Literature DB >> 19360135

A first-stage approximation to identify new imprinted genes through sequence analysis of its coding regions.

Elias Daura-Oller1, Maria Cabré, Miguel A Montero, José L Paternáin, Antoni Romeu.   

Abstract

In the present study, a positive training set of 30 known human imprinted gene coding regions are compared with a set of 72 randomly sampled human nonimprinted gene coding regions (negative training set) to identify genomic features common to human imprinted genes. The most important feature of the present work is its ability to use multivariate analysis to look at variation, at coding region DNA level, among imprinted and non-imprinted genes. There is a force affecting genomic parameters that appears through the use of the appropriate multivariate methods (principle components analysis (PCA) and quadratic discriminant analysis (QDA)) to analyse quantitative genomic data. We show that variables, such as CG content, [bp]% CpG islands, [bp]% Large Tandem Repeats, and [bp]% Simple Repeats, are able to distinguish coding regions of human imprinted genes.

Entities:  

Year:  2009        PMID: 19360135      PMCID: PMC2666875          DOI: 10.1155/2009/549387

Source DB:  PubMed          Journal:  Comp Funct Genomics        ISSN: 1531-6912


1. Introduction

Genomic imprinting is an epigenetic modification of dispersed regions of the genome depending on their exposure to the maternal or paternal germline. This results in differential expression of only one of the two alleles depending on the parent of origin. Allele-specific CpG methylation, histone acetylation, asynchronous DNA replication, and chromatin condensation are all associated with imprinted loci [1]. Recently, the question of whether imprinted genes have sequence characteristics that distinguish them from non-imprinted genes is drawing the attention of several research groups. Such structural differences may elucidate the mechanisms leading to allele-specific expression of imprinted genes [2]. Greally [3] found that the main sequence characteristic of human imprinted genes is a lower incidence of short interspersed nuclear elements. For tandem repeats and CpG islands, there is accumulating evidence correlating these elements and genomic imprinting. Accordingly, some authors [4-7] suggested using these sequence features as a search tool for imprinted genes. Identifying imprinted genes experimentally is challenging because the monoallelic expression of an imprinted gene may occur only in one of possibly several isoforms, only in particular tissues, or only at particular stages of development. Many autosomal genes are imprinted only in specific tissues or cell types, including GRB10 [8], Igf2/H19 [9], UBE3A [10], ATP10A (formerly ATP10C) [11], and KCNQ1 [12]. Consequently, in the absence of any method for prioritising genes, an average of 100 genes must be examined before a new imprinted gene can be identified. Indeed, experimental identification of human imprinted genes to date has been slow. To date, only ~60 human imprinted genes have been identified. For this reason, the application of sequence analysis approaches to genome-wide screening of human genes, which can be ranked to identify those with a sequence composition suggestive of imprinting, is very useful. To date, imprinted genes are predicted using a wide range of genomic features and sophisticated strategies and methodologies [13-16], but no simple sequence patterns and models are known to accurately distinguish imprinted genes from non-imprinted ones. But even so, a simple approach would be potentially valuable for directing laboratory work in a first stage. We are concerned with identifying possible candidate imprinted genes to allow their imprinting status to be determined experimentally. For this reason, human gene coding region features are considered further with a view to developing an approximation to a first-stage screening and classifying genes into imprinted and non-imprinted candidate groups. This study uses statistical approaches for a first discrimination between imprinted and non-imprinted genes based on the currently available coding region sequences.

2. Materials and Methods

A positive training set of 30 human genes (Table 1) that showed imprinting effects were selected for analysis from the Catalogue of Imprinted Genes (http://igc.otago.ac.nz/home.html). A negative training set of 72 randomly selected control genes and a test set of 31 predicted imprinted genes were compiled from the recent literature [16] and were collected from the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/). See supplementary data for more details about these genes used in this study.
Table 1

List of imprinted genes classified by expression.

NameBandExpression
TP731p36M
LRRTM12p12P
NAP1L54q22P
PRIM26p12M
PLAGL16q24P
HYMAI6q24P
PEG107q21P
PON17q21P
CALCR7q21M
PPP1R9A7q21M
MEST7q32P
COPG27q32P
CPA47q32M
KLF147q32M
KCNK98q24M
INPP5F_V210q26P
KCNQ111p15M
IGF2AS11p15P
SMPD111p15M
IGF211p15P
ZNF21511p15M
H1911p15M
SLC22A1811p15M
PHLDA211p15M
NDN15q11P
MKRN315q11P
MAGEL215q11P
UBE3A15q12M
TCEB3C18q21M
NNAT20q11P
The sequence characteristics of the coding regions of each gene were examined in the analysis. These regions are the portions of a gene or an mRNA which actually code for a protein. For CpG dinucleotide analysis, we used the NEWCPGREPORT program (http://mobyle.pasteur.fr/cgibin/portal.py?form=newcpgreport), and the total number of CpG islands was counted. For the repeat element analysis, the Repeat Masker program (http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker) was used, and for tandem repeat analysis, the ETANDEM program (http://mobyle.pasteur.fr/cgi-bin/ MobylePortal/portal.py?form=etandem) was used. All classes of repeat elements output from Repeat Masker were collected. We used ETANDEM to obtain numbers of tandem repeat elements ranging from 5 bp to 100 bp. The Wilbur and Lipman pairwise sequence alignment method, implemented in the MegaAlign program of the DNAstar Sequence Analysis software (Lasergene v8.0; http://www.dnastar.com) used to align sequences of Large Tandem Repeats identified in imprinted genes. Principal component analysis (PCA) and quadratic discriminant analysis (QDA) models of the [bp]% sequence characteristics data were performed using the Minitab software [17]. PCA analysis is a multivariate statistical technique. The central idea of PCA is to reduce the dimensionality of a data set that presents a large number of interrelated variables, while retaining as much as possible the variation present in the data set. PCA can search the data for qualitative and quantitative distinctions in situations where the number of data available is too large. The purpose of the Quadratic Discriminant Analysis is to predict membership of a group from a set of predictor variables (the sequence characteristics). The discriminant is the quadratic combination of the predictor variables that best predicts group membership, allowing each gene to be classified into either imprinted or control groups on the basis of its sequence characteristics. The performance of the classification was assessed using internal and external validation methods according to our software capabilities. With the QDA model, we used an internal validation method called cross-validation [18]. This method uses the training set to check the model. Here, the training set is divided in several segments. One segment is reserved to corroborate the results, and the rest of them are used to build the model. This process is repeated as many times as segments you have, and every time one of these segments is out of the calibration, and the other ones are used to build the model. Finally, all the segments are used to both build and validate the model. With the PCA model, we used the external validation test set method. The number of elements of this set must be large (at least 25% of the training set size), and it must be independent of the training set, but also this test set must represent the training set. The imprinted status of the test set is known, so it is possible to assess the PCA model using different elements that the ones used to build the model.

3. Results and Discussion

Recently, Ke et al. [14] found significant statistical differences between some sequence descriptors of human imprinted and control gene coding regions. These significant variables in their regression model were the Simple and Large Tandem Repeats, GC content, CpG islands, and short interspersed nuclear elements. Taking into account this fact, we considered these descriptors (variables) as the most relevant ones for our study. So, the [bp]% genomic sequence characteristics of GC content, CpG islands, simple repeats (SR), large tandem repeats (LTR) and SINEs of all imprinted and non-imprinted coding region sequences were calculated. Before applying the pattern recognition methods, each calculated descriptor was autoscaled. In the autoscaling method, each variable is scaled to a mean of zero and a standard deviation of unity. This method is very important because each variable is weighted equally, and this provides a measure of the ability of a descriptor to discriminate classes of compounds [19]. With this method, we can compare all descriptors at the same level. Firstly, we started applying the PCA technique. After several PCA analyses, the best separation was obtained by using the following descriptors: GC content, [bp]% CpG islands, [bp]% Simple Repeats and [bp]% Large Tandem Repeats. This suggests that in this case, the other variables are not significant for the classification of the coding regions studied. The PCA results show that the first component (PC1) is responsible for 49.6% of the variance of the data. Considering the first (PC1) and second (PC2) components, the accumulated variance increases to 72%. Figure 1 shows that both PC1 and PC2 are in fact responsible for the discrimination between imprinted (two groups: I1 and I2) and non-imprinted (two groups: NO_I1 and NO_I2) genes. PC1 and PC2 can be represented by the following equations, that in fact form the PCA pattern recognition model: From Figure 2 and (1), we can see that the imprinted group I1 has large values for GC content and [bp]% CpG islands and a major content of [bp]% LTR compared with the I2 group. The imprinted group I2 has small values for GC content and [bp]% CpG islands and a major content of [bp]% SR.
Figure 1

The separation of the training set into four groups: I1, I2, NO_I1 and NO_I2. Notice that both PCs are responsible for the separation.

Figure 2

Plot of the loading values of the selected variables used in the training set.

On the other hand, we can see that the major part of non-imprinted genes, the NO_I2 group, has small values for [bp]% SR and [bp]% LTR, and the NO_I1 group has large values for the same both descriptors. It is clear that there are four coding region groups, and each one is located in practically one specific quadrant of the XY axes. Genomic sequence characteristics of a total of 22544 bp from the coding sequences of 12 (I1 group) imprinted genes were compared to those of 66959 bp of coding sequences of 18 (I2 group) imprinted genes (Table 2) in order to carry out a deep study of the most relevant imprinted descriptors. The average number of CpG islands was higher in I1 group (1.8) than in I2 group (0.4). The frequency of G + C was also higher in I1 genes (62%) than in I2 ones (45%). Moreover, the average number of the ratio [bp]% LTR/[bp]% coding sequence coefficient is higher in the I1 group (I1) than in I2 (0.03). Note that these results are in good agreement with the loadings of the PCA model.
Table 2

The number of large tandem repeats (LTR), CpG islands, and GC content in coding sequences of imprinted genes.

I1 groupLenghtCG contentNumber CpG islandsNumber LTRSize countConsensus
TP73223464.630
LRRTM1221758.42124_7ctgccgaaccacaccttccaggac
KLF14138366.82118_9cggcgcgcccgccgcctc
KCNK9130360.120
KCNQ1326263.41130_4cgcggccgccgccccgggccccgcgccccc
IGF2AS20566410
SMPD1247359.8116_9cgctgg
IGF2135663.73114_18tccccccctctctc
SLC22A1815496510
PHLDA293761.7119_14ccgcgccct
NDN189752.32157_4cccaggcccacaacgccccgggcgccccgaaggcggttccgccggccgcggccccgg
TCEB3C187764.720

I2 groupLenghtCG contentNumber CpG islandsNumber LTRSize countConsensus

NAP1L5191242.90112_7ggaggaggagga
PRIM2235340.700
PLAGL1435446.91125_3atcttacaaaaaaaaaaaaaaaaaa
HYMAI500542.11113_7tatatatatataa
PEG10662844.72242_3 12_4agaagctctcagaggagaacaacaaccttcgagagcaggtgg/ccgccgcctcca
PON1239541.300
CALCR347040.400
PPP1R9A970539.9015_8ttttc
MEST250745.11242_4 23_3ggcggctgcggctgccgcgcccggtgctgcccagcgctgcgg/caaaaaaaaaaaaaaaaaaaaaa
COPG2336543.100
CPA4280748.910
INPP5F_V2495543.510
ZNF215365840.41284_3 84_3tattcgacatcaaaaaattcatactgaagcgaaggcctataaatgcaataaatgtgggaaagccttcagccgaagtgcagacct/aaaactgcatactggagataagtcctgaaaatgtaaaaaatgtaggaaaaccttcaaccggagttcagaacttatttaacatca
H19261555.9028_10 20_4ggggggga/ctttttcttcttcctccttt
MKRN33107480129_5ttaaaaattatatatataagaatataaaa
MAGEL2229453.70236_7 21_3cgggccctgagtgtctgggagggcccaagcacctcc/ggcctcctcaaaagagcgcag
UBE3A449136.70110_7aaaacaaaaa
NNAT133856.500
We found an obvious functional difference between I1 and I2 groups in terms of expression pattern. We observed maternal expression for 67% of the I1 imprinted genes and paternal expression for 61% of the I2 imprinted genes. Moreover, other important observation is that all the Large Tandem Repeats of the I1 group genes are inside CpG islands while this fact is not observed in the I2 group. These results agree with those of Meguro et al. [11]: the CpG islands of imprinted genes contain some special DNA elements that distinguish them from CpG islands of biallelically expressed genes. To identify sequence fingerprints and similarities among Large Tandem Repeats in the two imprinted groups, we used the Wilbur and Lipman pairwise sequence alignment method (see supplementary data for details). The I1 sequences group is quite consistent; all sequences are rich in GC content, and the similarity index of the aligned fragments ranges from 60 to 100%. In contrast, the sequences of the I2 group are longer, more heterogenous in terms of nucleotide composition; in some of them, the presence of a polyA motif could be empathised. The I2 sequence repeats show a much more wide range of similarity index. In addition, because of some significant differences in nucleotide composition between members of I2 sequences, some I2 sequence pairs could not to be aligned. From this analysis, we can conclude that these two Large Tandem Repeats: GC-motifs (in I1 group) and AT-motifs (in I2 group) are highly conserved sequence patterns across their respective coding regions. Then, we built a new model using another statistical technique: the quadratic discriminant analysis (QDA). QDA is also closely related to principal component analysis (PCA) in that both look for combinations of variables which best explain the data. QDA explicitly attempts to model the difference between the classes of data (supervised pattern recognition). PCA, on the other hand, does not take into account any difference in class (nonsupervised pattern recognition). Table 3 shows the results of the QDA classification model. The total percentage of correct classification was 93%, and the proportions for each group are 100% (I2), 92% (I1), 90% (NO_I1) and 92% (NO_I2).
Table 3

Classification obtained with the QDA analysis.

GroupI2I1NO_I1NO_I2
count18122151

Summary of classification

True group

Put into group I2 I1 NO_I1NO_I2
I2180 2 3
I1 01101
NO_I10 019 0
NO_I201 047
Total N 18122151
N correct18 11 19 47
Proportion1,000,920,90 0,92

N = 102; N correct = 95; proportion correct = 0,93; proportion correct with cross-validation = 0.833.

After the employing of QDA and PCA methods, we proceeded to the validation of their respective classification models. The cross-validation approach was used to validate the QDA model. The total percentage of correct classification was 83% (Table 3). Therefore, this result confirms the existence of four groups between the coding regions characteristics. On the other hand, the test set approach was used to validate the PCA model. We decided to apply the PCA model to a series of new predicted imprinted genes whose imprinting status was predicted by other methodologies [16] but it is still not experimentally proved. In this way, apart from the construction of a representative test set, we could compare our PCA results with the ones of Luedi et al. [16]. To form a randomly test set, we did a full-text mining search with all Luedi's predicted gene names across the publication data of the Nutrigenomics Database (http://133.11.220.243/nutdb.html). After that, we formed a test group of 31 supposed imprinted genes related to nutrigenomics in humans (Table 4). It is important to emphasise that these possible imprinted genes are related with dietary factors known to influence DNA methylation as alcohol, folate, zinc, and cadmium. We thought that this fact may be interesting for future nutrigenomic work.
Table 4

List of 31 genes from the test group.

GeneExpressionLenghtChromosome
GFI1P27841
EFNA4M12761
HSPA6M26641
SHC1M17521
CYP1B1P51282
SIX3P19262
OTX1M21762

BCL2L11P34222
HOXD9M20892
PER2M62192
PPARGP18833

POLR2HM8213
PITX2P21224
TLL1P66544

NDUFS4P6685
ITGB8M87877
CDK6M116117
PTPRN2M47677

GADD45GP10789
AKR1C2P166310
GATA3P307010
NRGNP129511
KLRF1P124212
KLRC3P104212
POU4F1M501513
F10M156013
JAG2M507714
SFRS2M292317
GATA6M349418
ELA2M93819
ZNF42M262019
We calculated the genomic sequence characteristics of the 31 coding regions, and then we checked if our PCA pattern recognition model could classify them as imprinted genes, too. Figure 3 shows the results of the PCA calculations for the first (PC1) and second (PC2) principal components. Before carrying out the prediction calculations, the descriptors were also autoscaled as previously. We found that 27 of the 31 genes were classified in the two correct imprinted quadrants (84%) by the PCA model. The GFI1, HSPA6, HOXD9, PITX2, PTPRN2, GADD45G, GATA3, NRGN, F10, JAG2, GATA6, ELA2, and ZNF42 genes are classified in the I1 imprinted group. The I2 imprinted groups are formed by EFNA4, BCL2L11, PER2, PPARG, POLR2H, TLL1, NDUFSA4, ITGB8, CDK6, AKR1C2, KLRF1, KLRC3, POU4F1, and SFRS2 genes.
Figure 3

Scores for the predicted imprinted genes.

Therefore, taking together these results and the ones of Luedi et al., we can suggest these 27 genes as good candidates for an experimental imprinting determination.

4. Conclusions

The most important feature of the present work is its ability to use multivariate analysis to look at variation, at coding region DNA level, among imprinted and non-imprinted genes. There is a force affecting genomic parameters that appears through the use of the appropriate multivariate methods (principle components analysis (PCA) and quadratic discriminant analysis (QDA) to analyse quantitative genomic data. We show that variables, such as, CG content, [bp]% CpG islands, [bp]% Large Tandem Repeats, and [bp]% Simple Repeats are able to distinguish human coding region imprinted genes. We know that a conclusive assessment of prediction methods for imprinted genes is problematic due to the small number of affected genes, their clustering in small genomic regions, and the difficulty of experimental validation. However, we think that the application of this PCA sequence analysis approach to genome-wide screening of human genes, which can be ranked to identify those with a sequence composition suggestive of imprinting, is potentially valuable for a first-stage approximation directing follow-up laboratory work. Clearly an approach like this can be further refined and the resolution improved as more imprinted genes are identified and confirmed and the genome sequencing is completed. Supplementary material containing lists of genes used in the study: a negative training set of 72 randomly selected control genes and a test set of 31 predicted imprinted genes; a table with the relevant calculated features; results of Wilbur and Lipman pairwise sequence alignment method. Click here for additional data file.
  16 in total

1.  Computational and experimental identification of novel human imprinted genes.

Authors:  Philippe P Luedi; Fred S Dietrich; Jennifer R Weidman; Jason M Bosko; Randy L Jirtle; Alexander J Hartemink
Journal:  Genome Res       Date:  2007-11-30       Impact factor: 9.043

2.  Imprinting of mouse Kvlqt1 is developmentally regulated.

Authors:  T D Gould; K Pfeifer
Journal:  Hum Mol Genet       Date:  1998-03       Impact factor: 6.150

Review 3.  A census of mammalian imprinting.

Authors:  Ian M Morison; Joshua P Ramsay; Hamish G Spencer
Journal:  Trends Genet       Date:  2005-08       Impact factor: 11.639

4.  Characteristics of imprinted genes.

Authors:  B Neumann; P Kubicka; D P Barlow
Journal:  Nat Genet       Date:  1995-01       Impact factor: 38.330

Review 5.  Lessons from comparative analysis of species-specific imprinted genes.

Authors:  K Okamura; T Ito
Journal:  Cytogenet Genome Res       Date:  2006       Impact factor: 1.636

6.  Genome-wide prediction of imprinted murine genes.

Authors:  Philippe P Luedi; Alexander J Hartemink; Randy L Jirtle
Journal:  Genome Res       Date:  2005-06       Impact factor: 9.043

7.  Tandem repeats in the CpG islands of imprinted genes.

Authors:  Barbara Hutter; Volkhard Helms; Martina Paulsen
Journal:  Genomics       Date:  2006-05-11       Impact factor: 5.736

8.  The Angelman syndrome candidate gene, UBE3A/E6-AP, is imprinted in brain.

Authors:  C Rougeulle; H Glatt; M Lalande
Journal:  Nat Genet       Date:  1997-09       Impact factor: 38.330

9.  Human GRB10 is imprinted and expressed from the paternal and maternal allele in a highly tissue- and isoform-specific fashion.

Authors:  N Blagitko; S Mergenthaler; U Schulz; H A Wollmann; W Craigen; T Eggermann; H H Ropers; V M Kalscheuer
Journal:  Hum Mol Genet       Date:  2000-07-01       Impact factor: 6.150

10.  Comparative analysis of sequence characteristics of imprinted genes in human, mouse, and cattle.

Authors:  Hasan Khatib; Ismail Zaitoun; Eui-Soo Kim
Journal:  Mamm Genome       Date:  2007-07-26       Impact factor: 2.957

View more
  3 in total

1.  Differential decay of parent-of-origin-specific genomic sharing in cystic fibrosis-affected sib pairs maps a paternally imprinted locus to 7q34.

Authors:  Frauke Stanke; Colin Davenport; Silke Hedtfeld; Burkhard Tümmler
Journal:  Eur J Hum Genet       Date:  2010-01-06       Impact factor: 4.246

2.  The application of restriction landmark genome scanning method for surveillance of non-mendelian inheritance in f(1) hybrids.

Authors:  Tomoko Takamiya; Saeko Hosobuchi; Tomotsugu Noguchi; Andrew H Paterson; Hiroshi Iijima; Yasufumi Murakami; Hisato Okuizumi
Journal:  Comp Funct Genomics       Date:  2010-01-27

3.  Imprinting of cerebral and hepatic cytochrome p450s in rat offsprings exposed prenatally to low doses of cypermethrin.

Authors:  Anshuman Singh; Sanjay Yadav; Vikas Srivastava; Rakesh Kumar; Dhirendra Singh; Rao Sethumadhavan; Devendra Parmar
Journal:  Mol Neurobiol       Date:  2013-02-28       Impact factor: 5.590

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.