Literature DB >> 19607664

Independent inactivation of arginine decarboxylase genes by nonsense and missense mutations led to pseudogene formation in Chlamydia trachomatis serovar L2 and D strains.

Teresa N Giles1, Derek J Fisher, David E Graham.   

Abstract

BACKGROUND: Chlamydia have reduced genomes that reflect their obligately parasitic lifestyle. Despite their different tissue tropisms, chlamydial strains share a large number of common genes and have few recognized pseudogenes, indicating genomic stability. All of the Chlamydiaceae have homologs of the aaxABC gene cluster that encodes a functional arginine:agmatine exchange system in Chlamydia (Chlamydophila)pneumoniae. However, Chlamydia trachomatis serovar L2 strains have a nonsense mutation in their aaxB genes, and C. trachomatis serovar A and B strains have frameshift mutations in their aaxC homologs, suggesting that relaxed selection may have enabled the evolution of aax pseudogenes. Biochemical experiments were performed to determine whether the aaxABC genes from C. trachomatis strains were transcribed, and mutagenesis was used to identify nucleotide substitutions that prevent protein maturation and activity. Molecular evolution techniques were applied to determine the relaxation of selection and the scope of aax gene inactivation in the Chlamydiales.
RESULTS: The aaxABC genes were co-transcribed in C. trachomatis L2/434, during the mid-late stage of cellular infection. However, a stop codon in the aaxB gene from this strain prevented the heterologous production of an active pyruvoyl-dependent arginine decarboxylase. Replacing that ochre codon with its ancestral tryptophan codon rescued the activity of this self-cleaving enzyme. The aaxB gene from C. trachomatis D/UW-3 was heterologously expressed as a proenzyme that failed to cleave and form the catalytic pyruvoyl cofactor. This inactive protein could be rescued by replacing the arginine-115 codon with an ancestral glycine codon. The aaxC gene from the D/UW-3 strain encoded an active arginine:agmatine antiporter protein, while the L2/434 homolog was unexpectedly inactive. Yet the frequencies of nonsynonymous versus synonymous nucleotide substitutions show no signs of relaxed selection, consistent with the recent inactivation of these genes.
CONCLUSION: The ancestor of the Chlamydiaceae had a functional arginine:agmatine exchange system that is decaying through independent, parallel processes in the C. trachomatis lineage. Differences in arginine metabolism among Chlamydiaceae species may be partly associated with their tissue tropism, possibly due to the protection conferred by a functional arginine-agmatine exchange system against host nitric oxide production and innate immunity. The independent loss of AaxB activity in all sequenced C. trachomatis strains indicates continual gene inactivation and illustrates the difficulty of recognizing recent bacterial pseudogenes from sequence comparison, transcriptional profiling or the analysis of nucleotide substitution rates.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19607664      PMCID: PMC2720952          DOI: 10.1186/1471-2148-9-166

Source DB:  PubMed          Journal:  BMC Evol Biol        ISSN: 1471-2148            Impact factor:   3.260


Background

Members of the Chlamydiaceae family grow inside host cells, when infectious elementary bodies (EBs) differentiate into replicative reticulate bodies (RBs). Worldwide, Chlamydia trachomatis serovars A-C are responsible for millions of cases of conjunctivitis and trachoma [1]. Genital infections by C. trachomatis serovars D-K cause the most commonly reported bacterial sexually transmitted disease [2]. C. trachomatis lymphogranuloma venereum serovars L1-L3 are invasive strains that can disseminate to lymph nodes and cause chronic inflammation. Chlamydia (Chlamydophila)pneumoniae causes 10% of pneumonia cases each year, and most adults are seropositive for C. pneumoniae antigens [3]. Despite differences in tissue tropism and virulence, these chlamydiae share a significant portion of their genomes, including about 711 coding DNA sequences (CDS) [4,5]. The Chlamydiaceae diverged from a non-pathogenic ancestor about 700 mya [5]. Intracellular bacterial pathogens such as Rickettsia and Chlamydia have undergone reductive evolution, as reduced purifying selection and a cascading loss of DNA repair genes led to gene inactivation and genome contraction [6]. While rickettsial genomes have a high number of split genes, a high proportion of noncoding DNA, and a low G+C nucleotide composition (~30%) [7], chlamydial genomes have few recognized pseudogenes, high coding densities (~90%) and moderate G+C nucleotide compositions (~40%) [8]. Despite the dramatic effects of gene loss, it has been difficult to determine the mode of reductive evolution from the snapshots provided by modern genome sequences. The chlamydial genomes are only half as large as the Parachlamydia sp. UWE25 genome, so both gene acquisition and gene loss have distinguished these lineages [5]. A comparison between genome sequences from C. trachomatis serovars A and D identified only 18 significant deletions in either strain, producing eight pseudogenes (interrupted open reading frames) in serovar A [9]. Another comparison between genome sequences from L2 and serovar A/D strains of C. trachomatis identified 15 pseudogenes in L2 strains [10]. Due to the relatively low number of chlamydial pseudogenes (< 2% of CDS) and the conservation of chlamydial genome size (1.0 to 1.2 Mbp), these bacteria are believed to have undergone reductive evolution, arriving at a stable genome structure. However, this model discounts gene transfer to the Chlamydiales, positive selection for antigenic proteins, and thousands of nonsynonymous amino acid substitutions that have occurred among the strains [9,11-13]. Single nucleotide polymorphisms account for much of the diversity among C. trachomatis serovars [12]. Deciphering the differences in their genetic content will provide important clues to understand tissue tropism and subsequent disease. Most inactivated, or nonfunctionalized pseudogenes are recognized in genome sequences by the presence of nonsense mutations or indels that substantially truncate CDS compared with homologous sequences. However, these mutations occur less frequently than missense mutations, which can have either minimal or catastrophic effects on protein folding and function [14]. Inactivating substitutions are particularly difficult to identify, since these genes can still be transcribed (and even translated): it is challenging to predict and prove their lack of activity [15]. Even some genes with gross mutations can still be transcribed, leading to a broader definition of pseudogenes that may include many unrecognized elements [16]. In this article, we describe the independent inactivation of two arginine decarboxylase orthologs from Chlamydia trachomatis strains, showing that gene loss continues in these pathogens, and illustrating the challenges of identifying recently nonfunctionalized genes. We previously identified three genes from C. pneumoniae that comprise an arginine:agmatine exchange system (AAX). The aaxA gene encodes an outer-membrane porin protein that stimulates the activity of this system [17]. The aaxB gene encodes an arginine decarboxylase proenzyme that self-cleaves at Ser53 to produce a small β-subunit and a larger α-subunit with a pyruvoyl cofactor that is essential for catalytic activity [18]. Finally, the aaxC gene encodes a cytoplasmic-membrane arginine:agmatine antiporter [17]. Together, these proteins catalyze the import of L-arginine, the decarboxylation of arginine to produce agmatine, and the export of agmatine from the cell. All chlamydial genome sequences contain orthologs of the aaxABC genes, which were apparently acquired by the chlamydial ancestor through horizontal gene transfer. Both the C. pneumoniae and C. trachomatis strains require exogenous arginine for growth, and their genomes lack arginine biosynthesis genes [19,20]. Chlamydial genomes contain artJ and glnPQ genes encoding a putative ABC-type arginine transporter, which is controlled by the ArgR transcriptional regulator in some species [21]. Therefore the AAX system is probably not used to acquire proteinogenic amino acids. Instead, this system could have several possible functions: it could raise the intracellular pH to resist acidification, produce agmatine – inhibiting host cell polyamine biosynthesis, or inhibit nitric oxide synthesis by host cells [17]. Global microarray analysis indicated that C. pneumoniae aax genes are transcribed late in the developmental cycle [22]. Similarly, C. trachomatis serovar L2/434 cells transcribe the aaxA and aaxB genes beginning 18 hours post infection, shortly before RBs begin to differentiate into EBs [23]. The AaxA protein is incorporated in the outer membrane in EBs from L2/434 cells [24]. Transcriptional profiles from C. trachomatis D/UW-3 cells also identified the highest levels of aaxB and aaxC transcripts at 16–40 hours post infection [25]. In this report, we confirm the late expression of the aaxA, aaxB and aaxC genes in L2/434 cells and demonstrate that the three genes are co-transcribed, using RT-PCR. However, the C. trachomatis L2/434 aaxB gene contains an ochre terminator in place of the tryptophan codon 128 found in other chlamydial orthologs (Figure 1) [10]. The resulting L2/434 protein is predicted to be truncated at amino acid 127, compared to the full 195 amino acids found in the homologous proteins. In contrast, the D/UW-3 aaxB gene is predicted to express a full-length protein that differs in only three positions from the L2/434 homolog.
Figure 1

Alignment of . Conserved amino acid residues are indicated by dots, while differences in the chlamydial sequences are indicated by lower-case symbols. The bottom row of the alignment shows an ancestral sequence for the C. trachomatis aaxB genes that was predicted using the codeml program, as described in the text. The ochre128 nonsense codon in the C. trachomatis L2/434 sequence is indicated by an asterisk, and the column of corresponding amino acids is colored red. The column of residues corresponding to Arg and Gly115 is also colored red. Sequence accession numbers are listed in Table 5.

Alignment of . Conserved amino acid residues are indicated by dots, while differences in the chlamydial sequences are indicated by lower-case symbols. The bottom row of the alignment shows an ancestral sequence for the C. trachomatis aaxB genes that was predicted using the codeml program, as described in the text. The ochre128 nonsense codon in the C. trachomatis L2/434 sequence is indicated by an asterisk, and the column of corresponding amino acids is colored red. The column of residues corresponding to Arg and Gly115 is also colored red. Sequence accession numbers are listed in Table 5. To determine whether the C. trachomatis L2/434 and D/UW-3 strains encode functional AaxB arginine decarboxylases, we cloned both aaxB genes in E. coli and determined heterologous expression using immunoblotting and activity assays. Neither gene produced a functional arginine decarboxylase in E. coli; however, site-directed mutagenesis experiments showed that AaxB from L2/434 could be rescued by an X128W replacement, and AaxB from D/UW-3 could be rescued by an R115G replacement. Multiple frameshift mutations in aaxC genes from C. trachomatis A/Har-13 and B/Jali are predicted to inactivate those genes [10]. E. coli cells expressing AaxC demonstrated arginine uptake activity of the D/UW-3 AaxC, but not the L2/434 AaxC proteins. Therefore the AAX system appears to be undergoing inactivation in parallel among the C. trachomatis strains. Transcription of these nonfunctional genes suggests that bioinformatic analysis underestimates the number of inactive genes in organisms undergoing reductive evolution. Neither a comparison of d/dvalues nor amino acid substitution analysis was sufficiently sensitive or specific to detect recent gene inactivation by missense mutations.

Results and discussion

Expression of the aax genes in C. trachomatis L2/434

cDNAs were prepared from chlamydial cells harvested 24 h post-infection. PCR amplification of intergenic regions showed that the aaxA and aaxB genes were transcribed on the same mRNA, as were the aaxB and aaxC genes (Figure 2A and 2B). No amplified product was detected for the region upstream of aaxA or downstream of aaxC, suggesting that these three genes are coordinately transcribed in a single operon. A canonical Shine-Dalgarno sequence (ribosome binding site) preceded each putative initiator codon. The aaxABC gene cluster is conserved in all Chlamydia spp. genome sequences, and this operon is predicted to coordinately express all three genes from a polycistronic mRNA.
Figure 2

Analysis of . Part A shows a map of the putative CTL0626-CTL0628 operon, comprising the aaxABC gene cluster. Both intragenic regions (bars 1–3 shown in red) and intergenic regions (bars A-D shown in blue) were amplified by RT-PCR. Part B shows PCR amplification products for the intergenic regions identified in part A using either cDNA, prepared from 24 h cultures of C. trachomatis L2/434, or chromosomal DNA as a template. Part C shows the PCR amplification products for the constitutively expressed hsp60 gene, using cDNA prepared from uninfected cells (mock) or C. trachomatis L2-infected cells harvested at the indicated hours post infection (hpi). Control reactions were performed using DNA (left lanes) or omitting reverse transcriptase (-RT) prior to PCR analysis. Part D shows gene-specific RT-PCR products to semi-quantitatively assess transcript levels during the course of infection. The numbered reactions correspond to the regions shown in part A. Control DNA reactions are shown in the left-hand lanes of each section, next to mock infection controls. Marker lanes (M) shows bands corresponding to 0.25, 0.50, 0.75 or 1.0 kbp DNA standards, as indicated. All PCR products were separated on 1.5% agarose electrophoresis gels and stained using ethidium bromide. The images were cropped, inverted and adjusted for contrast and brightness using Photoshop CS3 software (Adobe).

Analysis of . Part A shows a map of the putative CTL0626-CTL0628 operon, comprising the aaxABC gene cluster. Both intragenic regions (bars 1–3 shown in red) and intergenic regions (bars A-D shown in blue) were amplified by RT-PCR. Part B shows PCR amplification products for the intergenic regions identified in part A using either cDNA, prepared from 24 h cultures of C. trachomatis L2/434, or chromosomal DNA as a template. Part C shows the PCR amplification products for the constitutively expressed hsp60 gene, using cDNA prepared from uninfected cells (mock) or C. trachomatis L2-infected cells harvested at the indicated hours post infection (hpi). Control reactions were performed using DNA (left lanes) or omitting reverse transcriptase (-RT) prior to PCR analysis. Part D shows gene-specific RT-PCR products to semi-quantitatively assess transcript levels during the course of infection. The numbered reactions correspond to the regions shown in part A. Control DNA reactions are shown in the left-hand lanes of each section, next to mock infection controls. Marker lanes (M) shows bands corresponding to 0.25, 0.50, 0.75 or 1.0 kbp DNA standards, as indicated. All PCR products were separated on 1.5% agarose electrophoresis gels and stained using ethidium bromide. The images were cropped, inverted and adjusted for contrast and brightness using Photoshop CS3 software (Adobe). To determine the time course of aaxABC expression, cDNAs were prepared from RNA isolated 8, 24 or 46 h post-infection. As a control, cDNAs also were prepared from RNA isolated from a mock infection, containing only host cells. Amplification of an intragenic region of the constitutively expressed hsp60 gene confirmed the specificity and sensitivity of the analysis (Figure 2C). Amplification of intragenic regions of the aaxA, aaxB, or aaxC cDNAs showed significant levels of expression 24 and 46 h post-infection, but failed to detect expression during the early stage at 8 h (Figure 2D). Therefore, all three genes of the AAX system are preferentially transcribed at the mid- or late-stages of infection, when EBs begin to form. These results are consistent with expression profiles reported from microarray studies of global gene expression [23,25]. Although the semi-quantitative transcript analysis shown in Figure 2D indicates that levels of aaxC expression are the same or lower than aaxA levels, we cannot rule out the possibility of multiple, unidentified promoters in this gene cluster.

Heterologous expression of AaxB from L2 and D strains

To test whether the L2/434 CTL0627 (aaxB) gene encodes an active, truncated AaxB protein or is a true pseudogene, the CTL0627 and CTL0628 (aaxC) genes were cloned in a multi-copy plasmid vector. An E. coli strain missing the native adiAYC arginine uptake and decarboxylase genes was used to express AaxB fused to amino-terminal T7-epitope and hexahistidine tags, and untagged AaxC. Immunoblotting found no epitope-tagged protein in lysates of this strain (Figure 3), and no arginine decarboxylase activity was detected in cell-free extracts. Therefore the L2/434 aaxB homolog acts as a pseudogene in E. coli. No candidate for a suppressor tRNA was reported in the L2/434 genome sequence [10] or identified using the tRNAscan-SE program (ver. 1.23, general, cove only model) [26].
Figure 3

Full-length AaxB proteins were detected in immunoblots of . A 31-kDa T7-Tag protein standard was loaded in lane S (Novagen). Lane 1 contained 112 μg extract from E. coli DEG0147 (pDG479), containing the wild-type L2/434 aaxB pseudogene fused to an amino-terminal T7-Tag. Lane 2 contained 30 μg extract from E. coli DEG0147 (pDG543) expressing the X128W variant of aaxB from strain L2/434. Lane 3 contained protein size standards (without an epitope tag). Lane 4 contained 0.7 μg affinity-purified X128W variant of AaxB from strain L2, including a small amount of cleaved β-subunit. Lane 5 contained 117 μg extract from E. coli DEG0147 (pBAD/HisA) as a negative control. Lane 6 contained 72 μg extract from E. coli DEG0147 (pDG558) expressing the epitope-tagged aaxB from strain D/UW-3. The image was saturated to detect low levels of protein expression or cleavage, and it was processed as described for Figure 2.

Full-length AaxB proteins were detected in immunoblots of . A 31-kDa T7-Tag protein standard was loaded in lane S (Novagen). Lane 1 contained 112 μg extract from E. coli DEG0147 (pDG479), containing the wild-type L2/434 aaxB pseudogene fused to an amino-terminal T7-Tag. Lane 2 contained 30 μg extract from E. coli DEG0147 (pDG543) expressing the X128W variant of aaxB from strain L2/434. Lane 3 contained protein size standards (without an epitope tag). Lane 4 contained 0.7 μg affinity-purified X128W variant of AaxB from strain L2, including a small amount of cleaved β-subunit. Lane 5 contained 117 μg extract from E. coli DEG0147 (pBAD/HisA) as a negative control. Lane 6 contained 72 μg extract from E. coli DEG0147 (pDG558) expressing the epitope-tagged aaxB from strain D/UW-3. The image was saturated to detect low levels of protein expression or cleavage, and it was processed as described for Figure 2. For comparison, the CT373 (aaxB) and CT374 (aaxC) genes from C. trachomatis D/UW-3 were expressed from the same vector, producing T7-tagged AaxB protein in cell lysates (Figure 3). However, this pyruvoyl-dependent arginine decarboxylase must be cleaved to produce active enzyme, and no epitope-tagged cleavage product was detected by immunoblotting. Presumably due to the lack of self-cleavage, no arginine decarboxylase activity was detected in these cell-free extracts either. In contrast, the C. pneumoniae AaxB protein was significantly activated in E. coli [18].

Restoration of AaxB activity by site-directed mutagenesis

The C. trachomatis AaxB protein sequences share 89% amino acid identity and 97% similarity with the active C. pneumoniae ortholog (Figure 1). Therefore site-directed mutagenesis was used to replace the ochre codon at position 128 of the L2/434 aaxB pseudogene with a tryptophan codon that is found in the C. pneumoniae and other C. trachomatis homologs. This X128W variant protein was expressed at high levels in E. coli extract, and the affinity-purified protein contained epitope-tagged β-subunit (Figure 3). This purified protein contained a mixture of proenzyme and 41% cleaved protein forming α- and β-subunits (Figure 4), compared to 57% cleaved protein from C. pneumoniae. The purified X128W variant protein catalyzed the decarboxylation of L-arginine with a pH optimum near 3.4, as observed for the C. pneumoniae AaxB [18]. Accounting for only the cleaved portion of protein, this X128W variant had a KM of 5.4 mM and a kcat of 2.3 s-1, compared to a KM of 5.0 mM and a turnover of 6.9 s-1 for C. pneumoniae AaxB.
Figure 4

SDS-PAGE analysis of affinity-purified proteins shows the AaxB variant proteins self-cleaved in . Lane M contains polypeptide markers (Bio-Rad). Lane 1 contains the X128W variant of His6-AaxB from strain L2/434, including proenzyme (26 kDa expected, 26 kDa observed), α-subunit (16 kDa expected, 16 kDa observed) and β-subunit (10 kDa expected, 8 kDa observed). Lane 2 contains His10-AaxB from strain D/UW-3, including only proenzyme (24 kDa expected, 25 kDa observed). Lane 3 contains the R115G variant of His10AaxB from strain D/UW-3, including proenzyme (25 kDa expected, 25 kDa observed), α-subunit (16 kDa expected, 16 kDa observed) and β-subunit (9 kDa expected, 6 kDa observed). The gel was stained with silver, and the image was processed as described for Figure 2.

SDS-PAGE analysis of affinity-purified proteins shows the AaxB variant proteins self-cleaved in . Lane M contains polypeptide markers (Bio-Rad). Lane 1 contains the X128W variant of His6-AaxB from strain L2/434, including proenzyme (26 kDa expected, 26 kDa observed), α-subunit (16 kDa expected, 16 kDa observed) and β-subunit (10 kDa expected, 8 kDa observed). Lane 2 contains His10-AaxB from strain D/UW-3, including only proenzyme (24 kDa expected, 25 kDa observed). Lane 3 contains the R115G variant of His10AaxB from strain D/UW-3, including proenzyme (25 kDa expected, 25 kDa observed), α-subunit (16 kDa expected, 16 kDa observed) and β-subunit (9 kDa expected, 6 kDa observed). The gel was stained with silver, and the image was processed as described for Figure 2. Affinity-purified AaxB from D/UW-3 contained only proenzyme (Figure 4), yet this protein differs from the active X128W L2/434 protein in only two amino acid positions (Figure 1). The Val155Ile substitution is conservative, and probably reflects the ancestral state. However, a Gly115Arg substitution occurred after the divergence of the C. trachomatis L2 and A-D serovars. In the structure of the homologous arginine decarboxylase from Methanocaldococcus jannaschii [27], the corresponding Ile107 residue is found near the N-terminal end of β-strand 6 in the α-subunit. This strand forms the edge of one sheet in the αββα sandwich fold, and provides the Glu109 carboxylate group that facilitates cleavage in this protein family [28]. The Gly115Arg replacement in C. trachomatis AaxB could alter the conformation of this β-strand, inhibiting cleavage. To test the significance of this substitution, site-directed mutagenesis was used to construct an Arg115Gly variant of the D/UW-3 protein. The affinity-purified protein was 61% cleaved, and it catalyzed L-arginine decarboxylation with a rate of 1.3 s-1 (Figure 4).

Arginine uptake activity of AaxC transporters

E. coli adiAYC mutants that express the C. pneumoniae aaxC gene can exchange L-[3H]-arginine for cytoplasmic arginine [17]. To test the function of C. trachomatis AaxC proteins, arginine uptake assays were performed using E. coli cells expressing the aaxBC genes from L2/434 and D/UW-3 strains (Figure 5). No significant arginine uptake was detected in cells expressing L2/434 wild-type or X128W aaxBC genes. However, cells expressing D/UW-3 strain aaxBC genes showed significantly enhanced uptake. Although the L2/434 and D/UW-3 AaxC proteins are 99% identical, the 7 amino acid substitutions appear to have reduced the L2/434 protein's transport activity. These substitutions are scattered across the protein sequence, and none occurs at a conserved site in an alignment of homologs.
Figure 5

Arginine uptake activity in . L-[2,3,4,5-3H]Arginine was added to suspensions of E. coli DEG0147 cells during 20 min incubations at 37°C. The relative radioactivity retained on filters is shown for the mean of three samples, with the corresponding standard deviations. The indicated genes were expressed from vectors pBAD/HisA (negative control), pDG479 (L2/434 aaxBC), pDG543 (L2/434 aaxB X128W-aaxC), pDG379 (C. pneumoniae aaxBC), and pDG558 (D/UW-3 aaxBC). Similar levels of radioactivity were measured in samples containing E. coli with pBAD/HisA and control reactions with no cells. One-way ANOVA was used to identify significant differences among the samples, with Dunnett's multiple comparison post-test. A significant difference in samples expressing C. pneumoniae aaxBC (relative to pBAD/HisA) is indicated by *, p ≤ 0.05; an extremely significant difference in samples expressing C. trachomatis D/UW-3 aaxBC is indicated by ***, p < 0.001.

Arginine uptake activity in . L-[2,3,4,5-3H]Arginine was added to suspensions of E. coli DEG0147 cells during 20 min incubations at 37°C. The relative radioactivity retained on filters is shown for the mean of three samples, with the corresponding standard deviations. The indicated genes were expressed from vectors pBAD/HisA (negative control), pDG479 (L2/434 aaxBC), pDG543 (L2/434 aaxB X128W-aaxC), pDG379 (C. pneumoniae aaxBC), and pDG558 (D/UW-3 aaxBC). Similar levels of radioactivity were measured in samples containing E. coli with pBAD/HisA and control reactions with no cells. One-way ANOVA was used to identify significant differences among the samples, with Dunnett's multiple comparison post-test. A significant difference in samples expressing C. pneumoniae aaxBC (relative to pBAD/HisA) is indicated by *, p ≤ 0.05; an extremely significant difference in samples expressing C. trachomatis D/UW-3 aaxBC is indicated by ***, p < 0.001.

Evolution of aaxABC genes in the Chlamydiales

Most mutations predicted to convert protein-coding genes to pseudogenes are nonsense or frameshift mutations that prevent translation of full-length protein. However, the frequency of missense mutations may be much higher -these proteins can still be expressed, and they may fold correctly, yet they can be functionally impaired [29]. Several strategies have been developed to identify detrimental missense mutations, using either protein structure models or comparative sequence analysis to predict the effects of amino acid substitutions [15]. These models show great promise in predicting the effects of nonsynonymous single nucleotide polymorphisms in well-characterized human genes [30]. When the predicted ancestral C. trachomatis AaxB sequence (Figure 1) was submitted to the Sorting Intolerant From Tolerant (SIFT) web server , the G115R replacement was "predicted to affect protein function" [31]. However, when the C. pneumoniae AaxB sequence was submitted to the SIFT web server with a list of 22 observed replacements in the C. trachomatis sequence, all of the changes were predicted to be "tolerated." The G115R replacement alone also was predicted to be tolerated in the C. pneumoniae AaxB sequence. The PMUT server predicted 8 of the 22 replacements (including G115R) to be "pathological" for the C. pneumoniae sequence [32]. Therefore these amino acid substitution prediction tools are neither sensitive nor specific enough to predict functional changes due to missense mutations in significantly diverged bacterial sequences. Since we could not recognize specific missense mutations that impair function, we considered whether aberrant phylogenies or high rates of nonsynonymous substitution correspond to loss of function. Phylogenies of the aaxABC genes have the same topologies as the 16S ribosomal RNA tree (Figure 6) [33]. The intact aaxABC genes from Chlamydia psittaci 6BC are highly similar to their C. abortus homologs, containing several conservative amino acid replacements (data not shown). These results are consistent with previous protein-sequence based phylogenies that indicated the three genes were acquired by the Chlamydiaceae ancestor through horizontal gene transfer after its divergence from the Parachlamydiaceae [17,18]. To measure the effects of purifying selection on these genes, d/dvalues were calculated for each branch. Genes subject to negative selection often have low d/dvalues due to the costs of nonsynonymous substitutions, while genes under relaxed selection can have d/dvalues approaching 1; genes under positive selection for diversification occasionally have d/dvalues greater than 1 [34]. In a canonical model for gene loss and decay in intracellular bacteria, inactivating mutations that are fixed in a population give rise to pseudogenes that evolve neutrally, with a high frequency of deletions, increased d/dvalues and biased GC to AT mutations [35,36].
Figure 6

The chlamydial . The phylogeny of chlamydial 16S ribosomal RNA genes (shown at the upper left) was inferred by the maximum likelihood method using the PhyML program to analyze aligned sequences from the ribosomal database project (RDP) [33,54]. Bootstrap values from 1000 replicates are shown in red for each lineage supported by a plurality of trees, and this tree was rooted using the Parachlamydia sp. UWE25 rRNA sequence. A tree calculated by the weighbor method has the same topology (phylogram from RDP not shown). The phylogenies of the aaxA, aaxB and aaxC genes and d/dvalues for each lineage (shown in red) were inferred using maximum likelihood methods, as described in the text. No d/dvalues are shown for lineages with fewer than 0.05 nucleotide substitutions per codon. For each tree, the scale bar indicates the number of nucleotide substitutions per position.

The chlamydial . The phylogeny of chlamydial 16S ribosomal RNA genes (shown at the upper left) was inferred by the maximum likelihood method using the PhyML program to analyze aligned sequences from the ribosomal database project (RDP) [33,54]. Bootstrap values from 1000 replicates are shown in red for each lineage supported by a plurality of trees, and this tree was rooted using the Parachlamydia sp. UWE25 rRNA sequence. A tree calculated by the weighbor method has the same topology (phylogram from RDP not shown). The phylogenies of the aaxA, aaxB and aaxC genes and d/dvalues for each lineage (shown in red) were inferred using maximum likelihood methods, as described in the text. No d/dvalues are shown for lineages with fewer than 0.05 nucleotide substitutions per codon. For each tree, the scale bar indicates the number of nucleotide substitutions per position. For branches in the aaxA gene tree, dvalues ranged from < 0.005 (among the C. trachomatis strains) to 66 (saturation, separating the Chlamydophila and Chlamydia lineages). d/dvalues range from 0.002 to more than 1, with the majority of lineages showing purifying selection (Figure 6). The highly diverged amino-terminal secretory signal sequence in C. trachomatis homologs accounted for most of the nonsynonymous substitutions. Otherwise, the d/dvalues for aaxA homologs are consistent with those of the major outer membrane protein (MOMP) porin. The d/dvalue was 0.114 for the C. trachomatis D/UW-3 and C. pneumoniae MOMP pair, and 0.144 for the C. trachomatis D/UW-3 and L2/434 MOMP sequences. From these data we infer that aaxA orthologs have been subjected to moderate purifying selection, punctuated by a dramatic change in the secretory signal region of the ancestral C. trachomatis and C. muridarum gene. Signal sequences can vary significantly among homologous proteins [37], so further experiments will be required to test whether these changes in the signal sequence alter protein localization or expression levels. A future site-based comparison of codon substitution rates could identify specific positions subject to relaxed selection, but will require many more aaxA sequences. Despite the inactivating nonsense and missense mutations in C. trachomatis aaxB genes, the dvalues for aaxB genes ranged from < 0.00005 in the C. trachomatis lineage to 14 separating the Chlamydia and Chlamydophila strains. There are correspondingly few nonsynonymous substitutions, so d/dvalues are uniformly low (Figure 6). The frequency of GC versus AT nucleotides was not substantially different at any codon position in the inactivated genes. As observed for several Rickettsial pseudogenes, gene inactivation does not always correspond to higher d/dvalues [38]. The aaxC gene also shows no sign of relaxed selection, even in the C. trachomatis lineages with saturating synonymous substitution rates. Although homologs in C. trachomatis B/Jali and A/HAR-13 strains have 2 or 3 deletions, respectively, there are no other nucleotide substitutions compared to the D/UW-3 strain. Neutral evolution may be difficult to detect following such recent gene inactivation.

Parallel loss of AAX activity in C. trachomatis strains correlates with modes of infection

While the AAX system from C. pneumoniae functions in E. coli, we have demonstrated that several homologous C. trachomatis genes have experienced inactivating mutations. The pathogenic Chlamydiales form two distinct phylogenetic groups: the Chlamydophila and Chlamydia genera [39]. The latter includes C. trachomatis and Chlamydia muridarum, a strain that causes mouse pneumonitis. An alignment of AaxB sequences shows that the C. muridarum homolog contains none of the deleterious mutations found in C. trachomatis genes, so it should form an active arginine decarboxylase (Figure 1). Furthermore, a peptide from the AaxC transporter of this strain was identified bound to MHC class I molecules from infected murine dendritic cells [40]. These data indicate the chlamydial ancestor had a functional AAX system, but independent mutations in the C. trachomatis homologs are progressively inactivating these genes. Recent demonstrations of gene transfer and recombination among chlamydiae temper the correlation between serotype and AAX functionality [13]. Future sequences from clinical isolates and additional chlamydial species will help define the distribution and evolution of the AAX system. In early stage acute respiratory infections, C. pneumoniae EBs infect granulocytes and alveolar macrophages, which both use arginine to produce nitric oxide [41-43]. Therefore the AAX system may be selected for its ability to reduce L-arginine levels and nitric oxide synthase activity during infection. C. pneumoniae, unlike C. trachomatis, can infect and replicate in neutrophil granulocytes [44]. C. trachomatis strains rarely cause pneumonia, except in infants, who have immature alveolar macrophages [45]. Instead, C. trachomatis strains primarily infect mucosal epithelial cells, which do not express the inducible nitric oxide synthase; however, disseminating C. trachomatis L2 cells can persist in unactivated macrophages [46]. Consistent with this model, mice deficient in inducible nitric oxide synthase resolved genital C. trachomatis infections as well as normal mice [47]. A similar relationship between chlamydial strain-specific metabolism and tissue tropism has been described for tryptophan biosynthesis. When IFN-γ is produced by the host during infection, it causes the expression of indoleamine 2,3-dioxygenase (IDO), which degrades L-tryptophan. Genital tract isolates of C. trachomatis serovars B, D-K and L2 produce tryptophan synthase to make tryptophan from exogenous indole. In contrast, ocular C. trachomatis serovars A, Ba and C contain a deletion mutation in the trpA gene [48,49]. Despite the inactivating deletion in trpA, both the trpAB genes are transcribed and translated in a serovar A strain [48]. It has been proposed that ocular C. trachomatis strains do not encounter indole or IFN-γ induced IDO during infection [50].

Conclusion

The loss of arginine decarboxylase activity in the AaxB protein from L2/434 was predicted due to a nonsense mutation, but the inactivation of D/UW-3 AaxB was not obvious from the protein sequence. Nor could we predict that the L2/434 AaxC would be inactive, while the D/UW-3 AaxC would be active (the two protein sequences are 99% identical). Both aaxBC orthologs are transcribed. Therefore the AAX system has been inactivated via independent mechanisms in at least two lineages of C. trachomatis. Proteomic evidence suggests that the AaxA outer membrane protein is produced by L2/434 cells during infection, but this porin could have additional functions that are independent of AAX system. These results suggest a cautious interpretation of gene expression data for species undergoing reductive evolution. Neither sequence comparison nor transcriptional analysis is sufficient to detect all pseudogenes in these bacteria. Furthermore, recently inactivated genes may not show the hallmarks of relaxed selection, leading to over prediction of bacterial metabolic capabilities. Folded into the protein sequence databases, these inactive sequences may corrupt future genome annotations and protein-structure function analyses that rely on comparative sequence analysis.

Methods

Strains and DNA

L2 mouse fibroblast cells were grown to confluency in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS (complete DMEM) at 37°C in 5% CO2. These cells were infected at a multiplicity of infection (MOI) of 1 with EBs from C. trachomatis D/UW-3 or L2/434 (Table 1) [51]. After 46 h incubation, infected cells were pooled and sonicated to isolate EBs, and chromosomal DNA was extracted using the DNeasy Tissue Kit (Qiagen, Valencia, CA). Chlamydia pneumoniae genes were previously cloned from strain Kajaani 6 [52]. Escherichia coli DH5α (Invitrogen, Carlsbad, CA) or E. coli XL1-Blue (Stratagene, La Jolla, CA) strains were used as general cloning hosts. E. coli BL21(DE3) was used to express genes from T7 promoters. E. coli DEG0147 was used to express genes from PBAD promoters.
Table 1

List of microorganisms and plasmids

Strain or plasmidDescription and partial genotypeReference or source
Chlamydia pneumoniaeKajaani 6[52]
C. trachomatis L2/434Lymphogranuloma venerum II serovar L2, strain 434H. Caldwell
C. trachomatis D/UW-3Trachoma serovar D, strain UW-3/CxP. Wyrick
Escherichia coli
 BL21(DE3)Expression strain with T7 RNA polymerase geneNovagen
 DEG0147MG1655 ΔadiAYC::kan[17]
 DH5αGeneral cloning hostInvitrogen
 XL1-BlueGeneral cloning hostStratagene
Plasmids
 pBAD/HisAExpression vector with PBAD promoterInvitrogen
 pDFclone1L2/434 CTL0627–0628 in pGEM-TThis work
 pDG379Cpn aaxBC in pBAD/HisA[17]
 pDG479L2/434 CTL0627–0628 in pBAD/HisAThis work
 pDG491L2/434 His10-CTL0627 in pET-19bThis work
 pDG543pDG479 with X128W substitutionThis work
 pDG558D/UW-3 His6-CT373–374 in pBAD/HisAThis work
 pTG17D/UW-3 His10-CT373 in pET-19bThis work
 pTG20D/UW-3 His10-CT373 Arg115Gly in pET-19bThis work
List of microorganisms and plasmids

Cloning

C. trachomatis L2/434 genomic DNA and primers CTL06263'F and CTL06295'R (Table 2) were used to amplify a 2.5 kbp DNA fragment containing the CTL0627 (aaxB) and CTL0628 (aaxC) loci plus minimal 5' and 3' flanking sequences. The purified PCR product was ligated into plasmid pGEM-T (Promega) to produce vector pDFclone1. DNA sequencing performed at the Uniformed Services University Biomedical Instrumentation Center confirmed that the cloned DNA sequence was identical to the published sequence (GenBank accession NC_010287), except for a silent T390C mutation in the CTL0627 locus.
Table 2

Primers used for cloning and sequencing

Primer nameSequence1
CTL06263'FGCTCCAGACTTCCAACTC
CTL06295'RTGTAAAGCCATGAAGAAGG
5CT373XCGGCTCGAGATGCCTTACGGAACTCG
3CT374HGCAAGCTTACAAATGGATTTTATTAGC
5CT373NGGTCATATGCCTTACGGAACTCG
3CT373BGCTGGATCCTTATTGGATAACAGCAGGC
5CT373X128WCAGAATACGTAGAGTTTTTCCCAACTTGGATCGATGATGAAATCGCAGAAT
3CT373X128WATTCTGCGATTTCATCATCGATCCAAGTTGGGAAAAACTCTACGTATTCTG
5CT372XGGGCTCGAGATGTCCTTCCGTTCGGTTTTAC
3CT374RCGCGAATTCTTACAAATGGATTTTATTAGC
5CT373R115GGGAGAGCTCATCGGGGGCTGGGCAG
3CT373R115GCTGCCCAGCCCCCGATGAGCTCTCC
pBAD-Fwd2CGTCACACTTTGCTATGC
pBAD-RevGATTTAATCTGTATCAGGCTG
CTseq1GATCAGCTACATGATCGGAG
CTseq2TCAGTACTCACTCTATGCAATAG
CTseq3CCGTGTTTATAGCGTGCGAGC
CTseq4GTGATCAGCTCCATGATCG
T7-PromoterGTAATACGACTCACTATAGGG
T7-TermGCTAGTTATTGCTCAGCGG

1 Restriction sites are underlined and the initiator codon is shown in italics.

Primers used for cloning and sequencing 1 Restriction sites are underlined and the initiator codon is shown in italics. The CTL0627 and CTL0628 genes were amplified from pDFclone1 by PCR using primers 5CT373X and 3CT374H. The purified product was digested and ligated into the XbaI and HindIII restriction sites of vector pBAD/HisA to produce vector pDG479. Sequencing reactions using the primers pBAD-Fwd2, CTseq1 and pBAD-Rev confirmed that the cloned sequence was identical to that found in pDFclone1. The CTL0627 gene was amplified from pDFclone1 by PCR using primers 5CT373N and 3CT373B. The product was ligated into the NdeI and BamHI sites of vector pET-19b to produce vector pDG491. A QuikChange site-directed mutagenesis kit (Stratagene) was used with primers 5CT373X128W and 3CT373X128W to replace the ochre codon 128 of CTL0627 in pDG479 with a tryptophan codon, resulting in vector pDG543. The CT373 (aaxB) gene from C. trachomatis D/UW-3 was amplified from genomic DNA using the 5CT373N and 3CT373B primers. The resulting product was cloned into pET-19b to produce vector pTG17, as described for CTL0627. The CT373 and CT374 (aaxC) genes were amplified using primers 5CT373X and 3CT374H and ligated into pBAD/HisA, as described above, to produce vector pDG558. DNA sequencing at the Institute for Cellular and Molecular Biology DNA Core Facility showed that the DNA cloned in these vectors was identical to the published sequence (GenBank accession NC_000117). Site directed mutagenesis was used with primers 5CT373R115G and 3CT373R115G and vector pTG17 to construct an Arg115Gly substitution in CT373, resulting in vector pTG20.

Analysis of gene expression

C. trachomatis L2/434 EBs diluted in DMEM were used to infect confluent L2 mouse fibroblast cells at an MOI of 5 (for 8 h samples) or an MOI of 1 (for 24 and 46 h samples) for 2 h with rocking at 37°C in 5% CO2. Mock infections were performed with DMEM. Following infection, cells were incubated with complete DMEM supplemented with 20 μg/ml gentamicin sulfate and 1 μg/ml cycloheximide. Total RNA was harvested at 8, 24, and 46 h using TRIzol (Invitrogen) as directed by the manufacturer. RNA harvests were repeated in triplicate for each time period starting with independent infections. RNA was treated with amplification grade DNase I (Invitrogen) to remove contaminating DNA prior to cDNA synthesis. cDNA was synthesized from the DNase-treated RNA using the ThermoScript RT-PCR System for First-Strand cDNA synthesis kit from Invitrogen using the random primer protocol. PCR was performed using PCR MASTER MIX (2×) (Fermentas, Glen Burnie, MD), 1 μl of cDNA or RNA or 50 ng of control genomic DNA as template, and 0.5 μM each of forward and reverse primers (Tables 3 and 4). Thermocycler conditions were 94°C for 2 min, 25 cycles of 94°C for 45 s, 53°C for 45 s, and 72°C for 50 s, and a final extension of 5 min at 72°C. PCR products were analyzed on 1.5% agarose gels and visualized using ethidium bromide stain.
Table 3

Primers used for operon RT-PCR

ReactionGenesPrimer namesForward primer sequenceReverse primer sequenceSize (bp)
ACTL0625 to 626CTL06253'F/CTL06265'RGCTCATTAGCAACGAAGCCGCGCTTGCTTGAGATTTC430
BCTL0626 to 627CTL06263'F/CTL06275'RGCTCCAGACTTCCAACTCGACTTCTAATACAGCACCATGTTTG404
CCTL0627 to 628CTL06273'F/CTL06285'RGCATAGTGAGTTCCAATATTTCGGTGGGAAGAAATAGTTAAGG501
DCTL0628 to 629CTL06283'F/CTL06295'RCGATCATGGCTCTTGTGTAAAGCCATGAAGAAGG395
Table 4

Primers used for single gene RT-PCR

ReactionGenesPrimer namesForward primer sequenceReverse primer sequenceSize (bp)
hsp60 (groEL_1)hsp3/hsp4GACCGCCAGTTAAGATAGCGTCTCTAGCTACTTCGCAACAAATCC297
1CTL0626CTL06265'F/CTL06265'RGCACACCATCACTATCACGCGCTTGCTTGAGATTTC226
2CTL0627CTL06275'F/CTL06275'RGTTGGCGAGTCCGATGATGGACTTCTAATACAGCACCATGTTTG195
3CTL0628CTL06285'F/CTL06285'RGAAACGGTCTCCTACTAGCGGTGGGAAGAAATAGTTAAGG357
Primers used for operon RT-PCR Primers used for single gene RT-PCR

Heterologous expression and protein purification

E. coli BL21(DE3) cells containing the indicated plasmids were grown in LB medium supplemented with 100 μg/ml ampicillin and induced with 1% α-D-lactose to express the following decahistidine-tagged proteins: His10-CTL0627 (pDG491), His10-CT373 (pTG17), and His10-CT373-R115G (pTG20). E. coli DEG0147 cells containing plasmids derived from pBAD/HisA and induced with 0.2% L-arabinose were used to express the following hexahistidine and T7 epitope-tagged proteins: His6-CTL0267–0268 (pDG479), His6-CTL0627-X128W (pDG543), and His6-CT373–374 (pDG558). The polyhistidine-tagged proteins were purified using Ni2+-affinity chromatography and analyzed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described previously [18].

Arginine uptake and decarboxylation assays

The transport of radiolabeled arginine was measured in whole cells collected by filtration, using a method that we reported previously [17]. These assays contained 1 × 109 E. coli cells washed and suspended in E medium (pH 5) at 37°C for 20 min with 1 mM L-arginine and 2 μCi L-[2,3,4,5-3H]arginine. Arginine decarboxylase activity measurements using cell-free extracts or purified proteins were performed as described previously using 40 to 80 nCi L-[1-14C]arginine [18]. 14CO2 was trapped and then measured by liquid scintillation counting.

Immunoblotting

Proteins were separated on a SDS-PAGE Tris-glycine gel, followed by electrotransfer to a PVDF membrane (Pall, Ann Arbor, MI). These blots were blocked with bovine serum albumin and then incubated for 1 h with a 1:5000 dilution of T7-Tag monoclonal antibody conjugated to horseradish peroxidase (Novagen, Madison, WI). An Image Station 4000 instrument (Carestream Health, New Haven, CT) was used to detect chemiluminescence produced during incubation with SuperSignal West Pico Substrate (Thermo Pierce, Rockford, IL).

Phylogenetic analysis and estimation of nucleotide substitution rates

Orthologous nucleotide sequences for the aaxA, aaxB and aaxC genes were retrieved from the GenBank database (Table 5) and aligned using the ClustalW2 program (ver. 2.0.10) [53]. The phylogeny of the aaxA, aaxB and aaxC genes was inferred using the PhyML program (ver. 3.0.1) [54], with the HKY85 nucleotide substitution model, a discrete gamma model with 4 categories of sites and estimated transition/transversion ratios of 3.9 (aaxA), 4.8 (aaxC) and 6.1 (aaxB). Trees were viewed and edited using the FigTree program (ver. 1.2.2, A. Rambaut, University of Edinburgh) and Illustrator CS3 (Adobe). The numbers of synonymous substitutions per synonymous site (d) and nonsynonymous substitutions per nonsynonymous site (d) were estimated using the codeml program from the PAML software suite (ver. 4.2) [55], based on the ClustalW2 alignment and PhyML phylogeny with a free ratio branch model (ω = d/dvaries for each branch). A user tree was supplied to the codeml program, with codon frequencies calculated from the average nucleotide frequencies at the three codon positions, and with one category in the ω distribution. Both ω and κ parameters were estimated from the data. The codonml module was also used with the same parameters to infer the ancestral C. trachomatis AaxB sequence shown in Figure 1[55]. This ancestral sequence was consistent with a sequence inferred using the Dnapars program from the Phylip package (ver. 3.66; J. Felsenstein, U. Washington). However, the Dnapars program reported more ambiguous codons than the codeonml program. For the analysis of aaxA genes, translated amino acid sequences were aligned using ClustalW2, and then a nucleotide sequence alignment was constructed using the PAL2NAL program (ver. 12) [56]. Pairwise sequence d/dratios were calculated using the KaKs_Calculator program (ver. 1.2) [57].
Table 5

Sequences used for phylogenetic analysis and substitution rate calculations

StrainChromosomal locus and GenBank RefSeq accession number
aaxAaaxBaaxC
Chlamydia abortus S26/31CAB696[YP_220094.1]CAB697[YP_220095.1]CAB698[YP_220096.1]
Chlamydia caviae GPIC1CCA00729[NP_829592.1]CCA00730[NP_829593.1]CCA00731[NP_829594.1]
Chlamydia felisFe/C-561CF0287[YP_515204.1]CF0286[YP_515203.1]CF0285[YP_515202.1]
Chlamydia muridarum NiggTC0651[NP_297025.1]TC0652[NP_297026.1]TC0653[NP_297027.1]
Chlamydia pneumoniae CWL0291CPn1033[NP_225227.1]CPn1032[NP_225226.1]CPn1031[NP_225225.1]
Chlamydia trachomatis A/HAR-13CTA_0404[YP_328186.1]CTA_0405[YP_328187.1](CTA_0406)3
Chlamydia trachomatis B/JaliNA2NA2NA2,3
Chlamydia trachomatis D/UW-3CT372[NP_219881.1]CT373[NP_219882.1]CT374[NP_219883.1]
Chlamydia trachomatis L2/434CTL0626[YP_001654701.1](CTL0627)3CTL0628[YP_001654702.1]
Chlamydia trachomatis L2b/UCHCTLon_0624[YP_001653713.1](CTLon_0625)3CTLon_0626[YP_001653714.1]

1 These species are sometimes considered part of the Chlamydophila genus.

2 Not available. The unannotated C. trachomatis B/Jali genome sequence was retrieved from the Sanger Institute website .

3 The aaxB pseudogenes in LGV strains and the aaxC pseudogenes in C. trachomatis HAR-13 and Jali strains were not assigned GenBank accession numbers.

Sequences used for phylogenetic analysis and substitution rate calculations 1 These species are sometimes considered part of the Chlamydophila genus. 2 Not available. The unannotated C. trachomatis B/Jali genome sequence was retrieved from the Sanger Institute website . 3 The aaxB pseudogenes in LGV strains and the aaxC pseudogenes in C. trachomatis HAR-13 and Jali strains were not assigned GenBank accession numbers.

Authors' contributions

TNG carried out the protein expression, purification and immunoblotting studies, performed some cloning and mutagenesis experiments, and performed arginine uptake and decarboxylation assays. DJF cultured Chlamydia, carried out gene expression experiments and initial gene cloning, and helped to draft the manuscript. DEG conceived of and coordinated the study, performed some cloning and mutagenesis experiments, phylogenetic and statistical analysis, and drafted the manuscript. All authors read and approved the final manuscript.
  55 in total

1.  Predicting the functional consequences of non-synonymous single nucleotide polymorphisms: structure-based assessment of amino acid variation.

Authors:  D Chasman; R M Adams
Journal:  J Mol Biol       Date:  2001-03-23       Impact factor: 5.469

2.  Why are proteins so robust to site mutations?

Authors:  Darin M Taverna; Richard A Goldstein
Journal:  J Mol Biol       Date:  2002-01-18       Impact factor: 5.469

3.  Predicting deleterious amino acid substitutions.

Authors:  P C Ng; S Henikoff
Journal:  Genome Res       Date:  2001-05       Impact factor: 9.043

4.  Pyruvoyl-dependent arginine decarboxylase from Methanococcus jannaschii: crystal structures of the self-cleaved and S53A proenzyme forms.

Authors:  W David Tolbert; David E Graham; Robert H White; Steven E Ealick
Journal:  Structure       Date:  2003-03       Impact factor: 5.006

5.  Mechanisms of evolution in Rickettsia conorii and R. prowazekii.

Authors:  H Ogata; S Audic; P Renesto-Audiffren; P E Fournier; V Barbe; D Samson; V Roux; P Cossart; J Weissenbach; J M Claverie; D Raoult
Journal:  Science       Date:  2001-09-14       Impact factor: 47.728

6.  Pseudogenes, junk DNA, and the dynamics of Rickettsia genomes.

Authors:  J O Andersson; S G Andersson
Journal:  Mol Biol Evol       Date:  2001-05       Impact factor: 16.240

7.  Molecular basis defining human Chlamydia trachomatis tissue tropism. A possible role for tryptophan synthase.

Authors:  Christine Fehlner-Gardiner; Christine Roshick; John H Carlson; Scott Hughes; Robert J Belland; Harlan D Caldwell; Grant McClarty
Journal:  J Biol Chem       Date:  2002-05-13       Impact factor: 5.157

8.  Global stage-specific gene regulation during the developmental cycle of Chlamydia trachomatis.

Authors:  Tracy L Nicholson; Lynn Olinger; Kimberley Chong; Gary Schoolnik; Richard S Stephens
Journal:  J Bacteriol       Date:  2003-05       Impact factor: 3.490

9.  Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates.

Authors:  Harlan D Caldwell; Heidi Wood; Debbie Crane; Robin Bailey; Robert B Jones; David Mabey; Ian Maclean; Zeena Mohammed; Rosanna Peeling; Christine Roshick; Julius Schachter; Anthony W Solomon; Walter E Stamm; Robert J Suchland; Lacey Taylor; Sheila K West; Tom C Quinn; Robert J Belland; Grant McClarty
Journal:  J Clin Invest       Date:  2003-06       Impact factor: 14.808

10.  Genomic transcriptional profiling of the developmental cycle of Chlamydia trachomatis.

Authors:  Robert J Belland; Guangming Zhong; Deborah D Crane; Daniel Hogan; Daniel Sturdevant; Jyotika Sharma; Wandy L Beatty; Harlan D Caldwell
Journal:  Proc Natl Acad Sci U S A       Date:  2003-06-18       Impact factor: 12.779

View more
  11 in total

Review 1.  Evolution to a chronic disease niche correlates with increased sensitivity to tryptophan availability for the obligate intracellular bacterium Chlamydia pneumoniae.

Authors:  Wilhelmina M Huston; Christopher J Barker; Anu Chacko; Peter Timms
Journal:  J Bacteriol       Date:  2014-03-28       Impact factor: 3.490

Review 2.  Genetic variation in Chlamydia trachomatis and their hosts: impact on disease severity and tissue tropism.

Authors:  Hossam Abdelsamed; Jan Peters; Gerald I Byrne
Journal:  Future Microbiol       Date:  2013-09       Impact factor: 3.165

3.  The Plasmid-Encoded pGP3 Promotes Chlamydia Evasion of Acidic Barriers in Both Stomach and Vagina.

Authors:  Tianyuan Zhang; Zhi Huo; Jingyue Ma; Cheng He; Guangming Zhong
Journal:  Infect Immun       Date:  2019-04-23       Impact factor: 3.441

4.  Genome sequencing of recent clinical Chlamydia trachomatis strains identifies loci associated with tissue tropism and regions of apparent recombination.

Authors:  Brendan M Jeffrey; Robert J Suchland; Kelsey L Quinn; John R Davidson; Walter E Stamm; Daniel D Rockey
Journal:  Infect Immun       Date:  2010-03-22       Impact factor: 3.441

5.  Adaptive evolution of the Chlamydia trachomatis dominant antigen reveals distinct evolutionary scenarios for B- and T-cell epitopes: worldwide survey.

Authors:  Alexandra Nunes; Paulo J Nogueira; Maria J Borrego; João P Gomes
Journal:  PLoS One       Date:  2010-10-05       Impact factor: 3.240

6.  Chlamydia trachomatis transports NAD via the Npt1 ATP/ADP translocase.

Authors:  Derek J Fisher; Reinaldo E Fernández; Anthony T Maurelli
Journal:  J Bacteriol       Date:  2013-05-24       Impact factor: 3.490

7.  Characterization of the activity and expression of arginine decarboxylase in human and animal Chlamydia pathogens.

Authors:  Kimberly A Bliven; Derek J Fisher; Anthony T Maurelli
Journal:  FEMS Microbiol Lett       Date:  2012-10-29       Impact factor: 2.742

Review 8.  Chlamydia overcomes multiple gastrointestinal barriers to achieve long-lasting colonization.

Authors:  Guangming Zhong
Journal:  Trends Microbiol       Date:  2021-04-14       Impact factor: 17.079

9.  Uptake of biotin by Chlamydia Spp. through the use of a bacterial transporter (BioY) and a host-cell transporter (SMVT).

Authors:  Derek J Fisher; Reinaldo E Fernández; Nancy E Adams; Anthony T Maurelli
Journal:  PLoS One       Date:  2012-09-27       Impact factor: 3.240

10.  Lactobacilli inactivate Chlamydia trachomatis through lactic acid but not H2O2.

Authors:  Zheng Gong; Yesmin Luna; Ping Yu; Huizhou Fan
Journal:  PLoS One       Date:  2014-09-12       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.