Literature DB >> 18803876

Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples.

Edel O'Regan1, Evonne McCabe, Catherine Burgess, Sheila McGuinness, Thomas Barry, Geraldine Duffy, Paul Whyte, Séamus Fanning.   

Abstract

BACKGROUND: A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW) overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS) for 6 hours and subsequent DNA extraction.
RESULTS: The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method.
CONCLUSION: Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18803876      PMCID: PMC2564954          DOI: 10.1186/1471-2180-8-156

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Contaminated poultry products are widely accepted as a major source of Salmonella infections [1]. The annual cost of medical treatment for salmonellosis, in addition to loss of productivity, imposes a significant financial burden on many countries. At present more than 2,500 serotypes of Salmonella are known. Serotypes Enteritidis and Typhimurium accounted for the majority of cases of human salmonellosis in Ireland in 2006 [2]. A report on Zoonoses in Ireland in 2004 shows that of the 7,616 raw poultry meats sampled at processing level, 245 (3.2%) were positive for Salmonella with the most common serotypes isolated being Enteritidis, Kentucky, Bredeney and Mbandaka [3]. The results of the European baseline survey on the prevalence of Salmonella in broiler flocks in 2005–2006 indicated 27.9% positive flocks in Ireland, compared to 23.7% in the EU overall [4]. While the prevalence of Salmonella in egg-laying flocks was 1.4% in Ireland according to the European baseline study, compared to 30.7% in the EU overall [5]. Currently, international guidelines and regulations for the detection of Salmonella sp. in foods are based on traditional cultural methods, which takes at least 5 days for confirmation of results [6]. More recently attention has focused on molecular based methods due to their sensitivity, specificity and reduced assay time. Conventional PCR based assays for Salmonella detection in foods have been widely reported [7-10]. Additionally real-time PCR assays for the specific detection of Salmonella are increasingly documented [11-19]. Both of these methods for detection of Salmonella in foods have been brought to inter-laboratory trial, the results of which support their use as international standard methods [20,21]. Real-time multiplex PCR assays for simultaneous detection of two or more genera in foods e.g. Salmonella and Campylobacter in chicken rinse fluid [22] and Salmonella and Listeria in raw sausage meat [23,24] have been described. The invA gene target is most commonly used for the detection of Salmonella in PCR assays, however gene targets such as ttrRSBCA, sipBC and stn have been used as well [10-15,17-23]. A duplex real-time PCR assay for the detection of Salmonella Enteritidis in poultry meat and consumption eggs has been developed with primers and TaqMan probes based on the Salmonella specific invA gene and the prot6e gene located on the S. Enteritidis specific 60 kb virulence plasmid [24]. To date, conventional multiplex PCRs for serotyping in clinical isolates have been described using the rfb locus and flagellar alleles as gene targets, however they have not been tested on food samples [25-27]. Rapid pathogen testing is vital to the food industry and facilitates increased public health protection. Real-time PCR methodology reduces the reporting time of results compared to the traditional microbiology method. These methods can prove advantageous to food manufacturing companies by preventing costly and damaging product recalls, as most food products are not held in warehouses pending test results. In this paper we report the development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples and assess its equivalence with the traditional cultural method, ISO 6579 (2002). The multiplex real-time PCR assay comprises four targets, aceK, which is Salmonella sp. specific and three other targets that are Salmonella serotype specific; sefA specific for serotypes Enteritidis, Dublin and Gallinarum:sdf target specific for Salmonella Enteritidis only and fliC target specific for serotypes Typhimurium and Kentucky.

Methods

Bacterial strains used in this study

Sixty Salmonella strains and thirty non-Salmonella strains used in the selectivity testing in this study are listed in Tables 1 and 2, respectively. Salmonella Enteritidis ATCC 13076, Salmonella Typhimurium ATCC 14028, Salmonella Kentucky NCTC 05799 and Salmonella Bredeney NCTC 05731 were used to artificially contaminate chicken samples. These serotypes were chosen for artificial inoculation experiments because they have been associated with poultry-related outbreaks of gastroenteritis in Ireland [28,29].
Table 1

Salmonella strains used in the selectivity testing of real-time multiplex PCR assay and traditional cultural method. CT values are given in parentheses.

Salmonella serotypesISO 6579Real-time multiplex PCR
aceKfliCsefAsdf
Agona+a+ (23.31)-b--
Anatum++ (21.67)---
Braenderup++ (21.24)---
Bredeney++ (21.71)---
Derby++ (22.79)---
Dublin (n = 7)c++ (17.63)-+ (19.35)-
Enteritidis (n = 11)++ (21.35)-+ (23.36)+ (23.67)
Gallinarum (n = 3)++ (26.87)-+ (27.83)-
Goldcoast++ (24.35)---
Hadar++ (19.68)---
Heidelberg++ (21.12)---
Infantis++ (23.34)---
Kentucky (n = 8)++ (18.59)+ (21.65)--
Livingstone++ (21.90)---
London++ (19.92)---
Manhattan++ (17.53)---
Newport++ (18.04)---
Nottingham++ (21.89)---
Panama++ (19.54)---
Saintpaul++ (21.06)---
Senftenberg++ (21.01)---
Stanley++ (19.23)---
Typhimurium (n = 10)++ (19.77)+ (22.45)--
Uganda++ (20.21)---
Virchow++ (22.52)---
Gaminara++ (21.03)---

a + = Salmonella positive by the method.

b – = Salmonella negative by the method.

c = Mean CT values are given when n > 1.

Table 2

Non-Salmonella strains used in the selectivity testing of the real-time multiplex PCR assay and traditional cultural method.

Non-Salmonella StrainsType Strain Number
E. coliATCC 25922
E. coliNCTC 09001
E. coliNDC 544
C. freundiNCTC 09750
C. freundiNCTC 8090
C. diversusCCFRA 7119
C. koseriNCTC 10768
E. cloacaeNCTC 11933
E. cloacaeNCTC 10005
E. agglomeransNCTC 09381
E. intermediusNDC 427
E. aerogenesNCTC 10006
E. sakazakiiNCTC 11467
E. faeciumATCC 35667
E. faecalisNCTC 12697
B. cereusNCTC 07464
K. oxytocaATCC 43086
K. pneumoniaeATCC 13883
P. aeruginosaNCTC 12903
P. putidaATCC 49128
L. planatarumATCC 8014
S. haemolyticusATCC 29970
S. epidermisUnknown
S. saprophyticusATCC 15305
S. lactisNCDO 2003
A. hydrophiliaATCC 35654
A. globiformisATCC 8010
L. mesenteroidesATCC 8293
A. calcoaceticusATCC 23055
P. mirabilisDSM 4479
Salmonella strains used in the selectivity testing of real-time multiplex PCR assay and traditional cultural method. CT values are given in parentheses. a + = Salmonella positive by the method. b – = Salmonella negative by the method. c = Mean CT values are given when n > 1. Non-Salmonella strains used in the selectivity testing of the real-time multiplex PCR assay and traditional cultural method.

Traditional cultural method and real-time multiplex PCR assay

All Salmonella, non-Salmonella strains and chicken samples used in this study were tested for Salmonella by the ISO 6579:2002 European International Standard Method [6] (Figure 1). Biochemical testing was performed using api20E test strips (bioMerieux, Marcy l'Etoile, France). Serotyping was performed according to the Kauffmann-Whyte typing scheme using slide agglutination with standard antisera (Murex, Dublin, Ireland). The real-time multiplex PCR method comprised an 18 h pre-enrichment in buffered peptone water (BPW CM1049, Oxoid, Basingstoke, UK) at 37°C, followed by 6 h incubation in Rappaport-Vassiliadis Soya (RVS) Peptone Broth (CM0866, Oxoid) at 41.5°C, with subsequent DNA extraction (Figure 1).
Figure 1

Flow diagram of methodology in the traditional cultural method and the real-time multiplex PCR assay.

Flow diagram of methodology in the traditional cultural method and the real-time multiplex PCR assay.

Sample DNA Extraction for real-time multiplex PCR assay

DNA was extracted from pure cultures of bacteria and chicken samples that had been enriched at 37°C for 18 h in BPW and at 41.5°C for 6 h in RVS. One ml of the RVS broth was collected in an eppendorf tube, centrifuged at 15,339 × g for 5 min and the supernatant discarded. The cell pellets were resuspended in 1 ml phosphate buffered saline (PBS, Oxoid), centrifuged at 15,339 × g for 5 min and the supernatant discarded. DNA extractions were performed on the cell pellet using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. DNA preparations were stored at -20°C until use.

Primers and probes used in real-time multiplex PCR assay

The design of the primers was based on the multiple alignment of Salmonella and non-Salmonella sequences of the individual genes using MegAlign Lasergene software (DNAstar, Madison WI, USA). Sequences were taken from GenBank accession numbers in the literature and nucleotide entries on NCBI website . The gene targets used for primer design and for the real-time multiplex PCR assay and the Salmonella serotypes they detect are included in Figure 2. Four primer pairs were designed using Primer Select DNAStar Lasergene software. The specificity of the primer sequences was tested by homology searches in the nucleotide database (NCBI, nucleotide BLAST (blastn)). TIB Molbiol (Berlin, Germany) designed the TaqMan probes and the probes were labeled with reporter dyes FAM (aceK), YAK (fliC), ROX (sefA) and Cy5 (sdf). Primers and probes were purchased from TIB Molbiol and their sequences are presented in Table 3.
Figure 2

Gene targets used in real-time multiplex PCR assay and the Salmonella serotypes they detect.

Table 3

Oligonucleotide primers and probes used in real-time multiplex PCR assay.

Target genePrimer or ProbeSequence (5'-3')Tm (°C)Amplicon Size (bp)Reference or Accession No.
sefAForwardGTGGTTCAGGCAGCAGTTACT61.1334L11008
ReverseCAGGGACATTTAGCGTTTCTTGAG59.7
ProbeROX-CAGCTCAGAATACAACATCAGCCAACTGG-BBQ66.2
fliCForwardCCCCGCTTACAGGTGGACTAC60.2433AY649721
ReverseAGCGGGTTTTCGGTGGTTGT63.6
ProbeYAK-TAAAGCCGCATTGACAGCAGCAGGTG-BBQ69.8
aceKForwardCCGCGCTGGTTGAGTGG62.0240U43344
ReverseGCGGGGCGAATTTGTCTTTA60.3
ProbeFAM-AACCACTGCCGAACTGTATATGGCGA-BBQ65.0
sdfForwardAAATGTGTTTTATCTGATGCAAGAGG57.6299[35]
ReverseGTTCGTTCTTCTGGTACTTACGATGAC58.7
ProbeCy5-CGAATGGTGAGCAGACAACAGGCTGATTTA-BBQ68.4This study
Gene targets used in real-time multiplex PCR assay and the Salmonella serotypes they detect. Oligonucleotide primers and probes used in real-time multiplex PCR assay.

Real-Time Multiplex PCR assay

Real-time multiplex PCR reactions were performed with the Rotor Gene 3000 (Corbett Research, Australia) using a total volume of 25 μl, which was contained within a 0.2 ml thin-walled PCR tube. The optimal amplification reaction mixture contained 12.5 μl 2 × QuantiTect Multiplex PCR No ROX mastermix (Qiagen) containing HotStar Taq polymerase, QuantiTect multiplex PCR buffer, dNTP mix including dUTP and 11 mM MgCl2, a final concentration of 0.4 μM for each primer and probe, 4.5 μl sterile RNase-free water and 2 μl of test or control DNA. Each real-time PCR assay systematically included six control reactions performed in parallel with the test samples. These positive and negative controls used as template, genomic DNA of five Salmonella strains or water respectively. Incubation conditions consisted of an initial denaturation at 95°C for 15 min; followed by 35 cycles of 94°C for 60 sec and 60°C for 90 sec. Fluorescence signals were detected in FAM, YAK, ROX and Cy5 channels. The Rotor Gene 3000 analyzer is capable of detecting four dyes simultaneously in a multiplex assay. The line for calculating the threshold cycle number (CT) for each channel was assigned to a fixed value intersecting the amplification curves in the linear region of the logarithmic plot. Any sample showing a fluorescence signal above this line was regarded as positive. Each PCR reaction gave a positive or negative result at this threshold line. Samples with CT values of less than 35 cycles were considered as positive from preliminary optimization experiments.

Selectivity testing

Sixty Salmonella strains (10 CFU/ml) and thirty non-Salmonella (1,000 CFU/ml) strains were tested by both the traditional cultural method and real-time multiplex PCR assay. The strains were cultured in 10 ml BPW at 37°C for 18 h prior to decimal dilution in Maximum Recovery Diluent (MRD CM0733, Oxoid) to obtain the required inoculation level. One ml of this dilution was then transferred to 9 ml BPW at 37°C for 18 h and a 0.1 ml aliquot of this was added to 10 ml RVS broth at 41.5°C for 6 h. One ml of the RVS broth was then collected in an eppendorf tube for DNA extraction as previously described and subsequent real-time multiplex PCR. A 2 μl aliquot of the DNA extract was used as template in the real-time multiplex PCR assay.

Artificial contamination of chicken skin and chicken meat

Pre-packed whole chickens were purchased from local supermarkets and were tested for the presence of Salmonella sp. by enrichment of 25 g chicken skin and chicken meat in 225 ml BPW (Oxoid) at 37°C for 18 h, and subsequent plating on Xylose Lysine Desoxycholate agar (XLD CM0469, Oxoid) at 37°C for 18 h. As no Salmonella sp. was detected, the chicken was used for subsequent artificial contamination experiments. Chicken skin and chicken meat samples (25 g portions) were artificially contaminated individually with four Salmonella serotypes (Enteritidis ATCC 13076, Typhimurium ATCC 14028, Kentucky NCTC 05799 and Bredeney NCTC 05731) at four levels of contamination (0, 1–10, 10–100, 100–1,000 CFU/25 g). The four strains were cultured in 10 ml BPW at 37°C for 18 h prior to decimal dilution in MRD (Oxoid) to obtain the four different levels of contamination. Twenty-five gram portions of chicken samples were inoculated with 1 ml of each level of inoculation, placed in stomacher bags and 225 ml of BPW was added. The mixture was homogenized in a stomacher (Seward, London, United Kingdom) for 1 min and immediately incubated at 37°C for 18 h. The precise numbers of CFU introduced into the chicken skin and chicken meat was determined by plating each level of inoculation on Tryptone Soya Agar plates (TSA CM0131, Oxoid), followed by incubation at 37°C for 24 h. After pre-enrichment in BPW, the cultures were subdivided into two aliquots of RVS broth: one for analysis by the traditional culture method and the second for the real-time multiplex PCR assay. A total of thirty-two chicken skin and chicken meat samples, were analyzed in triplicate by both the ISO 6579 and real-time multiplex PCR methods.

Naturally contaminated chicken skin samples

A total of sixty-three 25 g chicken skin samples from naturally contaminated whole chickens, crowns, legs and breasts were obtained from local butchers in the Dublin area. All samples were tested for Salmonella by both the ISO 6579 method and real-time multiplex PCR assay.

Blind testing of cultures

Thirty cultures on solid media were received for blind testing from a collaborating group to assess the real-time multiplex PCR assay. One ml of an overnight BPW culture of the blind samples was transferred to 9 ml BPW at 37°C for 18 h and a 0.1 ml aliquot was added to 10 ml RVS broth at 41.5°C for 6 h. One ml of the RVS broth was then collected in an eppendorf tube for DNA extraction as described previously and subsequent real-time mutiplex PCR.

Statistical analysis and terms used

Relative sensitivity, specificity and accuracy were calculated according to the MICROVAL protocol [30]. The formulas used for the analysis were: (1) Relative accuracy: (2) Relative specificity: (3) Relative sensitivity: [ Where; PA is the positive agreement between culture and PCR methods; NA is the negative agreement between culture and PCR methods; PD are the false positives by PCR method; ND are the false negatives by PCR method; N is the total number of samples (NA+PA+PD+ND); N- is the total number of negative results with the reference method (NA+PD) and N+ is the total number of positive results with the reference method (PA+ND)]. Relative sensitivity is the ability of the alternative method (real-time multiplex PCR) to detect the analyte when it is detected by the reference method (traditional culture method ISO 6579) in the presence of a biological matrix. Relative specificity is the ability of the real-time multiplex PCR to not detect the target organism when it is not detected by the reference method. The relative accuracy is the degree of correspondence between the response obtained by the alternative method and the reference method on identical samples [30].

Results

Selectivity study

The sixty Salmonella strains were confirmed as Salmonella positive by the traditional cultural method. These strains, comprising 26 different Salmonella serotypes, all demonstrated positive results for the aceK target in the real-time multiplex PCR assay (Table 1). Testing of the fliC serotype specific target yielded positive results for serotypes Typhimurium and Kentucky only and negative results for all other Salmonella serotypes tested. The sefA serotype specific target was positive for serotypes Enteritidis, Dublin, and Gallinarum and gave negative results for all other Salmonella serotypes. The sdf serotype specific target was specific for all Salmonella Enteritidis strains only and was not amplified in the other Salmonella serotypes tested. The thirty pure culture non-Salmonella strains listed in Table 2 yielded negative results by the traditional cultural method. The non-Salmonella strains also yielded negative results by the four gene targets aceK, sefA, sdf and fliC in the real-time multiplex PCR assay. The selectivity study verified that only Salmonella strains were detected by both methods and that the gene targets sdf, sefA and fliC also correctly identified the serotype where appropriate. The selectivity study also confirmed that no cross reactivity ocurred with the non-Salmonella strains tested.

Detection of Salmonella in artificially contaminated samples

All artificially contaminated chicken samples tested positive for Salmonella by both the traditional cultural method and real-time multiplex PCR and all un-inoculated control samples tested negative by both methods (Table 4). The Salmonella-positive chicken samples were identified correctly at the serotype level by the real-time multiplex PCR assay. Mean CT values obtained by the detection channels ranged from 19 to 28 cycles. The CT values given cannot be used for quantitative interpretations because of the enrichment of each sample before the real-time multiplex PCR assay. The results from the artificially contaminated samples indicated that both methods are sensitive and able to detect to a level as low as 1–10 CFU of Salmonella in 25 g of chicken skin and chicken meat. The results from the multiplex real-time PCR assay were in complete agreement with the ISO 6579 method in three independent artificial inoculation experiments.
Table 4

Results of the real-time multiplex PCR assay compared to the traditional cultural method for the detection of Salmonella from artificially contaminated chicken skin and chicken meat samples

Food TypeSalmonella serotypeEstimated CFU by platingISO 6579Real-time multiplex PCR
aceKfliCsefAsdf
Chicken skinEnteritidis0-a----
3+b+ (28.14)-+ (27.70)+ (26.99)
32++ (24.94)-+ (25.15)+ (24.51)
168++ (22.52)-+ (22.32)+ (21.68)
Chicken meatEnteritidis0-----
5++ (20.58)-+ (20.09)+ (19.88)
36++ (20.20)-+ (19.96)+ (19.57)
222++ (19.67)-+ (19.67)+ (19.05)
Chicken skinTyphimurium0-----
3++ (24.12)+ (23.46)--
34++ (22.18)+ (21.00)--
257++ (21.95)+ (19.57)--
Chicken meatTyphimurium0-----
7++ (23.19)+ (22.75)--
54++ (21.39)+ (21.19)--
305++ (20.84)+ (20.42)--
Chicken skinKentucky0-----
6++ (26.28)+ (25.94)--
48++ (24.25)+ (23.70)--
280++ (22.12)+ (21.41)--
Chicken meatKentucky0-----
5++ (23.55)+ (22.33)--
52++ (21.15)+ (19.93)--
277++ (20.57)+ (19.49)--
Chicken skinBredeney0-----
6++ (22.46)---
60++ (21.58)---
397++ (22.00)---
Chicken meatBredeney0-----
9++ (22.37)---
75++ (21.69)---
338++ (22.23)---

CT values, in parentheses, are means of triplicates at a fixed threshold.

a – = Salmonella negative by the method.

b + = Salmonella positive by the method

Results of the real-time multiplex PCR assay compared to the traditional cultural method for the detection of Salmonella from artificially contaminated chicken skin and chicken meat samples CT values, in parentheses, are means of triplicates at a fixed threshold. a – = Salmonella negative by the method. b + = Salmonella positive by the method

Detection of Salmonella in naturally contaminated samples

Fifteen of the sixty-three naturally contaminated chicken skin samples were Salmonella positive by both methods (PA) and all fifteen samples were identified as either serotypes Typhimurium or Kentucky by the real-time multiplex PCR (Table 5). Fourty-one of the sixty three samples yielded negative results for Salmonella by both methods (NA). One sample was Salmonella-positive by the traditional cultural method and Salmonella negative by the real-time multiplex PCR (ND). Six samples were positive for Salmonella by real-time multiplex PCR and negative by the traditional cultural method (PD). Of these six samples positive for Salmonella only by real-time multiplex PCR, four were identified to the serotype level as Typhimurium or Kentucky as positive signals were detected in the YAK channel as well as the FAM channel. Mean CT values obtained by the detection channels ranged from 19 to 32 cycles. The CT values given cannot be used for quantitative interpretations because of the enrichment of each sample before real-time PCR. Relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively.
Table 5

Results of the traditional cultural method and real-time multiplex PCR assay for Salmonella detection from naturally contaminated chicken skin samples.

ISO 6579
+a-b
Real-time Multiplex+156c
PCR-141

a + = Salmonella positive by the method.

b – = Salmonella negative by the method.

c = Four of these samples were identified at the serotype level as Typhimurium or Kentucky.

Results of the traditional cultural method and real-time multiplex PCR assay for Salmonella detection from naturally contaminated chicken skin samples. a + = Salmonella positive by the method. b – = Salmonella negative by the method. c = Four of these samples were identified at the serotype level as Typhimurium or Kentucky.

Detection of Salmonella in blind samples

As part of the blind testing, there was a discrepancy in results with one of the blind samples (BS11) which was identified correctly by the real-time multiplex PCR (Table 6). BS11 was identified as Salmonella-positive in the FAM channel of the real-time multiplex PCR assay and confirmed by biochemical and serology testing. However the colloborating group reported that it was a non-Salmonella isolate.
Table 6

Results of the real-time multiplex PCR assay for the detection of Salmonella from blind culture samples compared to the reported identification from another laboratory.

Lab. IDReal-time multiplex PCRReal-time Multiplex PCR ResultReported Identification by other lab
aceKfliCsefAsdf
BS1+a (23.94)-b--SalmonellaGaminara
BS2+ (24.01)c-+(23.01)-Gallinarum/DublinDublin
BS3----NDdNon-Salmonella
BS4+ (24.16)---SalmonellaBranderup
BS5+ (24.77)---SalmonellaManhattan
BS6+ (23.89)---SalmonellaNottingham
BS7----NDNon-Salmonella
BS8+ (25.36)---SalmonellaAnatum
BS9+ (22.93)---SalmonellaSanDiego
BS10+ (24.02)+ (20.40)--Typhimurium/KentuckyKentucky
BS11e+ (23.10)---SalmonellaNon-Salmonella
BS12+ (23.78)---SalmonellaLondon
BS13+ (24.67)---SalmonellaVirchow
BS14+ (24.79)---SalmonellaLivingstone
BS15----NDNon-Salmonella
BS16+ (22.90)---SalmonellaDerby
BS17----NDNon-Salmonella
BS18+ (23.42)-+ (22.03)-GallinarumGallinarum
BS19+ (24.33)---SalmonellaSaintpaul
BS20+ (25.45)---SalmonellaAgona
BS21----NDNon-Salmonella
BS22+ (23.04)+ (20.55)--Typhimurium/KentuckyTyphimurium
BS23+ (22.59)+ (20.03)--Typhimurium/KentuckyTyphimurium
BS24+ (23.59)---SalmonellaHadar
BS25+ (23.49)---SalmonellaHeidelberg
BS26+ (23.12)---SalmonellaNewport
BS27+ (23.73)+ (22.68)--Typhimurium/KentuckyTyphimurium
BS28+ (23.96)---SalmonellaReading
BS29+ (22.56)+ (21.35)--Typhimurium/KentuckyTyphimurium
BS30+ (22.79)---SalmonellaInfantis

a + = Salmonella positive by method.

b – = Salmonella negative by method.

c = CT values in parentheses.

d ND = Salmonella not detected.

e = BS11 was identified as Salmonella-positive by aceK target and confirmed by biochemical and serology testing, while the another laboratory reported that it was a non-Salmonella isolate.

Results of the real-time multiplex PCR assay for the detection of Salmonella from blind culture samples compared to the reported identification from another laboratory. a + = Salmonella positive by method. b – = Salmonella negative by method. c = CT values in parentheses. d ND = Salmonella not detected. e = BS11 was identified as Salmonella-positive by aceK target and confirmed by biochemical and serology testing, while the another laboratory reported that it was a non-Salmonella isolate.

Discussion

The aim of this study was to develop a rapid detection method for multiple Salmonella serotypes based on real-time multiplex PCR and to compare it to the traditional cultural method. The detection method contained a two-step enrichment procedure comprising a non-selective and a selective enrichment step to detect Salmonella in chicken samples. The overnight pre-enrichment step was required to increase the number of viable cells and to effectively dilute inhibitory substances present in the sample. The use of the second selective enrichment for 6 hours also dilutes PCR inhibitors possibly derived from the food matrix and suppresses the growth of background flora. This was followed by DNA extraction and real-time multiplex PCR. Potential inhibitory substances in foods, including fats, glycogen, organic and phenolic compounds, can affect the PCR reaction [31-33]. However several techniques can be employed to overcome this problem such as simple dilution of the sample. Methods that use secondary enrichment steps will, in general, be less prone to inhibitory effects from the sample matrix than those performed from a primary culture [32]. For the development of the real-time multiplex PCR assay, primers were designed for four targets, one specific for Salmonella species and the other three targets were serotype specific; detecting serotypes commonly reported in Ireland. The aceK gene was chosen as a target for the detection of Salmonella sp. in the real-time multiplex PCR assay and its specificity was confirmed with at least thirty non-Salmonella strains in this study. The aceK gene encodes a bi-functional regulatory enzyme (isocitrate dehydrogenase kinase/phosphatase, IDH K/P) that catalyzes phosphorylation and dephosphorylation of isocitrate dehydrogenase and thereby controls the flux of isocitrate through the tricarboxylic acid cycle and the glyoxylate bypass [34]. The fliC target is specific for serotypes Typhimurium and Kentucky, which both encode the i-antigen specific phase 1 flagellin and both are poultry-associated serotypes. Further, the i-antigen is also expressed in uncommon serotypes such as Aberdeen, Bergen and Kedougou. The gene target sdf was chosen from the literature, it was identified by subtractive hybridization and is specific for serotype Enteritidis [35]. sdf is chromosomally encoded, yet its function is unknown [35]. Salmonella Enteritidis is most common serotype reported in poultry-associated gastroenteritis outbreaks worldwide [36]. sefA encodes the SEF14 fimbrial antigen and the distribution of SEF14 fimbriae is limited to a subset of group D Salmonella [37]. The sefA target detects serotype Enteritidis, hence it corroborates the results from the sdf target. sefA also detects the poultry-associated serotype Gallinarum. It detects serotype Dublin also, although this serotype is more commonly associated with cattle, it has been found on occasion in poultry samples. The sefA target may also identify infrequent Salmonella serogroup D serotypes such as Rostock, Berta, Pullorum and Seremban. This is the first report wherein these four gene targets were incorporated into a unified real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples. Selectivity testing of both methods yielded 100% inclusivity and 100% exclusivity. The Salmonella strains used for the selectivity testing represented Salmonella serotypes that have been frequently reported in Ireland over the past ten years according to the annual reports on salmonellosis by the Health Protection Surveillance Centre. The non-Salmonella strains chosen for the selectivity testing were representative of food-borne pathogens and found in the same environments as Salmonella. Blind testing of cultures by the real-time multiplex PCR method indicated that the gene targets in the real-time multiplex PCR method correctly identified the thirty blind culture samples. Both methods allowed sensitive detection of Salmonella in artificially contaminated chicken samples, yielding positive results even at the lowest contamination levels tested (1–10 CFU/25 g chicken samples). Data from fifty-six of the sixty-three naturally contaminated chicken skin samples were in agreement by both methods. One of the samples tested positive by traditional culture and negative by real-time multiplex PCR. This may have arisen as a result of dislodgement of the pellet during a washing step with PBS. Six of sixty-three naturally contaminated samples were positive by the real-time multiplex PCR assay and negative by the traditional cultural method. This may be attributable to the fact that target cells may have been injured or died despite the enrichment procedures i.e. were non-culturable but detectable by PCR. Similar to our findings, Schrank et al [38] and Loftstrom et al [39] noted that PCR following enrichment detected more Salmonella in poultry samples compared to conventional culture. Furthermore, it was reported that to be able to distinguish between salmonellae and other bacteria growing on selective solid agar, the number of Salmonella cells must be at least 104 CFU/ml after enrichment in tetrathionate broth (TTB) before they are detectable on selective solid media [40]. This could explain culture negativity in the samples that are PCR positive. Salmonella was detected in the presence of a large background flora in the naturally contaminated chicken skin samples, which was subsequently identified by biochemical testing as E. coli, Enterobacter cloacae, Klebsiella pneumoniae, Citrobacter freundi and Pseudomonas. The use of an internal amplification control (IAC) is becoming mandatory for diagnostic PCR testing of food-borne pathogens as it indicates the presence of DNA polymerase inhibitors, errors caused by PCR components or malfunctions of the thermal cycler [41]. In this real-time multiplex PCR assay the simultaneous detection of Salmonella specific aceK target sequence functions as a surrogate IAC for Salmonella DNA in the sample. However in the event of chicken samples being negative for all four targets in the real-time PCR assay, the possibility remains that inhibitors are present in the extracted DNA leading to a false negative result that cannot be excluded.

Conclusion

This study reports a rapid real-time multiplex PCR assay using four primer sets and four TaqMan probes for the detection of multiple Salmonella serotypes. The assay performed equally as well as the traditional cultural method and facilitated the sensitive detection of Salmonella in artificially contaminated chicken skin and chicken meat samples. However, further experiments should focus on inclusion of a universal IAC into the real-time multiplex PCR assay, automation of the DNA extraction, analysis of a larger number of naturally contaminated samples including additional food types and an inter-laboratory trial. The real-time multiplex PCR assay has the potential to be used in routine diagnostic laboratories when it is necessary to identify the serotype for surveillance studies and as a rapid screening tool in food testing laboratories to quickly identify Salmonella-positive samples.

Authors' contributions

EO'R designed and carried out all the experimental work. EO'R drafted the manuscript. EMcC, CB and SMcG provided some of the bacterial strains used in this study and collaborated on the culture enrichment studies. SF, PW, GD and TB conceived this study. All authors read and approved the final manuscript.
  34 in total

1.  Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method.

Authors:  Burkhard Malorny; Jeffrey Hoorfar; Marta Hugas; Annet Heuvelink; Patrick Fach; Lüppo Ellerbroek; Cornelia Bunge; Christina Dorn; Reiner Helmuth
Journal:  Int J Food Microbiol       Date:  2003-12-31       Impact factor: 5.277

2.  Evaluation of DNA extraction methods for use in combination with SYBR green I real-time PCR to detect Salmonella enterica serotype enteritidis in poultry.

Authors:  Dario De Medici; Luciana Croci; Elisabetta Delibato; Simona Di Pasquale; Emma Filetici; Laura Toti
Journal:  Appl Environ Microbiol       Date:  2003-06       Impact factor: 4.792

3.  Rapid and specific detection of Salmonella spp. in animal feed samples by PCR after culture enrichment.

Authors:  Charlotta Löfström; Rickard Knutsson; Charlotta Engdahl Axelsson; Peter Rådström
Journal:  Appl Environ Microbiol       Date:  2004-01       Impact factor: 4.792

4.  Comparison of phenotypic and genotypic characteristics of Salmonella bredeney associated with a poultry-related outbreak of gastroenteritis in Northern Ireland.

Authors:  John E Moore; Liam Murray; Séamus Fanning; Martin Cormican; Mairéad Daly; Niall Delappe; Brian Morgan; Philip G Murphy
Journal:  J Infect       Date:  2003-07       Impact factor: 6.072

5.  The prevalence and PCR detection of Salmonella contamination in raw poultry.

Authors:  P Whyte; K Mc Gill; J D Collins; E Gormley
Journal:  Vet Microbiol       Date:  2002-10-02       Impact factor: 3.293

6.  Multiplex PCR-based method for identification of common clinical serotypes of Salmonella enterica subsp. enterica.

Authors:  Seonghan Kim; Jonathan G Frye; Jinxin Hu; Paula J Fedorka-Cray; Romesh Gautom; David S Boyle
Journal:  J Clin Microbiol       Date:  2006-08-30       Impact factor: 5.948

7.  The rise and fall of Salmonella Enteritidis in the UK.

Authors:  T A Cogan; T J Humphrey
Journal:  J Appl Microbiol       Date:  2003       Impact factor: 3.772

8.  Identification by subtractive hybridization of sequences specific for Salmonella enterica serovar enteritidis.

Authors:  P G Agron; R L Walker; H Kinde; S J Sawyer; D C Hayes; J Wollard; G L Andersen
Journal:  Appl Environ Microbiol       Date:  2001-11       Impact factor: 4.792

9.  Enrichment and DNA extraction protocols for the simultaneous detection of Salmonella and Listeria monocytogenes in raw sausage meat with multiplex real-time PCR.

Authors:  Xiaowen Wang; Narayanan Jothikumar; Mansel W Griffiths
Journal:  J Food Prot       Date:  2004-01       Impact factor: 2.077

10.  Detection of Salmonella typhimurium in raw meats using in-house prepared monoclonal antibody coated magnetic beads and PCR assay of the fimA gene.

Authors:  Angela N Moreira; Fabricio R Conceição; Rita de Cássia S Conceição; Roberta J Ramos; José B Carvalhal; Odir A Dellagostin; José A G Aleixo
Journal:  J Immunoassay Immunochem       Date:  2008
View more
  17 in total

1.  Spontaneous excision of the Salmonella enterica serovar Enteritidis-specific defective prophage-like element phiSE14.

Authors:  Carlos A Santiviago; Carlos J Blondel; Carolina P Quezada; Cecilia A Silva; Pia M Tobar; Steffen Porwollik; Michael McClelland; Helene L Andrews-Polymenis; Cecilia S Toro; Mercedes Zaldívar; Inés Contreras
Journal:  J Bacteriol       Date:  2010-02-19       Impact factor: 3.490

2.  Cell invasion of poultry-associated Salmonella enterica serovar Enteritidis isolates is associated with pathogenicity, motility and proteins secreted by the type III secretion system.

Authors:  Devendra H Shah; Xiaohui Zhou; Tarek Addwebi; Margaret A Davis; Lisa Orfe; Douglas R Call; Jean Guard; Thomas E Besser
Journal:  Microbiology (Reading)       Date:  2011-02-03       Impact factor: 2.777

3.  Evaluation of the different methods to detect Salmonella in poultry feces samples.

Authors:  Reza Khaltabadi Farahani; Maryam Meskini; Arash Ghalyanchi Langeroudi; Safoora Gharibzadeh; Soumya Ghosh; Amir Hossien Khaltabadi Farahani
Journal:  Arch Microbiol       Date:  2022-04-20       Impact factor: 2.552

4.  Molecular detection of Salmonella isolated from commercial chicken.

Authors:  A Tiwari; M Swamy; P Mishra; Y Verma; A Dubey; N Srivastav
Journal:  Iran J Vet Res       Date:  2022       Impact factor: 1.226

5.  Thermal inactivation of Salmonella Enteritidis on chicken skin previously exposed to acidified Sodium chlorite or tri-sodium phosphate.

Authors:  K Karuppasamy; Ajit S Yadav; Gaurav K Saxena
Journal:  J Food Sci Technol       Date:  2015-06-26       Impact factor: 2.701

6.  Chemically modified primers for improved multiplex polymerase chain reaction.

Authors:  Jonathan Shum; Natasha Paul
Journal:  Anal Biochem       Date:  2009-03-01       Impact factor: 3.365

7.  Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella Enteritidis from poultry and egg samples in Iran.

Authors:  Hassan Bahramianfard; Abdollah Derakhshandeh; Zahra Naziri; Reza Khaltabadi Farahani
Journal:  BMC Vet Res       Date:  2021-05-24       Impact factor: 2.741

8.  Simultaneous detection and differentiation of human papillomavirus genotypes 6, 11, 16 and 18 by AllGlo quadruplex quantitative PCR.

Authors:  Daojun Yu; Yu Chen; Shenghai Wu; Baohong Wang; Yi-Wei Tang; Lanjuan Li
Journal:  PLoS One       Date:  2012-11-09       Impact factor: 3.240

9.  A new protocol to detect multiple foodborne pathogens with PCR dipstick DNA chromatography after a six-hour enrichment culture in a broad-range food pathogen enrichment broth.

Authors:  Masahiro Hayashi; Tatsuya Natori; Sayoko Kubota-Hayashi; Machiko Miyata; Kiyofumi Ohkusu; Keiko Kawamoto; Hisao Kurazono; Souichi Makino; Takayuki Ezaki
Journal:  Biomed Res Int       Date:  2013-12-02       Impact factor: 3.411

10.  A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples.

Authors:  Pengyu Zhu; Chenguang Wang; Kunlun Huang; Yunbo Luo; Wentao Xu
Journal:  Int J Mol Sci       Date:  2016-03-18       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.