database at the nucleotide and translated amino acid levels. We used custom software applications written in Perl (BioPerl 5.8.5) and programs available through the GreenePortal website (http://tako.cpmc.columbia.edu/Tools/).

Rapid Amplification of cDNA Ends

Virus-specific primers for 5′ rapid amplification of cDNA ends were 5′-ACGCTCAAGCTCATGTCTGA-3′ for reverse transcription, 5′-GATGAGCGCTCTGTTTTCAA-3′ for the first PCR with UAP (Invitrogen), and 5′-TCAACCTCAACCCAATCGTT-3′ for the second PCR with AUAP (Invitrogen). Primers for 3′ rapid amplification of cDNA ends were 5′-CTCGCAAGGCATATGAGTGA-3′ and UAP (Invitrogen) for the first PCR and 5′-CTGGCTTGGTTGCAAAAGTT-3′ and AUAP (Invitrogen) for the second PCR. Final concentration of all primers was 0.2 mmol/L. PCR products were purified with QIAquick PCR Purification kits (QIAGEN) and directly dideoxy sequenced in both directions.

Quantitative Real-Time PCR

Reactions were performed in an ABI 7300 cycler by using SYBR-Green Master Mix (Applied Biosystems, Foster City, CA, USA) with primers 5′-CCATGTGTCTGATGGTGCTG-3′ and 5′-TTGATCATATCAATCACCAAATCA-3′ in a volume of 25 μL. Cycling conditions were 50°C for 2 min and 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and 60°C for 1 min.

Cloning, Expression, and Purification of VP29

The VP29 variable region of the capsid gene (nt 5231–6562) was amplified by PCR with forward VP29-KpnI primer 5′-CGGGGTACCTGCTAGGTAAATCAGCAAATACT-3′ and reverse VP29-XhoI primer 5′-CCGCTCGAGTTGATCATATCAATCACCAAATCA-3′. Histidine 6–tagged VP29 was expressed in Escherichia coli (Gateway vector pDEST 17; Invitrogen) and purified by using 1 mL Histrap column (GE Healthcare Life Sciences, Piscataway, NJ, USA) in denaturing binding buffer (20 mmol/L Tris-HCl [pH 8], 6 M guanidine, 0.5 M NaCl, 20 mmol/L imidazole), washed with 5 column volumes of denaturing binding buffer followed by 5 column volumes of denaturing wash buffer (20 mmol/L Tris-HCl [pH 8], 6 M urea, 0.5 M NaCl, 20 mmol/L imidazole), and eluted in denaturing elution buffer (20 mmol/L Tris-HCl [pH 8], 6 M urea, 0.5 M NaCl, 0.5 M imidazole). Peak fractions were analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis, pooled, and dialyzed against 20 mmol/L Tris-HCl (pH 8) and 3 M urea. Purification of VP29 was confirmed by Western blot with anti-histidine antibody (Genscript, Piscataway, NJ, USA) and mass spectroscopy of a trypsin-digested purified sample. Rabbit antiserum against VP29 was generated by injecting rabbits with recombinant VP29 (3 injections of 0.5 mg each in Freund complete/incomplete adjuvant). Immunoglobulin (Ig) G was purified by using protein A-Sepharose (Lampire Biologic Laboratories, Pipersville, PA, USA).

Immunohistochemistry and Immunofluorescence

Formalin-fixed, paraffin-embedded brain sections were heated at 56°C for 10 min, deparaffinized in a citrus clearing agent, and rehydrated through decreasing concentrations of ethanol. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 15 min. Heat-induced antigen retrieval was performed in Trilogy antigen retrieval solution (Cell Marque, Rocklin, CA, USA) for 20 min at 95°C, after which the solution was cooled for 30 min. After blocking with Background Sniper solution (BS966H; Biocare Medical, Concord, CA, USA) for 10 min at room temperature, sections were incubated with primary antibodies overnight at 4°C. Slides were washed with wash buffer (Dako, Carpinteria, CA, USA) and incubated with appropriate secondary antibody for either immunohistochemical or immunofluorescence examination. For immunohistochemical examination, Vectastain Elite ABC kits (PK-6101, AK5002; Vector Laboratories, Burlingame, CA, USA) were used to develop diaminobenzidine tetrahydrochloride chromogen. Tissue sections were incubated with either biotinylated goat antirabbit or biotinylated horse antimouse IgG (1:200, Vector Laboratories) for 1 h at 37°C, after which ABC reagents were added. Sections were counterstained with hematoxylin and dehydrated with 100% ethanol. Sections were affixed to slides by using Permount histologic mounting medium (Fisher, Fair Lawn, NJ, USA), and coverslips were placed. For immunofluorescence assays, sections were incubated with secondary Cy3-conjugated goat antirabbit antibody or Cy2 goat antimouse antibody (1:200, Jackson ImmunoResearch Laboratories, West Grove, PA, USA) for 1 h at room temperature. Sections were mounted on slides by using ProLong Gold antifade reagent with DAPI (Invitrogen). Images were viewed on a Zeiss LSM 510 multiphoton confocal microscope and analyzed by using AIM Software (Carl Zeiss GmbH, Thornwood, NY, USA). Primary antibodies used were mouse antiglial fibrillary acidic protein cocktail (1:100, BD Bioscience Pharmagen, San Jose, CA, USA), mouse anti-CD3 (1:350, Dako), and mouse anti-CD68 (1:50, Dako).

Phylogenetic Analysis

Representative capsid gene (open reading frame 2) sequences were downloaded from GenBank, and aligned with the capsid gene sequence of the novel astrovirus by using Se-Al version 2.0a11 (http://tree.bio.ed.ac.uk/software/seal/). A Bayesian phylogenetic tree based on the full-length amino acid alignment of the capsid protein was generated by using MrBayes version 3 () and the WAG amino acid transition model. Two independent runs were allowed to converge over 10 million generations, burn-in setting was 10%, and every 1,000 generations were sampled. The robustness of the resultant phylogenetic analysis was assessed by using Bayesian posterior probability values.

Results

During the patient’s hospitalization, Gram stain, bacterial cultures, PCR, and cryptococcal antigen tests of 2 cerebrospinal fluid samples performed on days 6 and 12 after hospitalization failed to detect any agents that might be implicated in disease (Table 1; Table 2 Table 3; Table 4). Examination of a frontal cortex biopsy found diffuse astrogliosis and microgliosis of gray and white matter, perivascular and parenchymal CD3+ T-cell infiltrates, neuronal loss, and axonal swelling. No Negri bodies, Cowdry inclusions, or evidence of prion disease were found. No infectious agents were detected by electron microscopy or immunohistochemistry when a panel of antiserum for detection of herpes simplex virus, polyomavirus, and adenovirus was used. Bacterial and fungal cultures, broad-based 16S rRNA PCR, viral culture, and PCR for multiple viruses were negative (Table 2; Table 3; Table 4).
Table 1

Results of testing of cerebrospinal fluid from 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis*

Hospitalization dayNucleated cells, cells/mm3 (ref <5)Erythrocytes,
cells/mm3Neutrophils, %Protein, mg/dL
(ref <40)Glucose, mg/dL
(ref 45%–60% of glucose in serum)Immunoglobulin G, mg/dL (ref 0.8–7.7)
64227650ND
126107148573.7

*Ref, reference value; ND, not done.

Table 2

Staining and culture results for 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis*

SampleAFB stainGram stainCryptococcal antigenBacterial culture†Fungal cultureViral culture
Cerebrospinal fluidNDNegNegNegNDND
Brain biopsyNegNDNDNegNegNeg

*AFB, acid-fast bacteria; ND, not done; neg, negative.
†Includes Mycobacteria spp.

Table 3

PCR results for bacteria, fungi, parasites, and DNA viruses in 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis*

SampleBacteria (16S)FungiToxoplasma
gondiiAdenovirusBK virusCMVEpstein-Barr virusJC virusParvovirus B19
Cerebrospinal fluidNDNDNDNDNegNegNegNegND
BrainNegNegNegNegNegNegNegNegNeg

*CMV, cytomegalovirus; ND, not done; neg, negative.

Table 4

PCR results for RNA viruses in 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis*

SampleCoronavirusEnterovirusHMPVHPIV 1 to 4HSV 1 or 2Influenza virus†RhinovirusRSVVZVWNV
Cerebrospinal fluidNDNegNegNDNegNDNDNDNegND
BrainNegNegNegNegNegNegNegNegNegNeg

*HMPV, human metapneumovirus; HPIV, human parainfluenza virus; HSV, herpes simplex virus; RSV, respiratory syncytial virus; VZV, varicella zoster virus; WNV, West Nile virus; ND, not done; neg, negative.
†Type A or B.

*Ref, reference value; ND, not done. *AFB, acid-fast bacteria; ND, not done; neg, negative.
†Includes Mycobacteria spp. *CMV, cytomegalovirus; ND, not done; neg, negative. *HMPV, human metapneumovirus; HPIV, human parainfluenza virus; HSV, herpes simplex virus; RSV, respiratory syncytial virus; VZV, varicella zoster virus; WNV, West Nile virus; ND, not done; neg, negative.
†Type A or B. Histologic examination of postmortem brain specimens showed diffuse neuronal loss, cortical thinning, and vacuolation of the gray matter of the cortices and deep nuclei (Figure 1, panels A, B) accompanied by astrogliosis in cortex and subcortical white matter (Figure 1, panels C, D). CD3+ T-lymphocytes were identified in the perivascular spaces, infiltrating the parenchyma (Figure 1, panel E), and in microglial nodules (Figure 1, panel F). No CD20+ B cells were noted. The white matter showed vacuolation and myelin clumps consistent with myelin degeneration (Figure 1, panel G), axonal loss (Figure 1, panel H), and microgliosis (Figure 1, panel I). Microcalcifications were seen in the globus pallidus (Figure 1, panel J).
Figure 1

Histologic findings from brain of 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis. A) Frontal cortex with cortical thinning (double-headed arrow) and vacuolation (arrows) (Luxol fast blue stain with periodic acid–Schiff method [LFB/PAS], original magnification ×10). B) Frontal cortex with vacuolation (arrow) and rare residual neurons (arrowheads) (LFB/PAS, original magnification ×50). C) Marked astrogliosis in the frontal cortex (glial fibrillary acidic protein [GFAP] immunostain, original magnification ×100). D) White matter with marked astrogliosis (GFAP immunostain, original magnification ×100). E) Penetrating artery with abundant CD3+ T-cells in the perivascular space and adjacent brain parenchyma (CD3+ immunostain, original magnification ×25). F) CD3+ T-cells as part of microglial nodules (CD3+ immunostain, original magnification ×100). G) White matter in the internal capsule showing myelin clumps (arrowheads) and vacuolation (arrow) (LFB/PAS, original magnification ×100). H) Loss of axons in the internal capsule (Bielschowsky nerve fiber silver stain, original magnification ×100). I) Internal capsule with marked microgliosis (CD68+ immunostain, original magnification ×40). J) Microcalcifications (arrow) in the globus pallidus (LFB/PAS, original magnification ×100). All paraffin sections were counterstained with hematoxylin.

Histologic findings from brain of 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis. A) Frontal cortex with cortical thinning (double-headed arrow) and vacuolation (arrows) (Luxol fast blue stain with periodic acid–Schiff method [LFB/PAS], original magnification ×10). B) Frontal cortex with vacuolation (arrow) and rare residual neurons (arrowheads) (LFB/PAS, original magnification ×50). C) Marked astrogliosis in the frontal cortex (glial fibrillary acidic protein [GFAP] immunostain, original magnification ×100). D) White matter with marked astrogliosis (GFAP immunostain, original magnification ×100). E) Penetrating artery with abundant CD3+ T-cells in the perivascular space and adjacent brain parenchyma (CD3+ immunostain, original magnification ×25). F) CD3+ T-cells as part of microglial nodules (CD3+ immunostain, original magnification ×100). G) White matter in the internal capsule showing myelin clumps (arrowheads) and vacuolation (arrow) (LFB/PAS, original magnification ×100). H) Loss of axons in the internal capsule (Bielschowsky nerve fiber silver stain, original magnification ×100). I) Internal capsule with marked microgliosis (CD68+ immunostain, original magnification ×40). J) Microcalcifications (arrow) in the globus pallidus (LFB/PAS, original magnification ×100). All paraffin sections were counterstained with hematoxylin. Because the histologic findings were consistent with virus infection and because molecular, serologic, and morphologic methods failed to identify an infectious agent, we pursued unbiased pyrosequencing of RNA from the frontal cortex biopsy specimen (,). From 2 cDNA libraries that mapped either to human (host) sequences or were uninformative in GenBank searches at the nucleotide level (BLASTn), we obtained an average of 102,000 sequence fragments with a mean length of 180 nt. However, analysis at the deduced amino acid level (BLASTx) identified 12 sequences homologous to astroviruses (Figure 2; Table 5). The complete 6,584-nt genomic sequence of the virus (GenBank accession no. GQ89199) was determined in a 2-step procedure in which gaps between sequence fragments identified through pyrosequencing were filled by PCR amplification and sequencing, and the genomic termini were cloned and sequenced by rapid amplification of cDNA ends (Figure 2; Table 6). Phylogenetic analyses placed the virus, tentatively named human astrovirus Puget Sound (HAstV-PS), apart from known human astroviruses. Analysis of the full-length capsid protein sequence showed HAstV-PS in a clade together with ovine, mink, and bat astroviruses (Figure 3); analyses of polymerase or protease protein sequences gave comparable results (data not shown).
Figure 2

Schematic genome organization of human astrovirus Puget Sound (HAstV-PS). Arrows represent the 3 open reading frames of the 6,584-nt single-strand, positive-sense genome. Bars above the schematic indicate the 12 contiguous fragments (contigs A–L) generated through unbiased high-throughput sequencing. PCR primers for amplification across sequence gaps were designed based on the unbiased high-throughput sequencing data, and the draft genome was resequenced by overlapping PCR products that covered the entire genome except for terminal sequences. Genomic termini were characterized with 5′ and 3′ rapid amplification of cDNA ends kits (Invitrogen, Carlsbad, CA, USA). Arrowheads indicate primer locations. PRO, protease; POL, polymerase; CA, capsid; (A)n, poly-A tail.

Table 5

Genomic location of HAstV-PS contigs identified by 454 pyrosequencing and their relationship to known astroviruses*

Contiguous fragmentGenome position in HAstV-PSHighest amino acid identity, %GenBank accession no.†Astrovirus species
A238–50452NP_795334Mink
B1765–183964NP_795334Mink
C2012–218467NP_795334Mink
D2308–246642NP_059945Ovine
E2763–294548AAO32082Mink
F3360–372865NP_059945Ovine
G4558–467965NP_795336Mink
H4558–514070NP_059946Ovine
I4708–494472NP_795336Mink
J4801–511072NP_059946Ovine
K4819–492976NP_059946Ovine
L5104–533170NP_059946Ovine

* HAstV-PS, human astrovirus Puget Sound.
†Accession number for BLASTX (www.ncbi.nlm.nih.gov/blast/Blast.cgi) match with highest amino acid identity (GenBank database December 2007).

Table 6

Primers used in cloning and sequencing the human astrovirus Puget Sound genome

Sequence, 5′ → 3′Position
TCATGGAGCGCTCATACAAG
GTGTAAGCGAAGCCAAAAGC38–57
815–796
GATTGGGTTGAGGTTGATGC*
TCCAGTGGTGGCTTGATGTA340–359
1797–1778
GAAGTGGGATGGTGGAGTTG
TCCAGAAATCCGATTCAACC666–685
1314–1295
TGGAGCAGTTGTTGGTGAAA
TTCTCAAGGTCTATCTCCCTTTGT1215–1234
1877–1854
TACATCAAGCCACCACTGGA*
TCCGCCTCTCTAAGCACTTC1778–1797
2159–2140
TACATCAAGCCACCACTGGA
TTGGATTGACTCCCTCAAGC1778–1797
2533–2514
ATCACCACAAGAGGCGTAGG*
CCAGTAACTGCTGATGGACCAACAA2039–2058
4649–4625
CGTGATTTGCAGGAATACCA
CCCATACGTGTCAGGGTTCT2446–2465
3343–3324
TCTGGAGAGAGGCCTGATGT
TCTCTCTTGACCCACATCCC3159–3178
3865–3846
CCTCTGGGCAAATATCCACA
TAGGGATATGCGGAAAACAGA3625–3644
4671–4651
GTTTGTGGCGCTTGAAAAGT
TTGCGTGGAAGAAAGTGTTG4583–4602
5365–5345
TTGTTGGTCCATCAGCAGTTACTGG*
AACTTTTGCAACCAAGCCAG4 625–4649
5175–5156
CTGGCTTGGTTGCAAAAGTT
GAGTATTGTGCCCGCAAAGT5156–5175
6041–6022
CGGCTACACCAGCCTACATT
CAGCACCATCAGACACATGG5833–5852
6442–6423

*Primer pairs designed for amplification between ultra–high-throughput sequencing contiguous fragments (Figure 2); primer pairs without asterisk were applied for resequencing of the draft genome.

Figure 3

Phylogenetic analysis of full-length capsid protein sequences showing the relationship between human astrovirus Puget Sound (HAstV-PS) identified in brain of 15-year-old boy with X-linked agammaglobulinemia and encephalitis and other astroviruses. GenBank accession numbers in parentheses: MLB1 (FJ22245), VA1 (FJ973620), HAstV-1 (AB000295), HAstV-2 (L06802), HAstV-3 (DQ630763), HAstV-4 (AB025803), HAstV-5 (U15136), HAstV-6 (Z46658), HAstV-7 (Y08632), HAstV-8 (Z66541), MAstV (AY179509), OAstV (NC_002469), BatAstV (FJ571074), FAstV (AF056197), ChAstV (EU650331), PAstV (Y15938), ANV 1 (AB033998), ANV 2 (AB046864), TAstV 1 (Y15936), and TAstV 2 (AY769615). Bayesian posterior probability values >75% are shown at respective nodes. FAstV, feline astrovirus; ChAstV, cheetah astrovirus; PAstV, porcine astrovirus; OAstV, ovine astrovirus; MAstV, mink astrovirus; ANV, avian nephritis virus; TAstV, turkey astrovirus. Scale bar indicates number of amino acid substitutions per site.

Schematic genome organization of human astrovirus Puget Sound (HAstV-PS). Arrows represent the 3 open reading frames of the 6,584-nt single-strand, positive-sense genome. Bars above the schematic indicate the 12 contiguous fragments (contigs A–L) generated through unbiased high-throughput sequencing. PCR primers for amplification across sequence gaps were designed based on the unbiased high-throughput sequencing data, and the draft genome was resequenced by overlapping PCR products that covered the entire genome except for terminal sequences. Genomic termini were characterized with 5′ and 3′ rapid amplification of cDNA ends kits (Invitrogen, Carlsbad, CA, USA). Arrowheads indicate primer locations. PRO, protease; POL, polymerase; CA, capsid; (A)n, poly-A tail. * HAstV-PS, human astrovirus Puget Sound.
†Accession number for BLASTX (www.ncbi.nlm.nih.gov/blast/Blast.cgi) match with highest amino acid identity (GenBank database December 2007). *Primer pairs designed for amplification between ultra–high-throughput sequencing contiguous fragments (Figure 2); primer pairs without asterisk were applied for resequencing of the draft genome. Phylogenetic analysis of full-length capsid protein sequences showing the relationship between human astrovirus Puget Sound (HAstV-PS) identified in brain of 15-year-old boy with X-linked agammaglobulinemia and encephalitis and other astroviruses. GenBank accession numbers in parentheses: MLB1 (FJ22245), VA1 (FJ973620), HAstV-1 (AB000295), HAstV-2 (L06802), HAstV-3 (DQ630763), HAstV-4 (AB025803), HAstV-5 (U15136), HAstV-6 (Z46658), HAstV-7 (Y08632), HAstV-8 (Z66541), MAstV (AY179509), OAstV (NC_002469), BatAstV (FJ571074), FAstV (AF056197), ChAstV (EU650331), PAstV (Y15938), ANV 1 (AB033998), ANV 2 (AB046864), TAstV 1 (Y15936), and TAstV 2 (AY769615). Bayesian posterior probability values >75% are shown at respective nodes. FAstV, feline astrovirus; ChAstV, cheetah astrovirus; PAstV, porcine astrovirus; OAstV, ovine astrovirus; MAstV, mink astrovirus; ANV, avian nephritis virus; TAstV, turkey astrovirus. Scale bar indicates number of amino acid substitutions per site. Real-time PCR indicated that viral load was higher in the biopsy specimen (1.53 × 107 RNA molecules per reaction) than in postmortem specimens (cerebellum [5.39 × 102], frontal lobe [1.14 × 102], and brain stem [1.92 × 104]). No viral RNA was found in postmortem kidney, liver, or spleen specimens. Commercial antibodies to human astroviruses did not stain infected brain (data not shown). Therefore, polyclonal antibodies were generated by injecting rabbits with recombinant capsid protein of HAstV-PS. Indirect double-immunofluorescence staining of postmortem tissue sections demonstrated capsid protein in hypertropic astrocytes throughout the subcortical white matter and cortex (Figure 4, panel A). Astrocytes had swollen cell bodies and showed intense immunostaining of the glial fibrillary acidic protein. Indirect immunohistochemical staining of a frontal cortex brain biopsy specimen demonstrated intracytoplasmic capsid protein in only 1 cell; morphologic appearance was consistent with that of a neuron (Figure 4, panel B). No evidence of infection was found in oligodendrocytes or macrophages.
Figure 4

Immunofluorescence and immunohistochemical analyses with human astrovirus Puget Sound capsid antibodies. A) Indirect double immunofluorescence–stained, formalin-fixed, paraffin-embedded tissue sections from 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis and a control with astrogliosis not caused by astrovirus infection. The sections were stained for the astrocyte marker glial fibrillary acidic protein (GFAP, green) and for viral capsid protein (rabbit serum 1:1,000, red). Viral capsid protein is present in hypertropic astrocytes throughout the subcortical white matter and cortex; astrocytes have swollen cell bodies with intense GFAP immunostaining. Blue signal (DAPI) indicates nuclear counterstaining. Original magnification ×100. B) Immunohistochemical localization of viral antigen in a frontal cortex biopsy specimen. Immunoalkaline phosphatase stain with viral capsid antibodies (rabbit serum 1:1,000) and naphthol-fast red with hematoxylin counterstain. Original magnification ×158.

Immunofluorescence and immunohistochemical analyses with human astrovirus Puget Sound capsid antibodies. A) Indirect double immunofluorescence–stained, formalin-fixed, paraffin-embedded tissue sections from 15-year-old boy with X-linked agammaglobulinemia and astrovirus encephalitis and a control with astrogliosis not caused by astrovirus infection. The sections were stained for the astrocyte marker glial fibrillary acidic protein (GFAP, green) and for viral capsid protein (rabbit serum 1:1,000, red). Viral capsid protein is present in hypertropic astrocytes throughout the subcortical white matter and cortex; astrocytes have swollen cell bodies with intense GFAP immunostaining. Blue signal (DAPI) indicates nuclear counterstaining. Original magnification ×100. B) Immunohistochemical localization of viral antigen in a frontal cortex biopsy specimen. Immunoalkaline phosphatase stain with viral capsid antibodies (rabbit serum 1:1,000) and naphthol-fast red with hematoxylin counterstain. Original magnification ×158.

Discussion

The astrovirus identified in the central nervous system (CNS) of an immunocompromised patient with XLA and encephalitis was discovered through unbiased high-throughput pyrosequencing after conventional methods failed to identify an infectious agent. The astrovirus infection was confirmed by specific PCR and antigen detection. To prove causation according to the Koch postulates, the infectious agent must be propagated and must reproduce disease in a previously unexposed host (); to prove causation according to Rivers, a specific humoral immune response to infection must be found (). Because we have not been able to grow the astrovirus in culture and because persons with XLA do not generate specific antibodies, these criteria have not been met. Nonetheless, the neuropathologic findings consistent with viral encephalitis in conjunction with the high viral load found in the CNS suggest a causative association between HAstV-PS and disease. The most prominent histologic lesions in the brain consisted of severe neuronal degeneration, hypertrophic astrocytes, and infiltration by T-lymphocytes and macrophages. Although we cannot exclude prominent neuronal infection earlier in the course of infection, immunohistochemical and immunofluorescence studies localized astroviral protein mainly in astrocytes. Astrocytes are essential to neuronal function and viability (); they are critical for maintenance of the blood–brain barrier; they provide axon guidance during development and structural support to neural elements; and they are involved in CNS homeostasis as regulators of extracellular glutamate, ionic environment, and pH (). Astrocyte dysfunction is implicated in the pathogenesis of acute and chronic CNS disorders (,). Recent data indicate that infected astrocytes play a role in the pathogenesis of HIV-associated dementia, a neurodegenerative disorder (). The essential features of this disorder are cognitive and motor impairment, speech problems, and behavioral changes. Similar to findings for the patient described here, HIV-associated dementia is characterized by infiltration of macrophages into the CNS, gliosis, pallor of myelin sheaths, and loss of neurons (). Astroviruses have not previously been associated with CNS disease. They are nonenveloped, single-stranded RNA viruses, are typically transmitted by the fecal–oral route, and cause mild gastrointestinal disease. Antibodies to human astrovirus-1 have been found in >90% of the human population (). Immunocompromised persons are prone to astrovirus infections of the gastrointestinal tract (). Postmortem analysis of the gastrointestinal tract of the patient described in this article found no evidence of astrovirus infection (data not shown); however, we cannot exclude the possibility of a gastrointestinal infection that cleared before the patient died. The fact that the patient had XLA may explain dissemination of the astrovirus to the CNS. XLA is a primary immunodeficiency disorder caused by mutations in the Btk gene, which results in absence of B lymphocytes and serum immunoglobulins (). Several recent reports demonstrate that Btk is required for Toll-like receptor 8–mediated production of interleukin-6 and production of tumor necrosis factor-α by peripheral blood mononuclear cell–derived dendritic cells (,). Hence, Btk deficiency may impair innate immune responses after a person is infected with single-stranded RNA viruses known to cause fatal CNS infection in those with XLA (,), such as enteroviruses, and now, potentially, astroviruses. The source of infection for the patient described here remains unknown. Exposure to mink was a potential source, suggested by the phylogenetic relationship of HAstV-PS to mink astroviruses and the proximity of the patient’s residence to a mink farm. Another possible source was the patient’s monthly treatment with intravenous immunoglobulin. Several reports describe progressive neurodegeneration of unknown cause in immunosuppressed patients who received long-term intravenous immunoglobulin therapy (,). Some of these patients had neuropathologic findings similar to those reported here (,). Intravenous immunoglobulin preparations from 5 companies (Vivaglobin [CSL Behring GmbH, Marburg, Germany], Carimune [CSL Behring GmbH], Gammagard [Baxter, Westlake Village, CA, USA], Gamimune N [Bayer Healthcare Pharmaceuticals, West Haven, CT, USA], Flebogamma [Instituto Grifols, S.A. Barcelona, Spain]) were negative for the newly identified astrovirus, according to ELISA and PCR (data not shown). The recent finding of an astrovirus closely related to HAstV-PS in fecal samples from children from Virginia with acute gastroenteritis () suggests that these novel viruses are circulating widely in humans across the United States. They should be considered in the differential diagnosis of encephalitis, particularly for immunosuppressed patients. Despite extensive microbiologic investigation, the causes of up to 75% of encephalitis cases remain elusive. These undiagnosed cases pose a challenge for clinical medicine and public health and underscore the need to invest in developing new methods for investigating these debilitating, frequently fatal, disorders. To address the challenge of unexplained encephalitis, public health practitioners and diagnosticians need a more comprehensive armamentarium and methods that would enable them to discover new and unexpected pathogens associated with encephalitis. Our findings emphasize the value of unbiased pyrosequencing as a powerful tool for diagnosing the cause of encephalitis and the need to consider astroviruses as CNS pathogens, particularly in immunosuppressed persons. Early recognition of the causative agent of unexplained encephalitis cases will enable specific interventions that reduce illness and death and facilitate the recognition of outbreaks that threaten public health.
  25 in total

1.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

2.  Basic local alignment search tool.

Authors:  S F Altschul; W Gish; W Miller; E W Myers; D J Lipman
Journal:  J Mol Biol       Date:  1990-10-05       Impact factor: 5.469

Review 3.  Astrocytic dysfunction: insights on the role in neurodegeneration.

Authors:  Daniela Rossi; Andrea Volterra
Journal:  Brain Res Bull       Date:  2009-07-22       Impact factor: 4.077

Review 4.  Emerging viral infections of the central nervous system: part 2.

Authors:  Kenneth L Tyler
Journal:  Arch Neurol       Date:  2009-09

Review 5.  Emerging viral infections of the central nervous system: part 1.

Authors:  Kenneth L Tyler
Journal:  Arch Neurol       Date:  2009-08

6.  Impaired Toll-like receptor 8-mediated IL-6 and TNF-alpha production in antigen-presenting cells from patients with X-linked agammaglobulinemia.

Authors:  Klára Sochorová; Rudolf Horváth; Daniela Rozková; Jirí Litzman; Jirina Bartunková; Anna Sedivá; Radek Spísek
Journal:  Blood       Date:  2006-11-07       Impact factor: 22.113

7.  Identification of a novel astrovirus (astrovirus VA1) associated with an outbreak of acute gastroenteritis.

Authors:  Stacy R Finkbeiner; Yan Li; Susan Ruone; Christina Conrardy; Nicole Gregoricus; Denise Toney; Herbert W Virgin; Larry J Anderson; Jan Vinjé; David Wang; Suxiang Tong
Journal:  J Virol       Date:  2009-08-12       Impact factor: 5.103

8.  Signaling by Toll-like receptors 8 and 9 requires Bruton's tyrosine kinase.

Authors:  Sarah L Doyle; Caroline A Jefferies; Con Feighery; Luke A J O'Neill
Journal:  J Biol Chem       Date:  2007-10-11       Impact factor: 5.157

9.  A new arenavirus in a cluster of fatal transplant-associated diseases.

Authors:  Gustavo Palacios; Julian Druce; Lei Du; Thomas Tran; Chris Birch; Thomas Briese; Sean Conlan; Phenix-Lan Quan; Jeffrey Hui; John Marshall; Jan Fredrik Simons; Michael Egholm; Christopher D Paddock; Wun-Ju Shieh; Cynthia S Goldsmith; Sherif R Zaki; Mike Catton; W Ian Lipkin
Journal:  N Engl J Med       Date:  2008-02-06       Impact factor: 91.245

Review 10.  Astrocytes, from brain glue to communication elements: the revolution continues.

Authors:  Andrea Volterra; Jacopo Meldolesi
Journal:  Nat Rev Neurosci       Date:  2005-08       Impact factor: 34.870

View more
  141 in total

1.  Detection of a novel astrovirus in brain tissue of mink suffering from shaking mink syndrome by use of viral metagenomics.

Authors:  Anne-Lie Blomström; Frederik Widén; Anne-Sofie Hammer; Sándor Belák; Mikael Berg
Journal:  J Clin Microbiol       Date:  2010-10-06       Impact factor: 5.948

2.  Astrovirus outbreak at a pediatric hematology and hematopoietic stem cell transplant unit despite strict hygiene rules.

Authors:  H P J van der Doef; E Bathoorn; M P M van der Linden; T F W Wolfs; A L C Minderhoud; M B Bierings; A M J Wensing; C A Lindemans
Journal:  Bone Marrow Transplant       Date:  2016-01-25       Impact factor: 5.483

3.  Propagation of Astrovirus VA1, a Neurotropic Human Astrovirus, in Cell Culture.

Authors:  Andrew B Janowski; Irma K Bauer; Lori R Holtz; David Wang
Journal:  J Virol       Date:  2017-09-12       Impact factor: 5.103

4.  Neurotropic astrovirus in cattle with nonsuppurative encephalitis in Europe.

Authors:  Ilias G Bouzalas; Daniel Wüthrich; Julia Walland; Cord Drögemüller; Andreas Zurbriggen; Marc Vandevelde; Anna Oevermann; Rémy Bruggmann; Torsten Seuberlich
Journal:  J Clin Microbiol       Date:  2014-07-02       Impact factor: 5.948

Review 5.  Ecological Drivers of Virus Evolution: Astrovirus as a Case Study.

Authors:  Ian H Mendenhall; Gavin J D Smith; Dhanasekaran Vijaykrishna
Journal:  J Virol       Date:  2015-05-06       Impact factor: 5.103

6.  Fruits of virus discovery: new pathogens and new experimental models.

Authors:  David Wang
Journal:  J Virol       Date:  2014-11-19       Impact factor: 5.103

7.  Impact of Contaminating DNA in Whole-Genome Amplification Kits Used for Metagenomic Shotgun Sequencing for Infection Diagnosis.

Authors:  Matthew Thoendel; Patricio Jeraldo; Kerryl E Greenwood-Quaintance; Janet Yao; Nicholas Chia; Arlen D Hanssen; Matthew P Abdel; Robin Patel
Journal:  J Clin Microbiol       Date:  2017-03-29       Impact factor: 5.948

8.  Bovine astrovirus infection in feedlot cattle with neurological disease in western Canada.

Authors:  Senija Selimovic-Hamza; Sergio Sanchez; Hélène Philibert; Edward G Clark; Torsten Seuberlich
Journal:  Can Vet J       Date:  2017-06       Impact factor: 1.008

9.  New astrovirus in human feces from Burkina Faso.

Authors:  Tung Gia Phan; Johan Nordgren; Djeneba Ouermi; Jacques Simpore; Leon W Nitiema; Xutao Deng; Eric Delwart
Journal:  J Clin Virol       Date:  2014-04-13       Impact factor: 3.168

10.  Neuroinfectious diseases: a crisis in neurology and a call for action.

Authors:  Avindra Nath
Journal:  JAMA Neurol       Date:  2015-02       Impact factor: 18.302

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.