| Literature DB >> 19282453 |
Jesper B Bramsen1, Maria B Laursen, Anne F Nielsen, Thomas B Hansen, Claus Bus, Niels Langkjaer, B Ravindra Babu, Torben Højland, Mikhail Abramov, Arthur Van Aerschot, Dalibor Odadzic, Romualdas Smicius, Jens Haas, Cordula Andree, Jharna Barman, Malgorzata Wenska, Puneet Srivastava, Chuanzheng Zhou, Dmytro Honcharenko, Simone Hess, Elke Müller, Georgii V Bobkov, Sergey N Mikhailov, Eugenio Fava, Thomas F Meyer, Jyoti Chattopadhyaya, Marino Zerial, Joachim W Engels, Piet Herdewijn, Jesper Wengel, Jørgen Kjems.
Abstract
The use of chemically synthesized short interfering RNAs (siRNAs) is currently the method of choice to manipulate gene expression in mammalian cell culture, yet improvements of siRNA design is expectably required for successful application in vivo. Several studies have aimed at improving siRNA performance through the introduction of chemical modifications but a direct comparison of these results is difficult. We have directly compared the effect of 21 types of chemical modifications on siRNA activity and toxicity in a total of 2160 siRNA duplexes. We demonstrate that siRNA activity is primarily enhanced by favouring the incorporation of the intended antisense strand during RNA-induced silencing complex (RISC) loading by modulation of siRNA thermodynamic asymmetry and engineering of siRNA 3'-overhangs. Collectively, our results provide unique insights into the tolerance for chemical modifications and provide a simple guide to successful chemical modification of siRNAs with improved activity, stability and low toxicity.Entities:
Mesh:
Substances:
Year: 2009 PMID: 19282453 PMCID: PMC2685080 DOI: 10.1093/nar/gkp106
Source DB: PubMed Journal: Nucleic Acids Res ISSN: 0305-1048 Impact factor: 16.971
Figure 1.Structural overview of chemical modifications investigated.
Overview of chemically modified ASs and SSs
| Name | AS/SS | Modification | eGFP levels | Viability | Sequence (5′–3′) |
|---|---|---|---|---|---|
| DHARM1 | AS | OMe | 0.24 ± 0.02 | 0.82 ± 0.11 | A |
| DO1001 | AS | OMe/EA | 0.20 ± 0.04 | 0.88 ± 0.11 | |
| DO1002 | AS | OMe/CE | 0.49 ± 0.06 | 1.01 ± 0.24 | |
| GS2371 | AS | ANA | 0.41 ± 0.03 | 0.58 ± 0.15 | |
| GS2372 | AS | ANA | 0.11 ± 0.01 | 0.59 ± 0.08 | ACUUGUGGCCGUUUACGUC |
| GS2373 | AS | ANA | 1.12 ± 0.08 | 0.73 ± 0.19 | ACUU |
| GS2378 | AS | ANA | 0.25 ± 0.03 | 0.51 ± 0.07 | AC |
| GS2537 | AS | HNA/DNA | 0.19 ± 0.02 | 0.57 ± 0.04 | ACUUGUGGCCGUUUACG |
| GS2538 | AS | HNA/DNA | 0.21 ± 0.04 | 0.48 ± 0.07 | A |
| GS2539 | AS | HNA/DNA | 0.20 ± 0.02 | 0.80 ± 0.12 | AC |
| GS2540 | AS | HNA/DNA | 0.63 ± 0.08 | 0.71 ± 0.12 | A |
| GS2544 | AS | AEM/DNA | 0.59 ± 0.06 | 0.94 ± 0.12 | ACUUGUGGCCGUUUACG |
| GS2549 | AS | APM/DNA | 0.87 ± 0.11 | 0.90 ± 0.19 | ACUUGUGGCCGUUUACG |
| JC10 | AS | F/OMe | 0.32 ± 0.03 | 0.70 ± 0.28 | |
| JC-A1 | AS | AENA | 0.26 ± 0.02 | 0.88 ± 0.18 | AC |
| JC-A2 | AS | AENA | 0.63 ± 0.05 | 0.55 ± 0.15 | ACU |
| JC-A3 | AS | AENA | 0.69 ± 0.11 | 1.05 ± 0.18 | AC |
| JC-F1 | AS | CENA | 0.10 ± 0.02 | 0.87 ± 0.17 | AC |
| JC-F2 | AS | CENA | 0.18 ± 0.05 | 0.80 ± 0.19 | ACU |
| JC-F3 | AS | CENA | 0.19 ± 0.04 | 1.08 ± 0.12 | AC |
| JC-S1 | AS | CLNA | 0.12 ± 0.01 | 0.80 ± 0.12 | AC |
| JC-S2 | AS | CLNA | 0.28 ± 0.01 | 0.65 ± 0.16 | ACU |
| JC-S3 | AS | CLNA | 0.31 ± 0.04 | 0.86 ± 0.08 | AC |
| JE1001 | AS | EA | 0.13 ± 0.01 | 0.62 ± 0.17 | ACUUGUGGCCGUUUACGUC |
| JH1001 | AS | AP | 0.45 ± 0.09 | 0.78 ± 0.17 | |
| JW1186 | AS | HM/LNA | 0.10 ± 0.04 | 0.95 ± 0.22 | ACUUG |
| JW1187 | AS | HM/LNA | 0.76 ± 0.13 | 1.01 ± 0.25 | AC |
| W006 | AS | LNA | 0.09 ± 0.01 | 0.49 ± 0.11 | ACUUGUGGCCGUUUACGUC |
| W010 | AS | LNA | 0.54 ± 0.08 | 0.67 ± 0.07 | AC |
| W042 | AS | HM | 0.18 ± 0.03 | 0.44 ± 0.09 | ACUUGUGGCCGUUUACGU |
| W047 | AS | ALN | 0.14 ± 0.03 | 0.46 ± 0.04 | ACUUGUGGCCGUUUACGUCG |
| W053 | AS | 0.14 ± 0.02 | 0.43 ± 0.09 | ACUUGUGGCCGUUUACGUCGC | |
| W054 | AS | HM | 0.33 ± 0.06 | 0.69 ± 0.12 | ACUUGUGGCCGUUUACGUC |
| W059 | AS | HM | 0.18 ± 0.02 | 0.72 ± 0.14 | ACUUGUGGCCGUUUACGUCG |
| W068 | AS | ADA/LNA | 0.54 ± 0.11 | 0.64 ± 0.12 | ACUUG |
| W075 | AS | LNA | 0.14 ± 0.02 | 0.86 ± 0.15 | ACUUGUGGCCGUUUACGU |
| W095 | AS | ADA/LNA | 0.36 ± 0.04 | 0.78 ± 0.15 | ACUUGUGGCCGUUUACG |
| W096 | AS | PYR/LNA | 0.38 ± 0.06 | 0.52 ± 0.15 | ACUUG |
| W097 | AS | PYR/LNA | 0.46 ± 0.05 | 0.73 ± 0.19 | ACUUGUGGCCGUUUACG |
| W106 | AS | OMe | 1.11 ± 0.12 | 0.73 ± 0.31 | |
| W123 | AS | UNA/LNA | 0.11 ± 0.02 | 1.08 ± 0.22 | ACUUG |
| W124 | AS | UNA/LNA | 0.16 ± 0.05 | 0.89 ± 0.22 | AC |
| W125 | AS | UNA/LNA | 0.11 ± 0.03 | 0.89 ± 0.13 | ACUUGUGGCCGUUUACG |
| W126 | AS | UNA/LNA | 0.13 ± 0.03 | 0.72 ± 0.15 | ACUUGUGGCCG |
| W127 | AS | UNA | 0.26 ± 0.05 | 0.66 ± 0.12 | ACUUGUGGCCGUUUACGUCG |
| W128 | AS | UNA | 0.56 ± 0.11 | 0.80 ± 0.23 | AC |
| W180 | AS | LNA | 0.27 ± 0.04 | 0.78 ± 0.22 | ACUUGUGGCCGUUUACGUC |
| W209 | AS | LNA | 1.18 ± 0.23 | 0.88 ± 0.22 | AC |
| DO003 | SS | EA | 0.10 ± 0.01 | 0.67 ± 0.10 | GACGUAAACGGCCACA |
| DO004 | SS | GE | 0.12 ± 0.01 | 0.62 ± 0.05 | GACGUAAACGGCCACA |
| GS2332 | SS | HNA | 0.15 ± 0.01 | 0.55 ± 0.12 | G |
| GS2366 | SS | HNA | 0.40 ± 0.06 | 0.65 ± 0.60 | GACG |
| GS2368 | SS | ANA/DNA | 0.11 ± 0.02 | 0.71 ± 0.11 | |
| GS2369 | SS | ANA/DNA | 0.10 ± 0.01 | 0.64 ± 0.18 | GACGUAAACGGCCACAA |
| GS2370 | SS | ANA/DNA | 0.31 ± 0.03 | 0.73 ± 0.22 | GACG |
| GS2374 | SS | ANA | 0.16 ± 0.03 | 0.60 ± 0.14 | GACGUAAACGGCCACAAGU |
| GS2383 | SS | HNA | 0.11 ± 0.01 | 0.78 ± 0.16 | GACGUAAACGGCCACAAG |
| GS2534 | SS | HNA/DNA | 0.11 ± 0.01 | 0.58 ± 0.15 | |
| GS2535 | SS | HNA/DNA | 0.19 ± 0.03 | 0.64 ± 0.09 | GACG |
| GS2536 | SS | HNA/DNA | 0.13 ± 0.02 | 0.74 ± 0.12 | GACG |
| GS2542 | SS | AEM/DNA | 0.11 ± 0.01 | 0.66 ± 0.15 | GACGUAAACGGCCACAAG |
| GS2543 | SS | AEM/DNA | 0.11 ± 0.02 | 0.62 ± 0.20 | GA |
| GS2547 | SS | APM/DNA | 0.12 ± 0.01 | 0.64 ± 0.18 | GACGUAAACGGCCACAAG |
| GS2548 | SS | APM/DNA | 0.17 ± 0.02 | 0.61 ± 0.08 | GA |
| JC1 | SS | OX | 0.11 ± 0.01 | 0.63 ± 0.20 | GACGUAAACGGCCAC |
| JC2 | SS | OX | 0.13 ± 0.02 | 0.81 ± 0.19 | G |
| JC5 | SS | F/OMe | 0.13 ± 0.02 | 0.90 ± 0.19 | |
| JE0007 | SS | EA | 0.11 ± 0.02 | 0.79 ± 0.23 | GACGUAAACGGCCACAAGU |
| JE0008 | SS | EA | 0.11 ± 0.02 | 0.66 ± 0.13 | GACGUAAACGGCCACAAG |
| JE010 | SS | EA | 0.13 ± 0.01 | 0.84 ± 0.15 | GACG |
| JW1104 | SS | LNA | GACGUAAACGGCCACAAGU | ||
| JW1106 | SS | LNA | 0.12 ± 0.01 | 0.80 ± 0.16 | GA |
| JW1188 | SS | HM | 0.15 ± 0.02 | 0.62 ± 0.15 | GACGUAAACGGCCACAAG |
| JW1189 | SS | HM | 0.11 ± 0.02 | 0.74 ± 0.13 | GACG |
| W004+W179 | SS | LNA | 0.13 ± 0.03 | 0.71 ± 0.17 | GA |
| W007 | SS | DNA | 0.69 ± 0.09 | 1.06 ± 0.19 | |
| W008 | SS | DNA/LNA | 0.41 ± 0.05 | 1.02 ± 0.16 | |
| W009 | SS | DNA/LNA | 0.71 ± 0.06 | 1.04 ± 0.17 | |
| W011 | SS | LNA | 0.12 ± 0.02 | 0.69 ± 0.13 | GACG |
| W013 | SS | LNA | 0.19 ± 0.03 | 0.95 ± 0.13 | GA |
| W037 | SS | LNA | 0.19 ± 0.03 | 0.66 ± 0.11 | GA |
| W043 | SS | HM | 0.11 ± 0.02 | 0.60 ± 0.14 | GACGUAAACGGCCACAAGU |
| W044 | SS | HM | 0.12 ± 0.02 | 0.67 ± 0.17 | GAC |
| W049 | SS | ALN | 0.11 ± 0.02 | 0.64 ± 0.14 | GACGUAAACGGCCACAAGU |
| W050 | SS | ALN | 0.12 ± 0.02 | 0.68 ± 0.15 | GA |
| W060 | SS | HM | 0.10 ± 0.01 | 0.70 ± 0.11 | GACGUAAACGGCCACAAGUU |
| W069 | SS | ADA/LNA | 0.15 ± 0.02 | 0.93 ± 0.27 | GACG |
| W129 | SS | UNA/LNA | 0.20 ± 0.04 | 0.79 ± 0.22 | GACG |
| W130 | SS | UNA/LNA | 0.40 ± 0.05 | 0.78 ± 0.18 | GACGUAAAC |
| W131 | SS | UNA | 0.11 ± 0.02 | 0.58 ± 0.16 | GACGUAAACGGCCACAAGUU |
| W132 | SS | UNA | 0.13 ± 0.02 | 0.59 ± 0.11 | GACG |
| W181 | SS | LNA | 0.14 ± 0.02 | 0.65 ± 0.18 | GA |
| W194 | SS | LNA | 0.13 ± 0.03 | 0.45 ± 0.17 | GACGUAAACGGCCACAAGU |
| W207 | SS | 0.14 ± 0.02 | 0.43 ± 0.09 | GACGUAAACGGCCACAAGUUC |
The name, type of chemical modification, eGFP levels, viability and sequence of the investigated ASs and SSs are given. The following modification abbreviations are used: 2′-O-methyl (OMe), 2′-fluoro (F), 2′-deoxy (DNA), 2′-aminoethoxymethyl (AEM), 2′-aminopropoxymethyl (APM), 2′-aminoethyl (EA), 2′-aminopropyl (AP), 2′-cyanoethyl (CE), 2′-guanidinoethyl (GE), 4′-C-hydroxymethyl-DNA (HM), locked nucleic acid (LNA), alfa-L-LNA (ALN), 2′-N-adamant-1-ylmethylcarbonyl-2′-amino-LNA (ADA), 2′-N-pyren-1-ylmethyl-2′-amino-LNA (PYR), oxetane-LNA (OX), 2′,4′-carbocyclic-ENA-LNA (CENA), 2′,4′-carbocyclic-LNA-locked nucleic acid (CLNA), unlocked nucleic acid (UNA), altritol nucleic acid (ANA) 2′-deoxy-2′-N,4′-C-ethylene-LNA (AENA) and hexitol nucleic acid (HNA). The position of the modification is shown in bold in the oligo sequence.
aeGFP levels and viability is given for the particular strand in combination with an unmodified opposing strand (SS=W207, AS=W053). eGFP levels were normalized to cells transfected with siEGFP mismatch control (Dharmacon, Dharmacon, Inc.) and viability was normalized to cells treated with transfection reagent alone.
bThe JW1104 SS is not included in the large-scale siRNA screen but in subsequent analysis only.
Figure 2.Silencing activity of chemically modified SSs and ASs. HeLa-eGFP were transfected with the indicated siRNAs (10 nM concentration) and eGFP levels were evaluated 72 h post-transfection. (a) Silencing activity of modified SSs in combination with the unmodified AS, W053. (b) Silencing activity of modified ASs in combination with the unmodified SS, W207. Colour-code: 2′-OH substituted oligos (blue), 4′-modified oligos (pink), 2′-locked oligos (green) and ribose ring modified oligos (orange).
Highly efficient siRNA duplexes
| AS | SS | eGFP levels | Viability | Rank |
|---|---|---|---|---|
| JW1186 | W043 | 0.06 ± 0.01 | 0.62 ± 0.12 | 1 |
| W123 | W131 | 0.06 ± 0.02 | 1.05 ± 0.08 | 2 |
| JW1186 | W131 | 0.06 ± 0.01 | 0.66 ± 0.20 | 3 |
| JC-S1 | DO003 | 0.06 ± 0.01 | 0.65 ± 0.13 | 4 |
| W123 | W043 | 0.06 ± 0.01 | 0.89 ± 0.20 | 5 |
| GS2372 | GS2383 | 0.06 ± 0.01 | 0.60 ± 0.15 | 6 |
| JC-F1 | W131 | 0.07 ± 0.01 | 0.64 ± 0.17 | 7 |
| W123 | JW1189 | 0.07 ± 0.01 | 0.92 ± 0.25 | 8 |
| GS2372 | DO003 | 0.07 ± 0.01 | 0.47 ± 0.14 | 9 |
| JC-S1 | JC1 | 0.07 ± 0.01 | 0.62 ± 0.13 | 10 |
| Dharmacon – | – | 1.00 ± 0.07 | 0.78 ± 0.10 | – |
| Mock | – | 1.09 ± 0.04 | 1.00 ± 0.15 | – |
| W006 | W004+W179 | 0.09 ± 0.01 | 0.57 ± 0.16 | 35 |
| JW1186 | W004+W179 | 0.12 ± 0.02 | 0.90 ± 0.10 | 238 |
| W123 | W037 | 0.13 ± 0.02 | 1.01 ± 0.18 | 276 |
| W006 | W037 | 0.13 ± 0.02 | 0.65 ± 0.20 | 326 |
| JC10 | W004+W179 | 0.32 ± 0.06 | 0.88 ± 0.11 | 983 |
| W010 | W004+W179 | 0.34 ± 0.07 | 0.46 ± 0.27 | 1028 |
Relative silencing activity (eGFP levels), viability (# nuclei) and activity ranking of the most efficient siRNA duplexes. Upper panel: top 10 performing siRNA duplexes. Lower panel: selected siRNAs with high activity and LNA modifications in the SS for enhanced serum stability. The unmodified siRNA (W053-W207) is highlighted in bold.
Highly efficient SSs and ASs
| Strand name | AS/ SS | Sequence (5′–3′) | Percentage in HE siRNAs/ top 3 siRNAs | # impr. ASs/ avr. impr. (%) | Remark |
|---|---|---|---|---|---|
| DO003 | SS | GACGUAAACGGCCACA | 7/15 | 23/27 | Destabilized 3′-end favours AS selection |
| JC1 | SS | GACGUAAACGGCCAC | 7/10 | 22/25 | Destabilized 3′-end favours AS selection |
| W043 | SS | GACGUAAACGGCCACAAGU | 6/13 | 25/17 | Disfavoured 3′-overhang favours AS selection |
| W131 | SS | GACGUAAACGGCCACAAGUU | 7/11 | 21/13 | Disfavoured 3′-overhang favours AS selection |
| GS2383 | SS | GACGUAAACGGCCACAAG | 6/7 | 17/26 | Disfavoured 3′-overhang favours AS selection |
| JW1189 | SS | GACG | 6/5 | 14/21 | Disfavoured 3′-overhang favours AS selection |
| W004+W179 | SS | GA | 2/4 | 4/115 | Stabilizing SS for highly modified ASs |
| W006 | AS | ACUUGUGGCCGUUUACGUC | 24/– | – | HE ASs, favoured 5′-overhang |
| JE1001 | AS | ACUUGUGGCCGUUUACGUC | 15/– | – | HE ASs, favoured 5′-overhang |
| W123 | AS | ACUUG | 13/– | – | HE ASs, favoured 5′-overhang |
| GS2372 | AS | ACUUGUGGCCGUUUACGUC | 9/– | – | HE ASs, favoured 5′-overhang |
| JC-S1 | AS | AC | 9/– | – | HE ASs, thermodynamically asymmetric |
| W047 | AS | ACUUGUGGCCGUUUACGUCG | 9/– | – | HE ASs, favoured 5′-overhang |
| JW1186 | AS | ACUUG | 8/– | – | HE ASs, favoured 5′-overhang |
| JC-F1 | AS | AC | 7/– | – | HE ASs, thermodynamically asymmetric |
The name, sequence, statistical performance and remarks are given for the most efficient SSs and ASs. ‘Percentage in HE siRNA’ refers to the percentage of the 134 HE siRNAs containing the particular AS/SS. ‘Percentage in top 3 siRNAs’ refers to the summed representation of the particular SS among the three most efficient SSs for each AS (in %). ‘#impr. ASs/avr. improvement’ refers to the number and average improvement (%) of ASs whose activity is significantly enhanced by the particular SS as compared with the unmodified SS (W207). Modifications are highlighted in bold in the sequences.
Figure 3.Optimal SSs enhance the activity of ASs. Relative eGFP expression of HeLa-eGFP cells transfected with all investigated ASs (X-axis, ASs name given in bold) in combination with all 45 SSs (represented by grey dots) or with selected SSs (coloured triangles/lines). The activity of most ASs in combination with the unmodified SS, W207 (represented by black triangles/line) can be enhanced in combination with a specific, optimal SS for each AS (red triangles/line; name of the particular optimal SS for each AS is underlined). Furthermore the activity of many ASs is enhanced by the thermodynamically asymmetric SSs, DO003 (dark green triangles) and JC1 (orange triangles), as well as the 3′-overhang modified SSs, W043 (dark blue triangles) and W131 (light blue triangles). In contrast, the thermodynamically asymmetric SS, JC2, decreases the activity of many ASs (purple triangles).
Figure 4.Improvement of siRNA performance by introduction of additional thermodynamic asymmetry and modification of 3′-overhangs. (a) The performance of ASs (exemplified by the representative ASs DO1001 and JC-S3) can be modified by altering the overall thermodynamic profile of the siRNA duplex by introduction of chemical modification in the SS. (b) The siRNA activity is influenced by the nature of the AS and SS 3′-overhangs. ASs modified in the 3′-overhang by LNA, UNA and HM have significantly lower activity than unmodified and LNA-modified AS in combination with the RNA SS (blue). This loss of activity can be partly rescued by using SSs with the disfavoured overhangs LNA, UNA or HM. (c) The LNA-LNA-RNA motif is a favoured 3′-overhang motif. The silencing activity of both the AS (on the AS-target, blue) and SS (on the S-target, red) is shown for the unmodified, HM-, UNA- and LNA-modified ASs in combination with unmodified and LNA-modified SSs. (d) Overview of the luciferase reporters used to evaluate the silencing activity of both the AS (denoted ‘AS-target’) and SS (denoted ‘SS-target’).
Figure 5.Enhancing serum stability of siRNAs with minor loss of activity. (a) The biostability of modified siRNAs was evaluated by incubation in 80% FBS. While a low level of chemical modification results in only modest increase in stability (left panel), more extensive and full substitutions result in dramatically improved siRNA stability (right panel). The incubation time is given in hours (h). (b) The eGFP levels of cells transfected with modified ASs paired with either unmodified SS (W207), LNA-modified segmented SS (W004+W179), fully OMe/F substituted SS (JC5) and LNA-modified SS (W037) are given. The segmented LNA-modified SS (W004+W179) generally prevented the loss in activity imposed by the LNA-modified unsegmented SS (W037).
Figure 6.Identification of highly efficient siRNAs with low toxicity. Scatter plot showing target cell viability versus eGFP expression (siRNA activity) for all tested siRNAs (grey dots) and for selected ASs in combination with all 45 SS (coloured dots). Silencing activity correlates with toxicity for most siRNAs. The highly active, unmodified (W053, yellow triangles), HNA- (GS2538, red triangles) and LNA- (W006, purple triangles) modified ASs have high activity and poor viability, whereas heavily LNA- (W209, light brown triangles) and OME- (W106, light blue triangles) modified ASs have poor activity, but high viability. In contrast, the UNA- (W123, green triangles) and HM- (JW1186, dark blue triangles) modified ASs have both high activity and viability.