Cloning and functional characterization of carotenoid cleavage dioxygenase 4 genes.

Although a number of plant carotenoid cleavage dioxygenase (CCD) genes have been functionally characterized in different plant species, little is known about the biochemical role and enzymatic activities of members of the subclass 4 (CCD4). To gain insight into their biological function, CCD4 genes were isolated from apple (Malus x domestica, MdCCD4), chrysanthemum (Chrysanthemum x morifolium, CmCCD4a), rose (Rosa x damascena, RdCCD4), and osmanthus (Osmanthus fragrans, OfCCD4), and were expressed, together with AtCCD4, in Escherichia coli. In vivo assays showed that CmCCD4a and MdCCD4 cleaved beta-carotene well to yield beta-ionone, while OfCCD4, RdCCD4, and AtCCD4 were almost inactive towards this substrate. No cleavage products were found for any of the five CCD4 genes when they were co-expressed in E. coli strains that accumulated cis-zeta-carotene and lycopene. In vitro assays, however, demonstrated the breakdown of 8'-apo-beta-caroten-8'-al by AtCCD4 and RdCCD4 to beta-ionone, while this apocarotenal was almost not degraded by OfCCD4, CmCCD4a, and MdCCD4. Sequence analysis of genomic clones of CCD4 genes revealed that RdCCD4, like AtCCD4, contains no intron, while MdCCD, OfCCD4, and CmCCD4a contain introns. These results indicate that plants produce at least two different forms of CCD4 proteins. Although CCD4 enzymes cleave their substrates at the same position (9,10 and 9',10'), they might have different biochemical functions as they accept different (apo)-carotenoid substrates, show various expression patterns, and are genomically differently organized.

Introduction

Carotenoid cleavage dioxygenases (CCDs) are non-haem iron oxygenases that cleave carotenes and xanthophylls to apocarotenoids. These substances are widely distributed in nature and have important metabolic and hormonal functions in prokaryotes, animals, fungi, green algae, and higher plants. In animals, the most important apocarotenoid is the C20 compound retinal and its derivatives because retinal plays a crucial role as the chromophore of rhodopsin in the vertebrate visual cycle (Spudich ). In plants and cyanobacteria, apocarotenoids are found in large amounts in the thylakoid membrane, where they act as accessory and photoprotective pigments (Markwell ). In reddish and yellowish coloured plant tissues, apocarotenoids are found in large amounts in specialized plastids called chromoplasts, while volatile low molecular weight apocarotenoids such as the C13-norisoprenoids are aroma compounds in the flowers, fruits, and leaves of many plants (Winterhalter and Rouseff, 2002). The latter possess interesting flavour properties together with low aroma thresholds. It has been known that certain apocarotenoids act as hormones in the regulation of plant growth. The best characterized example is abscisic acid (ABA), which plays an important role in the regulation of drought tolerance, seed development, and sugar sensing. It is derived from the C15 apocarotenoid xanthoxin which is produced by VP14 the first functionally characterized CCD enzyme (Sindhu and Walton, 1987; Schwartz ). Recent analysis of Arabidopsis thaliana mutants led to the discovery of two novel carotenoid cleavage oxygenases, CCD7 and CCD8, which act in concert to produce an apocarotenoid that promotes shoot branching (Booker ; Auldridge ).

The CCD family is ancient, with family members present in bacteria, plants, and animals (Bouvier ; Kloer and Schulz, 2006; Auldridge ). The CCD family in A. thaliana has nine members (CCD1, 4, 7, 8 and NCED2, 3, 5, 6, and 9), and orthologues in other plant species are typically named according to their homology with an Arabidopsis CCD. CCD1s are shown to catabolize a wide range of all-trans- and 9-cis-carotenoids as well as epoxycarotenoids (Schwartz ; Simkin ; Ibdah ; Huang ). CCD1 enzymes symmetrically cleave the 9,10 (9′,10′) double bonds of multiple carotenoid substrates to produce a C14 dialdehyde and two C13 products. Recently, an additional cleavage activity for CCD1 at the 5,6 (5′,6′) double bonds of lycopene has been reported (Vogel ; Huang ). CCD7 from Arabidopsis catalyses the asymmetric cleavage of β-carotene at the 9′,10′ position, producing 10′-apo-β-caroten-10′-al and β-ionone. Interestingly, the Arabidopsis enzyme CCD8 cleaves 10′-apo-β-caroten-10′-al, the cleavage product of CCD7, at the 13,14 position to produce 13-apo-β-caroten-13-one and a C9 dialdehyde (Schwartz ; Auldridge ). All NCEDs cleave only 9-cis isomers of epoxycarotenoids at the 11,12 position to yield the ABA precursor xanthoxin (Schwartz ; Tan ; Taylor ). CsZCD from Crocus sativus oxidizes at the 7,8 (7′,8′) double bonds of zeaxanthin (Bouvier ), yielding one C20 and two C10 cleavage products that are used for the biosynthesis of safranal and crocetin glycosides, respectively. BoLCD from Bixa orellana was reported to cleave symmetrically at the 5,6 (5′,6′) double bonds of lycopene (Bouvier ), which is the first committed step in the biosynthesis of bixin.

Compared with other CCDs, CCD4 is rarely characterized. The biological role of CCD4 in plants is still unclear. RNA interference (RNAi) studies revealed that CmCCD4a contributed to the white colour formation in chrysanthemum petals by cleaving carotenoids into colourless compounds (Ohmiya ). However, no direct enzyme test was done for CmCCD4a. AtCCD4 has been reported to be located in plastoglobules where it could play a role in the dark-induced breakdown of carotenoids (Ytterberg ). Interestingly, the zinc-finger protein VAR3 which was also located in chloroplast was shown to interact specifically in yeast and in vitro with AtCCD4 (Næsted ). Recently, it has been reported for the first time that CsCCD4 could cleave β-carotene at the 9,10 (9′,10′) positions to yield β-ionone (Rubio ). To analyse the role of CCD4 genes further, MdCCD4, CmCCD4a, RdCCD4, and OfCCD4 were isolated from apple, chrysanthemum, rose, and osmanthus, respectively. The four genes and AtCCD4 were expressed in Escherichia coli, and recombinant proteins were assayed for their cleavage activities in vivo and in vitro.

Materials and methods

Plant material

The flowers of rose (Rosa×damascena), osmanthus (Osmanthus fragans), apple (Malus×domestica), and chrysanthemum (Chrysanthemum×morifolium) were chosen for the isolation of CCD4 genes as these plant tissues represent rich sources for apocarotenoids or are known to express CCD4 genes. The flowers of Rosa×damascena and O. fragans are utilized for the production of essential oils, in which volatile C13-norisoprenoids (β-damascenone, α-ionone, and β-ionone) formed by degradation of carotenoids significantly contribute to the odour (Demole ; Ohloff and Demole, 1987; Deng ; Jin ; Wang ). The first CCD4-like gene (MFS2) was isolated from apple flowers (Watillon ). RNAi studies revealed that CmCCD4a contributed to the white colour formation in chrysanthemum petals (Ohmiya ).

Isolation of CCD4 cDNAs

Total RNA was isolated from flowers of Rosa×damascena, Chrysanthemum×morifolium, Malus×domestica, and O. fragans by cetyltrimethylammonium bromide (CTAB) extraction (Liao ). The first-strand cDNAs were synthesized from 1 μg of total RNA using Superscript III revese transcriptase (Invitrogen, Karlsruhe, Germany) and a GeneRacer oligo(dT) primer [5′-GCT GTC AAC GAT ACG CTA CGT AAC GGC ATG ACA GTG T(18)-3′]. The cDNA fragments of RdCCD4 and OfCCD4 were amplified by PCR with the cDNA templates of flowers of rose and osmanthus, respectively. The primers used for PCR were 5′-GCN CAY CCN AAR GTN GAY CC-3′ (forward) and 3′-CAY GAY TTY GCN ATH ACN GA-5′ (reverse) designed by common sequences that have been reported (Schwartz , 2001, 2004; Watillon ; Bouvier ; Ohmiya et al., 2004; Ibdah ; Mathieu ; Agustí ). The amplified cDNAs were cloned into pGEM-T vector (Promega, Mannheim, Germany) and sequenced. The full-length clones for RdCCD4 and OfCCD4 were obtained by RACE (random amplification of cDNA ends)-PCR using GeneRacer oligo(dT) primer and gene-specific primers.

The coding regions of MdCCD4 and CmCCD4a were amplified by RT-PCR with the cDNA templates of flowers of apple and chrysanthemum, respectively. The primers used for MdCCD4 were MdFS2-S and MdFS2-AS (Table 1, design based on the MdFS2 gene, accession no. Z93765), whereas for CmCCD4a they were CmCCD4a-S and CmCCD4a-AS (Table 1, design based on CmCCD4a, accession no. AB247158). The temperature program used was 5 min at 95 °C, one cycle; 45 s at 95 °C, 45 s at 55 °C, 2 min at 72 °C, 35 cycles; final extension at 72 °C for 10 min. The PCR products amplified with Phusion enzyme polymerase (New England Biolabs, Frankfurt, Germany) were transformed into SmaI-digested pBluescript SK(–) vector. The recombinant genes were subjected to sequencing to confirm the sequence of the inserts.

Table 1.

Primer sequences used for PCR amplification of coding regions of various CCD4 genes

Primers	Sequences (5′ to 3′)	Orientation	Cloning sites
RdCCD4-S	CCGGAATTCATGGATGCCTTGTCTTCT	Sense	EcoRI/NotI
RdCCD4-AS	ATTGCGGCCGCCTACAACTTCTTCAGGTC	Antisense
MdFS2-S	CGCGGATCCATGGAAGAAAGACCCAGC	Sense	BamHI/EcoRI
MdFS2-AS	CCGGAATTCCTACAAATTGTTGAGATC	Antisense
CmCCD4a-S	CCGGAATTCATGGGCTCTTTTCCCACA	Sense	EcoRI/NotI
CmCCD4a-AS	ATTGCGGCCGCTCAAAGCGTTGTTAGGTC	Antisense
OfCCD4-S	CGCGGATCCATGGACACACTTTCTTCC	Sense	BamHI/EcoRI
OfCCD4-AS	CCGGAATTCTCATAGCTTGTTGAGGTC	Antisense
AtCCD4-S	CCGGAATTCATGGAGTCTGTTTCTTCT	Sense	EcoRI/NotI
AtCCD4-AS	ATTGCGGCCGCTTAAAGCTTATTAAGGTC	Antisense

The underlined nucleotide sequences indicate the recognition sites of the restriction enzymes for insertion into the multiple cloning sites of the plasmid.

Isolation of CCD4 genomic DNAs

Genomic DNA was isolated from leaf tissues of apple, osmanthus, and rose using a QIAGEN DNA mini kit. Genomic DNA fragments (from start codon to stop codon) of MdCCD4, RdCCD4, and OfCCD4 were amplified by PCR from apple, rose, and osmanthus, respectively. The primers used were MdFS2-S and MdFS2-AS for MdCCD4, RdCCD4-S and RdCCD4-AS for RdCCD4, as well as OfCCD4-S and OfCCD4-AS for OfCCD4 (primers are listed in Table 1). The temperature program used for PCR was described as above. The PCR products amplified with Phusion enzyme polymerase (New England Biolabs, Frankfurt, Germany) were transformed into SmaI-digested pBluescript SK(–) vector. The recombinant genes were subjected to sequencing to confirm the sequence of the inserts.

Real-time RT-PCR analysis

Total RNA was extracted from mature leaves, whole flowers (full bloom), stems, and roots of a potted rose plant (Rosa×damascena, 50 cm high) using the CTAB extraction procedure (Liao ). RNA samples were treated with RNase-free DNase I (Fermentas) for 1 h at 37 °C. First-strand cDNA synthesis was performed in duplicate in a 20 μl reaction volume, with 1 μg of total RNA as the template, random primer (random hexamer, 100 pmol), and M-MLV reverse transcriptase (200 U, Invitrogen) and according to the manufacturer's instructions. For each real-time PCR, 2 μl of cDNA were used. Real-time PCR was performed on a StepOnePlus System (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master MIX (Applied Biosystems). To monitor dsDNA synthesis data were analysed with ABI StepOne Software v2.0. A relative quantification of gene expression was performed using the Interspacer gene as a reference. Primers for the amplification of the Interspacer gene were 5′-ACC GTT GAT TCG CAC AAT TGG TCA TCG-3′ (forward) and 5′-TAC TGC GGG TCG GCA ATC GGA CG-3′ (reverse). The primers used for the target gene RdCCD4 were 5′-TCC CGT CAC CGA ACT TCC CCC AAC CGA ATG-3′ (forward) and 5′-GGA CGG CGC GGC CTT GGG AGA TTC TGA-3′ (reverse). All reactions were run three times with two sets of cDNAs. The thermal cycling conditions consisted of 50 °C for 2 min followed by an initial denaturation step at 95 °C for 10 min, 40 cycles at 95 °C for 15 s, then 60 °C for 1 min. The specificity of the PCR amplification was checked with a melting curve analysis following the final step of the PCR. For each sample, threshold cycles (Ct, cycle at which the increase of fluorescence exceeded the threshold setting) were determined. The relative expression ratio was calculated and normalized using the Interspace gene (Pfaffl, 2001).

Cloning of CCD4 genes into pGEX-4T1 vectors

The full-length open reading frames (ORFs) of RdCCD4, MdCCD4, CmCCD4a, OfCCD4, and AtCCD4 were amplified by RT-PCR from first-strand cDNAs synthesized from total RNAs of rose flower, apple flower, chrysanthemum petals, osmanthus flower, and Arabidopsis leaf, respectively. The PCR primers used for each gene are listed in Table 1. The PCR products were double digested with the restriction enzymes, the recognition sequences (underlined) of which are contained in the primers (see Table 1), and then ligated with pGEX-4T1 vectors, which were digested with the same restriction enzymes as for the inserts to yield pGEX-RdCCD4, pGEX-MdCCD4, pGEX-CmCCD4a, pGEX-OfCCD4, and pGEX-AtCCD4. The recombinant genes were subjected to sequencing to confirm the sequence of the inserts.

Determination of volatiles from bacterial headspace

The plasmids pGEX-RdCCD4, pGEX-MdCCD4, pGEX-CmCCD4a, pGEX-OfCCD4, pGEX-AtCCD4, and pGEX-4T1 empty vector (negative control) were transformed into E. coli strains engineered to accumulate cis-ζ-carotene, lycopene, β-carotene, and zeaxanthin (Misawa ; Breitenbach and Sandmann, 2005). An overnight culture (0.5 ml) was used to inoculate 20 ml of LB medium containing the appropriate antibiotics in 200 ml flasks. The flasks were incubated at 37 °C with gentle shaking (125 rpm) till an OD600 of 0.6 was reached. After adding 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), 5 ml of cell culture was transferred to a tightly closed 40 ml tube. The tubes were incubated at 16 °C for 20 h and gently shaken (125 rpm). An SPME fibre (65 μm polydimethylsiloxane-divinylbenzene, Supelco, Taufkirchen, Germany) was introduced into the vial through a septum and the headspace volatiles were allowed to be absorbed by the fibre at 45 °C for 30 min. Subsequently the SPME fibre was introduced into the gas chromatograph and analysed. The volatile compounds collected from the headspace were analysed on a Thermo Finnigan Trace DSQ mass spectrometer coupled to a 0.25 μm BPX5 20 M fused silica capillary column with a 30 m×0.25 mm inner diameter. Helium (1.1 ml min−1) was used as a carrier gas. The injector temperature was 250 °C, set for splitless injection. The temperature program was 40 °C for 1 min, 40–60 °C at a rate of 2 °C min−1, and 60–325 °C at 10 °C min−1. The ion source temperature was 250 °C. Mass range was recorded from m/z 50 to 300 and spectra were evaluated with the Xcalibur software version 1.4 supplied with the device.

Protein expression and enzyme assays in vitro

The plasmids pGEX-RdCCD4, pGEX-MdCCD4, pGEX-CmCCD4a, pGEX-OfCCD4, pGEX-AtCCD4, and pGEX-4T1 empty vector (negative control) were transformed into E. coli BL21 DE3pLysS for protein expression. A 2 ml overnight culture was used to inoculate a 100 ml culture in LB medium containing 100 μg ml−1 ampicillin and 34 μg ml−1 chloroamphenicol. Cultures were grown at 37 °C until an OD600 of 0.6 was reached. Expression of the protein was induced by the addition of 0.2 mM IPTG, and the cultures were grown at 16 °C for an additional 20 h. The crude extract was prepared and enzyme activity assay was performed as described (Schmidt ). Cells were harvested by centrifugation (5000 g, 20 min, 4 °C) and resuspended in 5  ml of 1× phosphate-buffered saline (PBS; 140 mM NaCl, 4.3 mM Na2HPO4, 2.7 mM KCl, 1.47 mM K2HPO4, pH 7.3) containing 5 mM sodium ascorbate. Cells were lysed by sonification on ice with an MS 73 sonotrode (Bandelin Electronic, Berlin, Germany) four times for 30 s at 10% of maximal power. Cell debris was removed by centrifugation (5000 g, 30 min, 4 °C). A 62 μl aliquot of ethanol containing 6.2 μg of substrate and 31 μl of an ethanolic β-octylglucoside solution [4% (w/v)] were combined and evaporated to dryness. The crude cell extract (125 μl) described above was added. The solution was shaken vigorously and incubated at 30 °C for 20 h in the dark. The assay products were partitioned into ethyl acetate and analysed by high-performance liquid chromatography (HPLC; carotenoid substrates) and gas chromatography–mass spectrometry (GC-MS; apocarotenal substrate). HPLC separations were performed as described (Huang ). For GC-MS, a Thermo Finnigan Trace DSQ mass spectrometer coupled to a Thermo Finnigan Trace gas chromatograph with a split injector (1:10) and a 0.25 μm BPX5 20 M fused silica capillary column with a 30  m×0.25 mm inner diameter was used. The oven temperature was held at 40 °C for 1 min and then increased to 240 °C at 3 °C min−1 intervals, with a helium flow rate of 1.1 ml min−1. The EI-MS ionization voltage was 70 eV (electron impact ionization), and the ion source temperature was 230 °C. Mass range was recorded from 45 to 450 m/z, and spectra were evaluated with the Xcalibur software version 1.4.

Results

Isolation of full-length cDNAs of CCD4 genes

Full-length cDNAs of CCD4 genes were isolated from rose (Rosa×damascena, RdCCD4), chrysanthemum (Chrysanthemum×morifolium, CmCCD4a), apple (Malus×domestica, MdCCD4), and osmanthus (O. fragans, OfCCD4) to characterize the enzymatic activities of the encoded proteins. Gene fragments of the novel RdCCD4 and OfCCD4 genes were first cloned using RT-PCR with degenerate oligonucleotide primers, which are complementary to the conserved AHPKVDP and MHDFAIT regions (Fig. 1A). Furthermore, full-length cDNAs of these genes were obtained by 5′- and 3′-RACE-PCR using gene-specific primers. The nucleotide sequence of RdCCD4 contains 1956 bp including a 5′-non-coding region of 14 bp, a complete ORF of 1764 bp corresponding to 588 amino acids, and a 3′-non-coding region of 178 bp. The cDNA sequence of OfCCD4 is 2077 bp long with an ORF (1827 bp) coding for a protein of 609 amino acids. It also includes a 77 bp 5′-untranslated region and a 173 bp 3′-untranslated region. MdFS2, an apple flower protein of unknown function (Watillon ), encodes a polypeptide (446 amino acids) with sequence similarities to those of CCDs. To elucidate the function of MdFS2, its ORF was amplified by PCR and sequenced. However, the DNA sequence obtained revealed that 2 bp (GC) were missing in the published ORF sequence (Watillon ). After inserting GC into the nucleotide sequence of MdFS2, a new ORF of 1689 bp encoding a 563 amino acid polypeptide was obtained. The protein showed high similarity to the products of CCD4 genes. Therefore, the clone was designated as MdCCD4. CmCCD4a is expressed specifically in white petals and is an enzyme contributing to the formation of white colour in chrysanthemum petals (Ohmiya ). To determine the substrate and product specificity of CmCCD4a, the ORF of this gene was cloned and its nucleotide sequence was determined. The cDNA sequence which was obtained from a different cultivar of chrysanthemum encoded a protein of 599 amino acids that is 94% identical to the protein sequence of previously isolated CmCCD4a (Ohmiya ). The sequences of RdCCD4, OfCCD4, MdCCD4, and CmCCD4a were submitted to GenBank with accession nos EU334433, EU334434, EU327777, and EU334432, respectively.

Fig. 1.

Sequence comparison of CCD4s of various plant species. (A) Alignment of amino acid sequence of MdCCD4, CmCCD4a, OfCCD4, RdCCD4, and AtCCD4. Identical amino acids are indicated with black backgrounds. The four iron-ligating histidines (triangles) and the glutamates or aspartates fixing them (*) are labelled. Amino acids selected for design of degenerate PCR primers are indicated by bold arrows. (B) Phylogenetic tree of the deduced amino acid sequences of CCD genes. The protein sequences were clustered using the program TreeView (http://taxonomy.zoology.gla.ac.uk/rod/treeview.html). The 0.1 scale bar means 0.1 nucleotide substitutions per site. The GenBank accession numbers for the sequences are as follows: AtCCD1 (Arabidopsis thaliana, NP_191911), AtNCED2 (Arabidopsis thaliana, NP_193569), AtNCED3 (Arabidopsis thaliana, NP_188062), AtNCED5 (Arabidopsis thaliana, NP_174302), AtNCED6 (Arabidopsis thaliana, NP_189064), AtNCED9 (Arabidopsis thaliana, NP_177960), AtCCD7 (Arabidopsis thaliana, NP_182026.1), AtCCD8 (Arabidopsis thaliana, NP_195007.2), BoLCD (B. orellana, AJ489277), CsZCD (Crocus sativus, AJ489276), CcCCD4b (Citrus clementina, ABC26012), AtCCD4 (Arabidopsis thaliana, NP_193652), PsCCD4 (Pisum sativum, BAC10552), CcCCD4a (Citrus clementina, ABC26011), MdCCD4 (Malus×domestica, ABY47995), RdCCD4 (Rosa×damascena, ABY60886), OfCCD4 (Osmanthus fragans, ABY60887), CmCCD4a (Chrysanthemum×morifolium, ABY60885), CmCCD4b (Chrysanthemum×morifolium, BAF36656), and LsCCD4 (Lactuca sativa, BAE72094).

Sequence analyses revealed that the four predicted CCD4 proteins as well as AtCCD4 contain four highly conserved histidine residues that have been previously described as typical ligands of a non-haem iron cofactor required for (di)-oxygenase activity (Schwartz ). Conserved glutamates or aspartate which are used to fix iron-ligating histidines (Kloer and Schulz, 2006) are also found in each of the five CCD4 protein sequences (Fig. 1A). In addition, each of the CCD4 proteins contains a predicted chloroplast transient peptide in its N-terminal region (prediction algorithm: http://www.cbs.dtu.dk/services/ChloroP). Sequence comparison (Fig. 1B) reveals that the four CCD4 amino acid sequences exhibit strong similarity to many other CCD4 proteins. The amino acid sequences of MdCCD4 and RdCCD4 show 66% and 71% identity to that of CcCCD4a from citrus fruit (Agustí ), respectively, while CmCCD4a shows 74% identity to CmCCD4b from chrysanthemum (Ohmiya ). The OfCCD4 protein also displays the highest homology (71% identity) with CmCCD4b protein.

Genome organization of CCD4 genes

The genomic DNAs of MdCCD4, RdCCD4, and OfCCD4 genes were amplified by PCR from the start codon to the stop codon and their sequences were analysed to identify the genome organization of CCD4 genes (Fig. 2). The sequence analysis revealed the presence of a 1285 bp intron at 593 bp from the start codon in the genomic clone encoding MdCCD4. Two introns were observed in the genomic clone encoding OfCCD4. They are 1942 bp and 491 bp long, and are inserted at 878 bp and 1470 bp from the start codon, respectively. However, like AtCCD4 (Tan ), no intron was present in the genomic clone of RdCCD4. In previous studies, a 105 bp intron was located at 1442 bp from the start codon in CmCCD4a (Ohmiya ).

Fig. 2.

Schematic diagrams of MdCCD4, RdCCD4, OfCCD4, AtCCD4, and CmCCD4a genes. Protein-coding exons are indicated by boxes, and introns are indicated by bent lines. Numbers below boxes or lines represent the length in base pairs.

Functional characterization of CCD4 enzymes

To determine whether MdCCD4, CmCCD4a, RdCCD4, OfCCD4, and AtCCD4 encode functional CCDs, these five genes were cloned into a glutathione S-transferase fusion vector for expression in E. coli. The recombinant proteins were then purified using glutathione–Sepharose and separated on a 12% SDS–polyacrylamide gel. The recombinant proteins of various CCD4s could be detected on the gel (Supplementary Fig. S1 available at JXB online). Two methods were used for assay of cleavage activities of CCD4 enzymes, namely in vivo and in vitro systems.

Some carotenoid substrates including cis-ζ-carotene, lycopene, and β-carotene are very difficult to use for in vitro assay, due to their extremely low solubility in water. For such substrates, plasmids expressing recombinant MdCCD4, CmCCD4a, RdCCD4, OfCCD4, or AtCCD4 were introduced as single events into E. coli strains that accumulate cis-ζ-carotene, lycopene, or β-carotene. In addition, the E. coli strain that produces zeaxanthin was also used for in vivo assays. Co-expression of each of the five CCD4 genes in strains of E. coli accumulating cis-ζ-carotene, lycopene, β-carotene, and zeaxanthin did not cause a lack of pigmentation in these cultures. However, a reduced colour development was observed in the β-carotene- and zeaxanthin-producing cells which expressed CmCCD4a. Co-expression of all the five CCD4 genes in E. coli strains that accumulate cis-ζ-carotene and lycopene did not affect the accumulation of these two carotenoids.

The headspace of various carotenoid-producing E. coli strains which harbour different CCD4 genes was analysed by SPME-GC-MS (Fig. 3). β-Ionone (peak 1) was detected in the headspace of all β-carotene-producing cells which express each of the five CCD4 genes, albeit in some cases in very tiny amounts (Fig. 3A). A small amount of β-ionone was also detected in the headspace of the control cultures harbouring the empty vector pGEX-4T1. This β-ionone is probably derived directly from autoxidation of β-carotene. The largest concentration of β-ionone (46 times that of the control cells) was detected in the headspace of cells expressing CmCCD4a. This result confirmed the reduced accumulation of β-carotene in those cells. Cells expressing MdCCD4 also produced a relatively large amount of β-ionone (21 times that of the control cells), although no significantly reduced level of β-carotene was observed in this strain by UV-visible spectroscopy (data not shown). It is assumed that the carotenoid production rate largely exceeds the degradation rate by MdCCD4 by which the loss of pigmentation is compensated. Only very low levels of β-ionone were released from the cells expressing OfCCD4, RdCCD4, and AtCCD4 (3.8, 2.6, and 2.1 times that of the control cells, respectively). Interestingly, β-ionone (peak 2) was also detected in the headspace of zeaxanthin-producing E. coli strains which expressed CmCCD4a, MdCCD4, OfCCD4, and RdCCD4 genes (Fig. 3B), while no β-ionone was produced by control cells. However, 3-hydroxy-β-ionone was not found in the headspace and liquid media of zeaxanthin-producing E. coli strains that expressed the different CCD4 proteins. The β-ionone is probably a breakdown product of β-carotene, an intermediate in zeaxanthin biosynthesis (Misawa ). The highest levels of β-ionone were detected in cells expressing CmCCD4a, and the lowest in cells expressing RdCCD4. This result corresponded to the data obtained with the β-carotene-producing cells and confirmed again that CmCCD4a, MdCCD4, and to a much lesser extent OfCCD4 and RdCCD4 could cleave β-carotene at the 9,10 (9′,10′) positions to generate β-ionone. Moreover, no cleavage products were detected by SPME-GC-MS in any of the cis-ζ-carotene- and lycopene-producing cells which expressed each of the five CCD4 genes (data not shown).

Fig. 3.

GC-MS analyses of the bacterial headspace. Escherichia coli strains engineered to accumulate β-carotene (A) and zeaxanthin (B) were co-transformed with the pGEX-AtCCD4 (AtCCD4), pGEX-RdCCD4 (RdCCD4), pGEX-OfCCD4 (OfCCD4), pGEX-MdCCD4 (MdCCD4), pGEX-CmCCD4a, and pGEX-4T1 empty vector (pGEX, negative control). The mass spectra of peak 1 and 2 yield fragmentation patterns identical to those of β-ionone.

Recombinant proteins of MdCCD4, CmCCD4a, RdCCD4, OfCCD4, and AtCCD4 were further assayed for their cleavage activities with zeaxanthin, lutein, astaxanthin, canthaxanthin and 8′-apo-β-caroten-8′-al in in vitro test systems. Incubation solutions with carotenoid substrates (zeaxanthin, lutein, astaxanthin, and canthaxanthin) were extracted and analysed by UV-visible spectroscopy and HPLC, whereas those with 8′-apo-β-caroten-8′-al were analysed by GC-MS. The results showed that no cleavage products were detected in any reaction solution containing zeaxanthin, lutein, astaxanthin, or canthaxanthin and each of the five recombinant proteins (data not shown). However, β-ionone was produced in assays containing CCD4 enzymes and 8′-apo-β-caroten-8′-al (Fig. 4A). A low level of β-ionone which is derived from autoxidation was also detected in the control reaction (pGEX). Like CCD1 proteins, CCD4 enzymes could cleave 8′-apo-β-caroten-8′-al at the 9,10 position to yield β-ionone, but the cleavage activities of various CCD4 enzymes examined were much lower than that of the RdCCD1 and AtCCD1 enzyme (data not shown). The highest level of β-ionone was observed in the reaction solution containing AtCCD4 (Fig. 4A). AtCCD4 could not oxidize β-carotene in vivo very well, but degraded 8′-apo-β-caroten-8′-al in vitro better than the other four CCD4 enzymes. In contrast, CmCCD4a oxidized β-carotene more efficiently than the other four CCD4 enzymes, but could not cleave 8′-apo-β-caroten-8′-al well.

Fig. 4.

GC-MS analyses of the cleavage products of 8′-apo-β-caroten-8′-al catalysed by recombinant AtCCD4, RdCCD4, OfCCD4, MdCCD4, and CmCCD4a proteins (A) and catalysed by recombinant AtCCD4 under various conditions (B): the enzyme reactions were performed at 30 °C in a 1% β-octylglucoside solution containing 6.25 μg of 8′-apo-β-caroten-8′-al (AtCCD4); or additionally with 15% ethanol (AtCCD4-EtOH); 8 mM EDTA (AtCCD4-EDTA); or 400 μM ferrous ions (AtCCD4-FeSO4). The pGEX-4T1 empty vector (pGEX) was used as negative control. The mass spectra of peak 3 and 4 yield fragmentation patterns identical to those of β-ionone.

In previous studies, it has been shown that ferrous iron is essential for the cleavage activity of CCDs (Schwartz ) and that the addition of organic solvents in the form of short-chain aliphatic alcohols (such as methanol and ethanol) positively affects the enzyme activity of CCD1 (Mathieu ; Schilling ). The present investigation showed that the addition of ferrous iron (400 μM) could enhance the cleavage activity of AtCCD4 (Fig. 4B). However, the enzymatic activity was totally inhibited by the addition of 15% (v/v) ethanol in the reaction mixture and partially inhibited by the addition of 8 mM EDTA, a chelator of divalent cations.

Spatial distribution of the RdCCD4 gene transcript in the rose plant

The expression pattern of RdCCD4 was examined in various rose organs by real-time PCR (Fig. 5). RdCCD4 transcripts were present predominantly in flower, however, at very low levels also in leaf, stem, and root. The expression level in flower was 42-fold higher than the level found in leaf, 150-fold higher than that in stem, and 240-fold higher than that in root. Although RdCCD4 is mainly expressed in flower, it could not cleave β-carotene efficiently to yield β-ionone but was able to oxidize 8′-apo-β-caroten-8′-al. It is assumed that RdCCD4 is not involved in the production of β-ionone, a key flavour compound in rose oil (Demole ; Ohloff and Demole, 1987). The recently characterized RdCCD1 which efficiently forms the C13-norisoprenoid in vivo and is expressed in rose flower is a better producer of the aroma chemical (Huang ). The biological role of RdCCD4 in rose is still unclear, but it could have an as yet unknown role in flower development.

Fig. 5.

Spatial distribution of the RdCCD4 gene transcript in the rose plant. Quantitative real-time RT-PCR analysis was performed using RdCCD4 and Interspace gene-specific primers, the latter used as an internal control for normalization. Total RNA was extracted from mature leaves, whole flowers (full bloom), stems, and roots of a potted rose plant (Rosa×damascena). Values are means ±SEM of three different evaluations carried out with two sets of cDNAs.

Discussion

The present results and literature data show that there are at least two isoforms encoded by CCD4 genes. CmCCD4a and CmCCD4b isolated from chrysanthemum show 74% identity to each other. However, they have extremely different expression patterns in chrysanthemum (Ohmiya ). CcCCD4a and CcCCD4b isolated from citrus fruit show only 49% identity to each other (Agustí ). A 98% identity was found between CsCCD4a and CsCCD4b that can be considered as allelic variants, due to the triploid nature of C. sativus (Rubio ). CsCCD4a and CsCCD4b showed 100% and 98% similarity in 369 amino acids with CsZCD which could cleave zeaxanthin at the 7,8 and 7′,8′ positions (Bouvier ). Sequence comparison revealed, however, only 60–71% similarity in 369 amino acids between the other CCD4 genes and CsZCD. Although CsCCD4 presents high similarity with CsZCD, no cleavage product of zeaxanthin was detected in the assay with recombinant CsCCD4 expressed in E. coli (Rubio ). The results also showed that zeaxanthin was not degraded by recombinant MdCCD4, CmCCD4a, RdCCD4, OfCCD4, and AtCCD4.

Different isoforms of CCD4 probably exhibit different biochemical functions in plants as they are differentially expressed. Expression of CmCCD4a was strictly limited to flower petals and was not detected in other organs. However, the levels of CmCCD4b transcripts were extremely low in petals, but very high in stems (Ohmiya ). The present investigation showed that CmCCD4a cleaves β-carotene at the 9,10 (9′,10′) positions in compliance with the formation of white petals. Oxygen-functionalized carotenoids (xanthophylls) were not oxidized by CmCCD4a or any of the CCD4 enzymes analysed. CCD1 proteins which also cleave β-carotene at the 9,10 (9′,10′) positions show a much broader substrate tolerance and accept a multitude of xanthophylls as substrates (Huang ).

Expression of CsCCD4 was significantly induced by dehydration stress and heat treatment (Rubio ). In contrast, expression of AtCCD4 and CcCCD4a was not induced by drought stress (Iuchi ; Agustí ). The transcripts of CsCCD4 were only found in floral organs and the expression pattern is consistent with the high levels of β-carotene and emission of β-ionone formed during stigma development. Additionally, it has been shown that CsCCD4 cleaves β-carotene at the 9,10 (9′,10′) positions (Rubio ). Also the apple MdFS2 (MdCCD4) gene was preferentially expressed in floral organs at full bloom (Watillon ). The present study indicated that the enzyme encoded by MdCCD4 degrades β-carotene to yield β-ionone. Similarly, RdCCD4 is also almost exclusively expressed in rose flower (Fig. 5) while AtCCD4 is expressed in Arabidopsis during petal differentiation and anthesis (http://www.arabidopsis.org/servlets/TairObject?type=locus&name=At4g19170). However, RdCCD4 probably does not contribute to the production of C13-norisoprenoids in rose flower as this enzyme could not cleave β-carotene well to form β-ionone. Taken together, all CCD4 genes examined are expressed in flower and, except for RdCCD4 and AtCCD4, all CCD4 proteins produce β-ionone from β-carotene albeit that OfCCD4 shows low cleavage activity.

Although CCD4 genes have been isolated from several plants, only CsCCD4 isolated from C. sativa has been characterized as exhibiting β-carotene cleavage activity at 9,10 (9′,10′) double bonds to yield β-ionone (Rubio ). Additional cleavage activities of CCD4 enzymes were observed in the present studies. CmCCD4a and MdCCD4 accepted the C40-carotenoid β-carotene as substrate, while AtCCD4 and RdCCD4 preferentially cleaved the C30-apocarotenoid substrate 8′-apo-β-caroten-8′-al (Figs 3, 4). Interestingly, the expression patterns of both CmCCD4a and MdCCD4 are flower specific and both genes contain introns in their genomic DNA. AtCCD4 and RdCCD4 exhibit similar substrate specificity and contain no intron in their genomic DNA. OfCCD4 also contains introns; nevertheless, the encoded protein could cleave neither carotenoid nor apocarotenoid well. The correlation between the number of introns, expression pattern, and the substrate specificity may be explained by the fact that shuffling of DNA in an ancestral gene resulted in the evolution of a new CCD4 isoform with novel properties. A positive effect of introns on gene expression has been observed for many plant genes (Rose and Last, 1997; Rose, 2004). The retention of introns in MdCCD4, CmCCD4a, and OfCCD4 may point to some functional significance of these introns. However, like RdCCD4 and AtCCD4, the five members of the AtNCED subfamily also lack introns (Tan ). There is some evidence that the efficiency of intron splicing may be degraded under severe stress in plants (Marrs and Walbot, 1997). Tan assumed that the absence of introns may be a mechanism for enhancing NCED expression and ABA synthesis under stress.

Detailed analyses of various CCD enzymes have demonstrated the production of β-ionone by CCD1 proteins. However, the present results suggest that the C13-apocarotenal might also be formed by a redundant enzymatic activity. This could explain why in transgenic tomato, petunia, and Medicago truncatula co-suppressed for CCD1 expression, the plants still produced β-ionone (Simkin , b, Floss ). Although CCD1 and CCD4 enzymes cleave carotenoids at the same positions (9,10 and 9′,10’), CCD4 enzymes seem to be more substrate specific than CCD1. CCD1 enzymes have a broad substrate tolerance and produce numerous C13 products (Schwartz ; Simkin ; Ibdah ; Huang ). In the present studies, CCD4s could not cleave linear carotenoids such as lycopene and cis-ζ-carotene, or carotenoids containing a hydroxyl group such as zeaxanthin and lutein. It seems that CCD4s only cleave cyclic non-polar carotenoids such as β-carotene. Moreover, the CCD1 enzymes have been shown to be located in the cytoplasm and lack a chloroplast transient peptide in their sequence (Auldridge ). In contrast, CCD4 enzymes show a targeting sequence and have been reported to be located in plastids (Ytterberg ; Rubio ). The location of CCD4 enzymes within plastids allows these enzymes to obtain access to plastid carotenoids. Similarly, CCD7 has also been reported to catalyse a specific 9–10 cleavage of β-carotene and has been shown to be located inside the plastids (Schwartz ; Auldridge ).

RNAi-mediated repression of MtCCD1 in mycorrhizal roots of M. truncatula caused accumulation of C27-apocarotenoids (Floss ). The authors suggested that the major substrates for CCD1 enzymes in planta may not be C40 carotenoids but rather C27 apocarotenoid compounds. The first step (C40→C27+C13) may be catalysed by CCD7 and/or CCD4 inside plastids. However, it was demonstrated that CCD4 isoforms oxidize different substrates. Therefore, it is reasoned that CCD4 enzymes such as AtCCD4 and RdCCD4 cleave apocarotenoids rather than carotenoids in vivo while CmCCD4a and MdCCD4 prefer C40 carotenoids.

VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. VAR3 protein contains novel repeats and zinc-fingers described as protein interaction domains. This protein interacts specifically in yeast and in vitro with AtCCD4 (Næsted ). Both VAR3 and AtCCD4 accumulate in the chloroplast stroma. The var3 mutant exhibits a variegated phenotype and accumulates lower levels of chlorophylls and carotenoids (Næsted ). Since VAR3 interacts with AtCCD4, VAR3 could act as a signal molecule to regulate the function of CCD4 enzymes, furthermore regulating carotenoid catabolism. It was observed that some CCD4 enzymes have cleavage activities on carotenoids. Therefore, it is conjectured that CCD4 loses its function when VAR3 and CCD4 bind together. In contrast, free CCD4 promotes carotenoid catabolism.

Five CCD4 genes have ben isolated from different plant sources and heterologously expressed in E. coli. Enzyme assays indicated that the recombinant proteins derived from different CCD4 genes oxidatively cleave their substrates at the same position (9,10 and 9′,10′) but they might have different biochemical and biological functions as they accept different (apo)-carotenoid substrates and show various expression patterns. Thus, the results add to the knowledge about the enzymatic activity of carotenoid cleavage proteins. Clearly, the identification of the in vivo substrates, which will help to understand the function of plant CCD4 enzymes, is one of the major challenges for the future. It may be approached by overexpression and RNAi-mediated repression of CCD4 enzymes in transgenic plants.

Supplementary data

Supplementary data are available at JXB online.

Coomassie-stained polyacrylamide gels showing recombinant proteins expressed with the glutathione S-transferase fusion vector system.