| Literature DB >> 19338676 |
Katie A Ashton1, Anthony Proietto, Geoffrey Otton, Ian Symonds, Rodney J Scott.
Abstract
Hereditary non-polyposis colorectal cancer (HNPCC), also known as Lynch syndrome, is an autosomal dominant inherited predisposition to a number of epithelial cancers, most notably colorectal and endometrial cancer. Outside of the context of Lynch syndrome there is little evidence for an autosomal dominant or recessive condition that predisposes to endometrial cancer. Recently, genetic variants in MUTYH have been associated with a recessive form of colorectal cancer, known as MUTYH associated polyposis or MAP. MUTYH is involved in base excision repair of DNA lesions and as such a breakdown in the fidelity of this process would necessarily not be predicted to result in a specific disease. At present there is little information about the role of MUTYH in other types of cancer and only one report indicating a possible relationship with endometrial cancer.Similar to a previous study, we investigated a series of endometrial cancer patients to determine if MUTYH variants were over-represented compared to a series of healthy control subjects and to assess whether or not endometrial cancer risk could be explained by an autosomal recessive model of inheritance.Two MUTYH mutations, Y165C and G382D, and three common MUTYH polymorphisms, V22M, Q324H and S501F, were genotyped in 213 endometrial cancer patients and 226 controls from Australia using real time PCR. Differences in genotype frequencies were compared using Chi-squared analysis and by calculating odds ratios and 95% confidence intervals.Three endometrial cancer patients were identified with heterozygous MUTYH mutations (two G382D and one Y165C). No bi-allelic mutation carriers were identified. Two of the three patients' clinical characteristics were similar to those commonly identified in HNPCC and lend support to the notion that MUTYH mutations increase the risk of developing HNPCC related diseases. There was no difference in the five genotype frequencies of the endometrial cancer patients compared to the controls. The results of our study suggest that MUTYH is unlikely to be involved in the genetic basis of endometrial cancer but a possible association of MUTYH variants with HNPCC related diseases cannot be excluded.Entities:
Year: 2009 PMID: 19338676 PMCID: PMC2653716 DOI: 10.1186/1897-4287-7-3
Source DB: PubMed Journal: Hered Cancer Clin Pract ISSN: 1731-2302 Impact factor: 2.857
Real-Time PCR Assay-by-Design Primers and Probes for MUTYH Y165C, G382D and S501F
| MUTYH S501 (C>T) | CAGCCTTCCAAAAGGTTCCCA | GCTGTGTGCATCAGTGGAGAT | VIC-CACGGA | FAM-CACGGA |
| MUTYH Y165C (A>G) | CCACAGGAAGGTGAATCAACTCT | CCTTACCTTCCGAGCTCCCT | VIC-CTGGGCT | FAM-GGGCT |
| MUTYH G382D (G>A) | GACCCCTGCCTGGCT | GACGGGAACTCCCACAGT | VIC-CCTCTCAG | FAM-CCTCTCAG |
Note: The mutation/polymorphism is underlined in the probe sequences.
* The MUTYH S501F polymorphism is designed on the reverse strand.
The five MUTYH variants and their association with endometrial cancer risk
| MUTYH Y165C (A>G) | AA | 190 (99.5) | 120 (100) | 1.00 (reference) | |
| AG | 1 90.5) | 0 (0.0) | P = 0.43 | 0.53 (0.02–13.1) p = 0.43 | |
| GG | 0 (0.0) | 9 (0.0) | |||
| MUTYH G382D (G>A) | GG | 189 (99.0) | 118 (98.3) | 1.00 (reference) | |
| GA | 2 (1.0) | 2 (1.7) | p = 0.6 | 41.6 (0.22–11.5) p = 0.63 | |
| AA | 0 (0.0) | 0 (0.0) | |||
| MUTYH V22M (G>A) | GG | 172 (90.1) | 194 (85.8) | 1.00 (reference) | |
| GA | 17 (8.9) | 31 (13.7) | 1.62 (0.86–3.02) p = 0.17 | ||
| AA | 2 (1.0) | 1 (0.4) | 0.44 (0.04–4.94) p = 0.92 | ||
| MUTYH Q324H (G>C) | GG | 109 (57.1) | 129 (59.2) | 1.00 (reference) | |
| GC | 71 (37.2) | 75 (34.4) | p = 0.83 | 0.89 (0.59–1.35) p = 0.66 | |
| CC | 11 (5.8) | 14 (6.4) | 1.08 (0.4&-2.47) p = 0.86 | ||
| MUTYH S501F (C>T) | CC | 187 (97.9) | 210 (96.8) | 1.00 (reference) | |
| CT | 4 (2.1) | 7 (3.2) | p = 0.48 | 1.56 (0.45–5.41) p = 0.69 | |
| TT | 0 (0.0) | 0 (0.0) |
Characteristics of MUTYH Y165C and G382D heterozygous mutation carriers
| Year of Birth | 1933 | 1935 | 1951 |
| BMI (kg/m2) | >30 | 25–30 | 25–30 |
| Age of Diagnosis of Endometrial cancer (years) | 71 | 70 | 52 |
| Age of Menarche | 15 | 16 | 15 |
| Age of Menopause | 55 | 45 | 52 |
| No. of Children | 0 | 3 | 2 |
| Oral Contraceptive | Never Use | Never | Never |
| Other Diseases | High Blood Pressure Ovarian Cancer Colorectal Cancer | High Blood Pressure Diabetes | Diabetes |
| Family History of Sister Cancer | Colorectal cancer Mother & Maternal Aunt Breast Cancer | Father Colorectal Brother Leukaemia | None |
| Stage of Cancer | Unknown | 1B | Mixed Mullerian Malignant Tumour |
| Grade of Cancer | 1 | 1 | 3 |
| Histology | Adenocarcinoma | Adenocarcinoma | Mixed Mullerian Malignant Tumour |
| Recurrence | None | None | None |
| Smoker | Never | Current | Never |
| Alcohol | Non-Drinker | Non-Drinker | Non-Drinker |