Literature DB >> 18565236

Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM.

Shin-Yu Lin1, Yi-Ning Su, Chia-Cheng Hung, Woei Tsay, Shyh-Shin Chiou, Chieh-Ting Chang, Hong-Nerng Ho, Chien-Nan Lee.   

Abstract

BACKGROUND: Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex.
METHODS: We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM), as an alternative screening method.
RESULTS: We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89%) and 15 out of 15 (100%) carriers. The sensitivity was 93 % (40/43). The overall mutation detection rate of hemophilia A was 100% in this study.
CONCLUSION: We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18565236      PMCID: PMC2442058          DOI: 10.1186/1471-2350-9-53

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

Hemophilia represents the most common and severe inherited hemorrhagic disorder. Hemophilia A(HA) is caused by mutations in the F8 gene, leading to a deficiency or dysfunctional III protein, an essential cofactor in the factor X activation complex. The F8 gene is 186 kb long; it has 26 exons and encodes a 9-kb mRNA transcript [1,2]. The mutations causing hemophilia A are spread throughout the gene and are mostly represented by point alterations. However, the inversion of intron 22 was found in 40–50% of patients with severe HA [3] and the inversion of intron 1 was reported with a prevalence of about 5% in the UK [4]. Patients suffering from the disorder, along with their families, bear great financial and social burden; therefore, it is very important to prevent recurrence of the disease. For the sake of genetic counselling and prenatal diagnosis of hemophilia A, it is necessary to establish a sensitive, rapid and economic genetic diagnostic system. However, comprehensive analysis of mutations in the F8 gene is difficult to conduct due to the large gene size, its many scattered exons, and the high frequency of de novo mutation. The most direct strategy for mutation detection would be to amplify these regions from genomic DNA using PCR [5]. However, it would necessitate almost 30 amplifications of genomic DNA to cover all the essential regions. The first systematic analysis of the complete coding sequence of the F8 gene was performed by applying denaturing gradient gel electrophoresis (DGGE) after PCR amplification in 1991. The analysis demonstrated a 90% mutation detection rate [6]. Since then, a wide range of different mutations have been identified, providing the genetic basis for the extensive variability observed in the clinical phenotypes. Mutation detection in the F8 gene is so challenging that it is only partially met by conventional screening methods such as single stranded conformational polymorphism (SSCP), conformational sensitive gel electrophoresis (CSGE) and chemical mismatch cleavage (CMC), each with varying applicability and efficiency; however, they all suffer from incomplete detection rates in the range of 70–85% [7-11]. Moreover, each method places variable demands on the technical skills and time investment of the investigator. In contrast, the recently introduced denaturing high performance liquid chromatography (DHPLC) offers a promising new method for a fast and sensitive analysis(96.2%) of PCR-amplified DNA segment [12-15]. We have established a diagnostic strategy, consisting of screening for most common mutations in the F8 gene, using long-distance polymerase chain reaction (LD-PCR) and DHPLC. We reported the result of detailed screening of 122 Taiwan families with hemophilia A. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM). This alternative screening technique detects sequence variation by the use of a saturating double-stranded DNA dye.

Methods

Patients

This study was approved by the Ethic Institute Review Board of National Taiwan University Hospital and included 122 families, in which 329 samples had hemophilia A family history. We obtained consent from each subject. The patients presented varying degrees of severity of the disease. The mild and moderate hemophilia A was diagnosed following the familial transmission analysis and after the elimination of von Willebrand disease type 2N either by FVIII:vWF binding test or sequencing of exon 18 to 24 of the von Willebrand gene.

DNA extraction

According to the manufacturer's instructions, genomic DNA was extracted from 3 ml of peripheral blood cell samples with a Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN). DNA mutation numbering is based on cDNA sequence and nucleotide +1 corresponds to A of the ATG translation initiation codon. The nomenclature of this study follows the Nomenclature for Description of Genetic Variations approved by the Human Genome Variation Society and differs in 19 amino acids from the reference mutation database because the first 19 amino acids compose a signal peptide.

Mutation identification

The PCR assay for intron 22 inversion

The PCR mixture contained a total volume of 50 μl: 1 mM 10× buffer, 76 mM DMSO, 0.5 mM of dNTP and 0.3 mM deaza-Dgtp(Amershan Biosciences; Freiburg Germany), 0.12 mM of Expand long Template DNA polymerase (Roches) and 0.36 mM each of primer P, Q, 0.06 mM each of primer A, B as described by Qiang Liu et al. [16,17]. Subcycling multiplex long distance PCR(LD-PCR) was carried out as described by Qiang Liu et al. [16,17] with slight modifications in the reaction temperatures. The conditions for LD-PCR for the first 10 cycles were set at 94°C for 12s, followed by four subcycles of annealing/elongation carried out at 62°C for 120s and 65°C for 120s. The remaining 20 cycles were modified by the addition of an extra 5s per cycle for each of the annealing/elongation step. 10 μl of PCR product were mixed with TAE buffer and electrophoresed for one hour on a 0.7% agarose gel, then stained with ethidium bromide and visualized under UV Light.

The PCR assay for intron 1 inversion

The PCR amplification of the F8 intron 1 region and the intron 1 h repeats were performed on 100 ng of genomic DNA, in a reaction volume of 25 μl containing 0.1 mM dNTP, 2 mM MgCl2, 10 mM buffer and 0.5 units Taq polymerase (Perkin Elmer, ABI Foster City, CA). The primers used for the amplification of the F8 intron 1 region were 0.12 mm of 9F, 9CR and int1h-2F each. Primers int1h-2F, int1h-2R and 9F were used for the amplification of intron 1 h repeats as previously described by Tizzano and Banagnall et al. [18,19]. After the initial denaturing step at 95°C for 5 min, thirty cycles of PCR were carried out designated at 94°C for 30s, 65°C for 30s and 72°C for 2 min. Finally, 5 μl of PCR products were mixed with TAE buffer and electrophoresed for one hour on a 0.7% agarose gel, then stained with ethidium bromide and visualized under UV light.

PCR assay and DHPLC for entire coding region

If there was no inversion in intron 1 or intron 22, we perform mutation analysis of the entire F8 coding region, including flanking splicing sites, by DHPLC using appropriate primers (Table 1). The DHPLC allows for the automated detection of single base DNA substitutions as well as small insertions and deletions. When using heteroduplex analysis by DHPLC under partially-denaturing conditions, heteroduplexes are retained less than their corresponding homoduplexes on a unique DNA separation matrix. DHPLC uses unpurified PCR products that are subjected to a final denaturing/reannealing step to ensure adequate formation of the heteroduplex. The cycling parameters of the amplification reactions were optimized for the fragment. Equal volumes of the polymerase chain reaction (PCR) product from the patient and from a wild-type control male were mixed, denatured at 95°C for 5 min and then incubated at 65°C for 30 min to obtain heteroduplexes. Mutational screening, performed on all amplified fragments from each patient, was carried out via denaturing high-performance liquid chromatography (DHPLC) on a Wave® DNA Fragment Analysis System (Transgenomic Inc., San Jose, CA) with a DNASep column (Transgenomic). The DNASep column contains proprietary 2-mm nonporous alkylated poly (styrene divinylbenzene) particles. The DNA molecules eluted from the column are detected by scanning with a UV detector at 260 nm. DHPLC-grade acetonitrile (9017-03; J.T. Baker, Phillipsburg, NJ) and triethylammonium acetate (TEAA; Transgenomic, Crewe, UK) constituted the mobile phase [14,20]. For DHPLC analysis, heterozygous profiles were identified by visual inspection of the chromatograms.
Table 1

Primer pairs and PCR conditions for DHPLC analysis.

HA Primer pairs and PCR conditions for DHPLC analysis
Exon primerSequence (5' to 3')Length of PCR amplicon (bp)Annealing Temp. (°C)DHPLC oven (°C)Elution profile(B%)

1FACATCCAGTGGGTAAAGTTC35653605556–6552–61
1RAGACTTACATCCCCACAATC
2FTTGAAGTGTCCACCAAAATGAACGACT211545948–57
2RGATACCCAATTTCATAAATAGCATTCA
3FGTACTATCCCCAAGTAACCTT204545950–59
3RCATAGAATGACAGGACAATAGG
4FTACAGTGGATATAGAAAGGAC296545754–63
4RTGCTTATTTCATCTCAATCCTACGCTT
5FCCTCCTAGTGACAATTTCCTA188545549–58
5RAGCAGAGGATTTCTTTCAGGAATCCAA
6FCATGAGACACCATGCTTAGCT224546051–60
6RAACTCTGGTGCTGAATTTGGAAGACCCT
7FCAGATTCTCTACTTCATAGCCATAG32454585655–6453–62
7RATTAAAAGTAGGACTGGATA
8FATATAGCAAGACACTCTGACA338545855–64
8RAGAGAGTACCAATAGTCAAA
9FAGAGTTGGATTTGAGCCTACC28454585553–6250–59
9RCAGACTTTTTCTTCTTACCTGACCTT
10FGGATTTGATCTTAGATCTCGC20453565450–5948–57
10RATTTTAGTTGTTATTGATGA
11FTTGAGCTATTTATGGTTTTG2945358.55653–6251–60
11RGACATACACTGAGAATGAA
12FGCATTTCTTTACCCCTTTCA2305459.55751–6049–58
12RCTTTATTCACCACCCACTG
13FTCCTGGGAATAAGATAATGG3935457.55656–6554–63
13RAGAGCATACGAATGGCTAGT
14(I)FATCTGTGTTATGAGTAACCA4305457.557–66
14(I)RTCATATTTGGCTTCTTGGAG
14(II)FCATGGGCTATCCTTATCTGA4795456.557–66
14(II)RCATGAACTTTCTTGGCTATT
14(III)FTCAAAGTTGTTAGAATCAGG4415455.556–65
14(III)RATTTTGTGCATCTGGTGGAA
14(IV)FGTCCAACAGAAAAAAGAGGG481545754.558–6755–64
14(IV)RCTACATTTTGCCTAGTGCTC
14(V)FCTGGCACTAAGAATTTCATG4295457.55657–6655–64
14(V)RCCTTCTCATTGTAGTCTATC
14(VI)FGAAACATTTGACCCCGAGCA4315457.556–65
14(VI)RTTTTGGGCAAGTCTGGTTTC
14(VII)FCACATACAAGAAAGTTGAGA436545957.556–6555–64
14(VII)RCTCATTTATTGCTGCTATTG
14(VIII)FGATACCATTTTGTCCCTGAA4155457.556–65
14(VIII)RGTCACAAGAGCAGAGCAAAG
15FCACCTAGGAAAATGAGGATGT3005358.55653–6251–60
15RATAGTCAGCAAGAAAATAAA
16FAAGATCCTAGAAGATTATTC3305057.553–62
16RTTAGTACACAAAGACCATTT
17FTGATGAGAAATCCACTCTGG349545856.554–6353–62
17RGTGCAATCTGCATTTCACAG
18FGTGGAATCCTCATAGATGTCA312535754–63
18RGAGTAGGTAGAAGAAAGAGCAC
19FGCAAGCACTTTGCATTTGAG30552595655–6452–61
19RAGCAACCATTCCAGAAAGGA
20FCCATTTTCATTGACTTACATTTGAG1935359.556.549–5846–55
20RAGATATAATCAGCCCAGGTTC
21FGAATTTAATCTCTGATTTCTCTAC1685360.55648–5746–55
21RGAGTGAATGTGAATACATTTCC
22FAAATAGGTTAAAATAAAGTGTTAT206534848–57
22RGACTAATTACATACCATTAAG
23FCTCTGTATTCACTTTCCATG250545752–61
23RACAGTTAGTCACCCTACCCA
24FGCTCAGTATAACTGAGGCTG2495458.551–60
24RCTCTGAGTCAGTTAAACAGT
25FAGTGCTGTGGTATGGTTAAG323565856.555–6454–63
25RTTGCTCTGAAAATTTGGTCATA
26FATCCTGGACTACTGGAAACA393536358.556–6551–60
26RAGTTAATTCAGGAGGCTTCA
Primer pairs and PCR conditions for DHPLC analysis. Samples showing an abnormal peak pattern were sequenced using a fluorescent ABI Prism BigDye terminator kit (Applied Biosystems, UK), and the mutations were characterized. Each mutation was confirmed on a second, independent, amplified PCR sample. In order to rule out the possibility of exonic polymorphisms, 150 DNA samples from healthy, unrelated controls were screened and found negative for the novel missense mutations. All mutations found in the patients' family members were confirmed by sequencing.

High Resolution Melting Analysis

Melting curve analysis with the high-resolution melting instrument is a simple, high-performance, reliable, high-resolution, time-saving, and low labor-intensive technique that has shown promise as a sensitive and specific tool for the detection of variations in DNA. The thermal stability of a PCR product is determined by its base sequence [21,22]. When the PCR product sequence is altered, duplex stability is changed, leading to different melting behavior. During high resolution melting analysis, melting curves are produced using dyes that fluoresce in the presence of double-stranded DNA and specialized instruments designed to monitor fluorescence during heating; as the temperature increases, the fluorescence decreases, producing a characteristic melting profile. The melting curve data were normalized, temperature-shifted, and converted to melting peaks by plotting the negative derivative of the fluorescence with respect to temperature against temperature (-dF/dT vs. temperature). This melting data can be analyzed to detect sequence variations such as single nucleotide polymorphisms and small insertions and deletions. PCR amplification mixture included 2.5 mM MgCl2, 5 μl 2× Master Mix, 3.1 μl H2O (from Roche Reaction Mix Kit, Mannheim, Germany), 0.2 mM primers. And we added 25 ng DNA template. PCR amplification began with the first denaturation step at 95°C for 10 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 45 s, extension at 72°C for 45 s, and then a final extension step at 72°C for 10 min. Pipet 10 μl PCR products into each well of the LightCycler® 480 (Roche Applied Science) Multiwell Plate. Seal Multiwell Plate with LightCycler® 480 Sealing Foil. Load the multiwall Plate in LightCycler® 480 instrument and start the melting program. High resolution melting was performed at 95°C for 1 min, 40°C for 1 min, 6.5°C for 1 s and acquisitions at 95°C. The data was evaluated using the LightCycler® 480 Gene Scanning Software. In order to improve the melting analysis, we redesigned the primers for some exons to shorten the PCR product and to avoid DNA-dimer formation (Table 2).
Table 2

Redesigned primer pairs for HRM

ExonOligo (5' – 3')product size
HA – 1-1FCCACTGATAAAAAGGAAGCA226
HA – 1-1RGTGGAGAGCTCTATTTGCAT
HA – 1-2FCCTCCTGGGAGCTAAAGATA248
HA – 1-2RCGATCAGACCCTACAGGA
HA – 4-1FCTTTGAGTGTACAGTGGATATAGAA200
HA – 4-1RAAAGATATGAGTAGGTAAGGCACA
HA – 4-2FTGATAAAGTCTTCCCTGGTG209
HA – 4-2RTGCTTATTTCATCTCAATCCT
HA – 7-1FCCTAGCAAGTGTTTTCCATT246
HA – 7-1RAGGTCCATCAAGAGTGTTTG
HA – 7-2FGCCACAGGAAATCAGTCTAT236
HA – 7-2RTTCATTTTAAAGATCCAAGA
HA – 8-1FTGAGCCAATTCAATCTCTTT237
HA – 8-1RATCATCAAACCTGACCACAT
HA – 8-2FTAATGAAGAAGCGGAAGACT245
HA – 8-2RTTTTGAGTATGGGGAAGAGA
HA – 9FCCCAACCTCTCATCTTTTT250
HA – 9RCCAGACTTTTTCTTCTTACCTG
HA – 11-1FCAGATTTGTAGAACCCTTGC216
HA – 11-1RTAGAGTAATAGCGGGTCAGG
HA – 11-2FCTGCCAGGAGAAATATTCAA239
HA – 11-2RAAGGGGACATACACTGAGAA
HA – 13-1FCATGACAATCACAATCCAAA244
HA – 13-1RAGAATGGGAATAGGGTGAGT
HA – 13-2FGAGGTGGCATACTGGTACAT219
HA – 13-2RATACGAATGGCTAGTGAAGC
HA – 14-1FCTGTGTTATGAGTAACCAGAGT243
HA – 14-1RCCTAGTGCTAGGGTGTCTTG
HA – 14-2FAATGCCATTGAACCAAGA238
HA – 14-2RCATATTTGGCTTCTTGGAGA
HA – 14-3FTCTTGCGACAGAGTCCTACT242
HA – 14-3RTTTCTTCAACTCTGTTGCTG
HA – 14-4FTCAGGCCTCCAATTAAGAT250
HA – 14-4RGGTCCACCAGACTCAGTAAG
HA – 14-5FAGA TAC CAC TCT ATT TGG CA229
HA – 14-5RAAC TTT GAA TAA GGC ATT A
HA – 14-6FTGGTAGGTTATTTAAAGGGAAA248
HA – 14-6RGCATTCTGTCATGAATCAAA
HA – 14-7FCCATCAGTCTGGCAAAATA250
HA – 14-7RATCCACCTTGCTGATTCTG
HA – 14-8FCACAAAATCCAGATATGTCGT235
HA – 14-8RCCATCTCTTTGAGTCCTACG
HA – 14-9FAGGAAAGGGTGAATTTACAA249
HA – 14-9RTTTTGCCTAGTGCTCAGTAA
HA – 14-10FTTGCCTCAGATACATACAGTG250
HA – 14-10RTGCATGCATATTTCTCTACAA
HA – 14-11FAAAACTTGGAAGGCTTGG250
HA – 14-11RTTGTAGTCTATCTGTGTGAGG
HA – 14-12FGGTCCAAAAACATGAAACAT245
HA – 14-12RATAAGATGCTGCTGGAAGAT
HA – 14-13FGGTCCTATTCCAAGACAACTC250
HA – 14-13RAGATGTTTTGGGCAAGTCT
HA – 14-14FCACATACAAGAAAGTTGAGAACA250
HA – 14-14RGCTTTCTGTTGCTACTCTCAG
HA – 14-15FTGGAATGAAGCAAACAGAC250
HA – 14-15RTTTGTCCCTCATTTATTGCT
HA – 14-16FATACCATTTTGTCCCTGAAC249
HA – 14-16RTGTCAAAATCTTCCTTCTTCA
HA – 14-17FTTCAGTCAGATCAAGAGGAAA246
HA – 14-17RTCAAATGTCACAAGAGCAGA
HA – 15FTATTGCTTTTCCTCTGCTTT214
HA – 15RTTTCTTGTAATTCCACTGTCC
HA – 16-1FGGGATGTAAACCCTAAGGAC228
HA – 16-1RATGATGTTGCACTTTCCAA
HA – 16-2FCTCTCGTCCCTATTCCTTCT232
HA – 16-2RTAAACCAAAAAGTGGTCAGC
HA – 17-1FACTCATAGGATTGATGTCTTCC238
HA – 17-1RTAAAAGTGGGATCTTCCATC
HA – 17-2FCTAACACACTGAACCCTGCT241
HA – 17-2RTCATTTGTCAAAGTGCAATC
HA – 18FTTTTAACAGGCTTCTCTGTG246
HA – 18RAGGTAGAAGAAAGAGCACAAAC
HA – 19FAAATAATTTCTGTTCCTGTTG222
HA – 19RATTCCAGAAAGGAAGAAAGC
HA – 25-1FGGT GAC CAA GAG GCT AC170
HA – 25-1RGAC TGC TGG AGA TGA GGA
HA – 25-2FCAG GGA GTA AAA TCT CTG C155
HA – 25-2RTGG TAT TTT TTT TCT TTC TT
HA – 26-1FAGAAGTGAGAAAAGCGTCTG244
HA – 26-1RACCCTCAGTAGAGGTCCTG
HA – 26-2FGAATTCACCCCCAGAGTT234
HA – 26-2RAGAAATGCAGGACTGATGAT

Some of the primers used for HRM were redesigned by LightCycler Probe Design Software 2.0. The primers not listed were the same with table 1

Redesigned primer pairs for HRM Some of the primers used for HRM were redesigned by LightCycler Probe Design Software 2.0. The primers not listed were the same with table 1

Multiplex PCR by Capillary Electrophoresis

In one family, the band of exon 4 to exon 10 by electrophoresis after PCR was visible in female cases but not in affected male patients. Large deletion was suspected, so we designed multiplex PCR in order to differentiate normal female from female carriers. Multiplex PCRs were used to optimize the system and allowed the amplification of exon 3 to exon11. The KRIT and FGFR2 genes were used as internal controls. Each multiplex PCR for the DNA fragments was performed in a total volume of 25 μL containing the following: 100 ng of genomic DNA; 0.1 to 0.5 μM each primer; 200 μM dNTPs; 1 unit of AmpliTaq Gold enzyme (PE Applied Biosystems); and 2.5 μL of GeneAmp 10× buffer II (10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl) in 2 mM MgCl2 as provided by the manufacturer. PCR amplification was carried out with an initial denaturation step at 95°C for 10 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 45 s, extension at 72°C for 45 s, and then a final extension step at 72°C for 10 min. The HDA system with GCK-5000 cartridge kit (eGene) was used to analyze exons of the F8 gene. The gel-matrix in the gel cartridge consists of proprietary linear polymer with ethidiumbromide (EtBr) dye. The PCR products were diluted 20-fold by deionized water and placed in the sample chamber of the instrument. The DNA samples were then automatically injected into the capillary channel and subjected to electrophoresis according to the manufacturer's operation protocol. BioCalculator Graphing software (eGene) enabled automatic labelling of the peak sizes.

Results

Genomic DNA from 122 HA unrelated families were analyzed for mutations in the F8 gene (Table 3). There were 128 affected patients identified. This resulted in the identification of 61 different F8 gene mutations. The mutation detection rate was 100%.
Table 3

The detailed patient data.

Case numberGenderDiagnosisResultReported/NovelHRM resultFVIII:CSeverity
69-1MAffected caseExon 1 deletionR<1%severe
61-1MAffected caseExon 2, c.185, C>G, TCA>TGA, Ser>XN<1%severe
109MAffected caseExon 3, c.278, C>T, CCT>CTT, Pro>LeuNV<1%severe
82MAffected caseExon 3, c.278, C>T, CCT>CTT, Pro>LeuN<1%severe
144MAffected caseExon 3, c.336_339, dup CCATNindistinguishable1.6%moderate
71-1FCarrierIntron 3, c.289-9 C>TNV
42-3MAffected caseExon 4, c.403 G>A, GAT>AAT, Asp>AsnN<1%severe
59-1MAffected caseExon 4, c.532, C>G, CTT>GTT, Leu>ValN<1%severe
118-1MAffected caseExon 4~Exon 10 deletionR1.1%moderate
122MAffected caseExon 7, c.829, A>G, ATT>GTT, Asp>GlyNV12%muld
114MAffected caseExon 7, c.854_855, ins GNV2.4%moderate
79-1MAffected caseExon 7, c.977 T>C, CTA>CCA, Leu>ProR<1%severe
94-1MAffected caseExon 7, c.977 T>C, CTA>CCA, Leu>ProR<1%severe
16-3MAffected caseExon 8, c.1247, C>T, CCC>CTC, Pro>LeuN4.2%moderate
101FCarrierExon 9, c.1310 G>C, CGG>CCG, Arg>ProRV
72-1MAffected caseExon 9, c.1315 G>A, GGT>AGT, Gly>SerR3.0%moderate
162MAffectedExon 9, c.1336, C>T, CGA>TGA, Arg>XR4.8%moderate
110MAffected caseExon 9, c.1400, T>G, ATC>AGC, Ile>SerNV0.6%severe
65MAffected caseExon 11, c.1636, C>T, CGG>TGG, Arg>TrpR2.3%moderate
92MAffected caseExon 11, c.1648, C>T, CGC>TGC, Arg>CysR12.0%mild
136MAffected caseExon 11, c.1678, A>G, AGA>GAA, Arg>GlyNV11.0%moderate
98MAffected caseExon 12, c.1783_1790 del 8 merNV<1%severe
119MAffected caseExon 12, c.1804, C>T, CGA>TGA.Arg>XRV1.5%moderate
150-1MAffected caseExon 12, c.1834, C>T, CGC>TGC, Arg>CysR6.0%mild
10-1MAffected caseExon 14, c.2314 C>T, CAA>TAA, Gln>XR<1%severe
104-1MAffected caseExon 14, c.2605_2606, ins CNV<1%severe
113-1MAffected caseExon 14, c.2609_2610, del CTRV<1%severe
85-1MAffected caseExon 14, c.2939_2940, ins GNV<1%severe
124MAffected caseExon 14, c.3294_3295, ins ANV0.2%severe
111MAffected caseExon 14, c.3629, del ARV<1%severe
17-1FCarrierExon 14, c.3629, del AR
3-1MAffected caseExon 14, c.3629, del AR<1%severe
132MAffected caseExon 14, c.4076 G>A, TGG>TAG, Trp>XR0.3%severe
87-1MAffected caseExon 14, c.4197 del CN3.0%moderate
63-1MAffected caseExon 14, c.4372, del AN3.6%moderate
2-1MAffected caseExon 14, c.4619, del TN<1%severe
11-1FAffected caseExon14, c.4814, C>A, TCA>TAA, Ser>XR2.0%moderate
57-2MAffected caseExon 14, c.4856, del CR<1%severe
67-3MAffected caseExon 14, c.4942 C>T, CAA>TAA, Gln>X2.6%moderate
115-1MAffected caseExon 14, c.5069_5073, del 5 merRV<1%severe
74MAffected caseExon14, c.5143, C>T, CGA>TGA, Arg>XN<1%severe
39-3MAffected caseExon 15, c5343 T>A, TATA>TAA, Tyr>XN<1%severe
48-5MAffected caseExon 15, c.5353, G>A, GAA>AAA, Glu>LysNV3.7%moderate
159-2MAffected caseExon 16, c.5399, G>A, CGT>CAT, Arg>HisR4.5%moderate
97MAffected caseExon 16, c.5465_5466, insAN4.9%moderate
55-1MAffected caseExon 16, c.5526, G>A, ATG>ATA, Met>IleR2.1%moderate
5-2MAffected caseExon 16, c.5536, T>A, AAA>TAA, Lys>XR1.6%moderate
123MAffected caseExon 16, c.5576, A>G, GAT>GGT, Asp>GlyNindistinguishable1.3%moderate
161-1FCarrierExon 17, c.5711, A>G, GAG>GGG, Glu>GlyNV
56-1MAffected caseExon 17, c.5848, C>T, CGA>CAA, Gln>XN<1%severe
1-1MAffected caseExon 18, c.5879, G>A, CGA>CAA, Arg>GlnR7.4%mild
133MAffected caseExon 18, c.5879, G>A, CGA>CAA, Arg>GlnR5.5%mild
107-1MAffected caseExon 18, c.5953, C>T, CGA>TGA, Arg>XRV0.8%severe
138-2MAffected caseExon 18, c.5953, C>T, CGA>TGA, Arg>XR<1%severe
73MAffected caseExon 22, c.6403, C>T, CGA>TGA, Arg>XN<1%severe
14-2MAffected caseExon 23, c.6506, G>A, CGT>CAT, Arg>HisR25%mild
20-1MAffected caseExon 23, c.6506, G>A, CGT>CAT, Arg>HisR2.9%moderate
139-1MAffected caseExon 23, c.6506, G>A, CGT>CAT, Arg>HisRV3.0%moderate
125MAffected caseExon 23, c.6532, C>T, CGC>TGC, Arg>CysR6.5%mild
170-1MAffected caseExon 23, c.6532 C>T, CGC>TGC, Arg>CysRV8.9%mild
174-1MAffected caseExon 23, c.6532 C>T, CGC>TGC, Arg>CysRV8.4%mild
95-1MAffected caseExon 23, c.6545, G>A, CGC>CAC, Arg>HisRV2.5%moderate
38-3MAffected caseExon 24, c. 6575 G>T, AGT>ATT, Ser>IleR7.2%mild
102-1MAffected caseExon 24, c.6671, C>T, CCT>CTT, Pro>LeuRV2.7%moderate
12-1FAffected caseExon 24, c.6683 G>A, CGA> CAA, Arg>GlnR<1%severe
41-3MAffected caseExon 25, c.6724, G>A, GTG>ATG, Val>Met; Exon 8, c.1172, G>A, CGC>CAC, Arg>HisR;Rindistibuishable; V<1%severe
84-1MAffected caseExon 25, c.6794_6795 del AGRindistinguishable<1%severe
93-1MAffected caseIntron 1 inversionR12.0%mild
21-1MAffected caseIntron 22 inversion/Exon14 c.4531, G>A, GTT>ATT, Val>IleR;NV<1%severe
100MAffected caseIntron 22 inversionR<1%severe
103-1FCarrierIntron 22 inversionR
105MAffected caseIntron 22 inversionR<1%severe
106-1MAffected caseIntron 22 inversionR<1%severe
112-1MAffected caseIntron 22 inversionR1.2%moderate
116-1MAffected caseIntron 22 inversionR<1%severe
117MAffected caseIntron 22 inversionR3.0%moderate
120-1MAffected caseIntron 22 inversionR2.0%moderate
121MAffected caseIntron 22 inversionR0.6%severe
126-1MAffected caseIntron 22 inversionR<1%severe
131-1MAffected caseIntron 22 inversionR<1%severe
13-4MAffected caseIntron 22 inversionR<1%severe
140MAffected caseIntron 22 inversionR1.1%moderate
143-1MAffected caseIntron 22 inversionR3.0%moderate
147MAffected caseIntron 22 inversionR0.5%severe
149-2MAffected caseIntron 22 inversionR<1%severe
151MAffected caseIntron 22 inversionR1.4%moderate
15-1MAffected caseIntron 22 inversionR<1%severe
152MAffected caseIntron 22 inversionR2.1%moderate
153MAffected caseIntron 22 inversionR1.8%moderate
154MAffected caseIntron 22 inversionR0.5%severe
155MAffected caseIntron 22 inversionR1.7%moderate
156MAffected caseIntron 22 inversionR1.8%moderate
164MAffected caseIntron 22 inversionR<1%severe
167MAffected caseIntron 22 inversionR<1%severe
181MAffected caseIntron 22 inversionR3.0%moderate
31-7FCarrierIntron 22 inversionR
33-3MAffected caseIntron 22 inversionR<1%severe
34-1MAffected caseIntron 22 inversionR<1%severe
35-1MAffected caseIntron 22 inversionR3.0%moderate
40-2MAffected caseIntron 22 inversionR<1%severe
47-1MAffected caseIntron 22 inversionR3.2%moderate
58-3MAffected caseIntron 22 inversionR<1%severe
60-1MAffected caseIntron 22 inversionR1.6%moderate
6-1MAffected caseIntron 22 inversionR<1%severe
51-1MAffected caseIntron 22 inversionR2.7%moderate
62-1MAffected caseIntron 22 inversionR<1%severe
64-2MAffected caseIntron 22 inversionR<1%severe
68-1MAffected caseIntron 22 inversionR<1%severe
70-1MAffected caseIntron 22 inversionR<1%severe
75-2MAffected caseIntron 22 inversionR<1%severe
76-1MAffected caseIntron 22 inversionR<1%severe
77-1MAffected caseIntron 22 inversionR<1%severe
81MAffected caseIntron 22 inversionR<1%severe
86-2MAffected caseIntron 22 inversionR<1%severe
88-1MAffected caseIntron 22 inversionR<1%severe
89-1MAffected caseIntron 22 inversionR<1%severe
90MAffected caseIntron 22 inversionR0.8%severe
91MAffected caseIntron 22 inversionR1.1%moderate
9-1MAffected caseIntron 22 inversionR<1%severe
96-2MAffected caseIntron 22 inversionR0.5%severe
99MAffected caseIntron 22 inversionR<1%severe
148MAffected caseIntron 22 inversionR<1%severe
The detailed patient data.

Screening of the F8 intron inversion

There were fifty-three (42.7%) families with intron 22 inversion (Fig. 1a) and one (0.8%) family with intron 1 inversion (Fig. 1b &1c) in this study. Since the intron 1 and the intron 22 inversion were well established causative mutations [3], there would be no need to search for other mutations in the coding regions in these families.
Figure 1

Result of inversion detection of intron 1 and intron 22. a) LD-PCR result of intron 22 inversion. Wild type has two band with PQ segment (12 KB) and AB segment (10 KB). With intron 22 rearrangement, PQ segment will be interrupted so that PB and AQ (both 11 KB) form. That is why we can see all three bands in carrier. Patient will show only 11 KB and 10 KB bands. Patient 154 is proved to be an affected case. M, marker. C, carrier. P, known affected male patient. WT, wild type. b) PCR result of intron 1 inversion. Set 1 is the product of primer 9F, int-2F and 9CR. In wild type, the only segment amplified is 1908 bp. In the affected male patient with intron 1 inversion, the amplified segment is 1323 bp in length. c) Set 2 is the product of primer 9F, int-2F and 2R. 93-2, 104-1 and 104-2 are normal. 93-1 is proved to be an affected case. 93-3 is a carrier with heterogenous components.

Result of inversion detection of intron 1 and intron 22. a) LD-PCR result of intron 22 inversion. Wild type has two band with PQ segment (12 KB) and AB segment (10 KB). With intron 22 rearrangement, PQ segment will be interrupted so that PB and AQ (both 11 KB) form. That is why we can see all three bands in carrier. Patient will show only 11 KB and 10 KB bands. Patient 154 is proved to be an affected case. M, marker. C, carrier. P, known affected male patient. WT, wild type. b) PCR result of intron 1 inversion. Set 1 is the product of primer 9F, int-2F and 9CR. In wild type, the only segment amplified is 1908 bp. In the affected male patient with intron 1 inversion, the amplified segment is 1323 bp in length. c) Set 2 is the product of primer 9F, int-2F and 2R. 93-2, 104-1 and 104-2 are normal. 93-1 is proved to be an affected case. 93-3 is a carrier with heterogenous components.

Screening of the F8 mutation by DHPLC and direct sequencing

We performed DHPLC for mutation screening in those families who didn't have intron 1 and intron 22 inversions. By DHPLC, 100% genetic mutation was detected in the 119 HA families and confirmed by sequencing. The two X chromosomes from the carriers are responsible for the heteroduplex formation of the PCR amplicons. These stutter peaks (heteroduplex) were eluted much earlier in the chromatographic process than the main peaks (homoduplex). Yet, the affected male patients with one X chromosome would not form a heteroduplex until it is mixed together with the wild type DNA (Fig. 2).
Figure 2

Result of DHPLC. DHPLC results of two families were illustrated. a) Family 85. b) Family 139. The wild type DNA showed homoduplex. The carrier DNA would show heteroduplex peak just as affected male after mixing with normal DNA.

Result of DHPLC. DHPLC results of two families were illustrated. a) Family 85. b) Family 139. The wild type DNA showed homoduplex. The carrier DNA would show heteroduplex peak just as affected male after mixing with normal DNA.

Evaluating of High-Resolution Melting Analysis

In order to evaluate the HRM analysis, 25 families, including a total of 43 samples with known mutation and 341 normal controls were tested. The mutations consisted of 13 different missense mutations, 5 deletions, 4 insertions, 2 nonsense mutations, one splicing site nucleotide substitution and one duplication. In order to avoid DNA-dimer formation, we redesigned the primers for the HRM PCR reaction. The resulting melting curves were easier to differentiate from normal controls and the sensitivity was elevated. Figure 3 compares the melting curves of the original and modified primers, respectively. As temperature increased, the double strand DNA was unwound and the fluorescence was released (Fig 3a and 3b). The melting curves were normalized by calculation of the "line of best fit" in between two normalization regions before and after the major fluorescence decrease representing the melting of the PCR product using the software the LightCycler® Gene Scanning Software 4.0. The samples with high signal difference would present different peaks from the wild type (Fig 3d).
Figure 3

Comparison of the results of different HRM primers. a) and c) are HRM plots for exon 14-5 with first-designed primer. We are unable to see the grouping in the normalized, temperature-shifted plot. So we redesigned the primer pairs by LightCycler Probe Design Software 2.0. The result is shown in b) and d). The carrier and the patient are easy to be distinguished in the latter.

Comparison of the results of different HRM primers. a) and c) are HRM plots for exon 14-5 with first-designed primer. We are unable to see the grouping in the normalized, temperature-shifted plot. So we redesigned the primer pairs by LightCycler Probe Design Software 2.0. The result is shown in b) and d). The carrier and the patient are easy to be distinguished in the latter. The different melting curve patterns were easily identified in 25 out of 28 cases (89%) and 15 out of 15 (100%) carriers. The sensitivity of HRM in this study was 93 % (40/43). In addition, we performed HRM for whole coding region scanning in three families with unknown mutations. Three abnormal melting curves were identified. After these exons were confirmed by direct sequencing, we were able to identify the mutation in these three families. The specificity of HRM in this pilot study was high but it required further investigation. A larger sample sizes was needed for validation.

Multiplex PCR

There were two families, which we were unable to see the exon 4 to exon 10 band and the Exon1 band from electrophoresis after PCR, respectively. For the former, we designed the multiplex PCR that showed a total deletion from exon 4 to exon 10 (Fig 4). The ratio of the defective exon to the control gene in peak heights (the exon 4 to exon 10/the KRIT and the exon 4 to exon 10/the FGFR2) in the female carrier was half of that of the wild type. That is, the relative gene dosage in exon 4 to the exon 10 of the wild type was two times to that of the female carrier. As for the other family, we were unable to perform the multiplex PCR without having the DNA of the obligate carrier.
Figure 4

Multiplex PCR in a family with exon 4 to exon 10 deletion. FGFR2 (*) and KRIT (#) gene are used as internal control. a) are from wild type and b) are from female carrier. The X axis was time, which also represented the size of the amplicon. The Y axis was the fluorescence intensity of each amplicon, which also represented the relative gene dosage. The relative peak height of the female carrier with arrow is half to that of the wild type in exon 4, 5, 8,9 but not in exon 11.

Multiplex PCR in a family with exon 4 to exon 10 deletion. FGFR2 (*) and KRIT (#) gene are used as internal control. a) are from wild type and b) are from female carrier. The X axis was time, which also represented the size of the amplicon. The Y axis was the fluorescence intensity of each amplicon, which also represented the relative gene dosage. The relative peak height of the female carrier with arrow is half to that of the wild type in exon 4, 5, 8,9 but not in exon 11. In this study we identified twenty-eight missense mutations, thirteen nonsense mutations, one four- base pair duplication, five insertions, nine small deletions, one splicing site nucleotide substitution and two large segment deletions in the F8 gene. We identified twenty-nine novel mutations of the F8 gene in hemophilia A patients, in which eleven were missense mutations, one was splicing site substitution, seven were nonsense mutation, which lead to premature terminating of the protein, and ten were frameshift mutations including one four-base pair duplication, four deletions and five insertions, resulting in truncations of the F8 protein. None of the novel missense mutations were presented in the 150 normal DNA samples.

Discussion

The most common mutation, found in approximately 40% of patients with severe hemophilia A, was the intron 22 inversion mutation [23]. This mutation happens when homologous recombination occurs between the Int22h-1 in intron 22 and 1 of 2 homologous regions (Int22h-2 or Int22h-3) telomeric to the F8 gene. An additional inversion of intron 1 of the factor VIII gene that affects up to 5% of patients with severe hemophilia A has been reported [18]. The large size of the F8 gene predisposes to the occurrence of deletions, which account for approximately 5% of characterized mutations. Single base pair changes (resulting in missense, frameshift, or splice junction mutations), insertions, or duplications account for the balance of cases of hemophilia A that are spread throughout the F8 gene [24]. Although the structure-function relationships of some of the missense mutations are known or can be deduced (eg, alteration of vWF binding site, thrombin cleavage site, etc), the structural consequences of most such mutations remain undefined [25]. Our data showed a mutation detection rate at 100% out of 122 hemophilia A families. Since the intron 22 inversion and intron 1 inversion present in 45.1 % in this Taiwanese database, 47.5 to 53% in India population [8,26] and 40–50% in European [3,18], it is rational to perform the inversion detection of intron 1 and intron 22 at first, and then genetic scan if no intron 1 or 22 inversion were found. In our cohort, 54.5% severe HA families had intron 1 and intron 22 inversion; 65.5% cases with intron 1 and intron 22 inversion belonged to severe hemophilia A patients. It is also suggested to check for intron 1, intron 22 inversion and big deletions in cases having the severe phenotype; on the other hand, it is recommended to go directly to the F8 gene mutation scanning in cases having the moderate/mild phenotype [25,27]. However, we are a referred center and the clinical data is not always available. Because the inversion detection of intron 1 and intron 22 is cheaper and more time-saving than other techniques, our strategy seemed to be economical under this situation. The B domain accounts for 40% of the F8 cDNA. Apart from large exon or intron deletions, fourteen (14/52, 26.9%) different mutations and one SNP were found to be located in the B domain of the F8 cDNA. All mutations belonging to deletion, insertion, or nonsense mutations, lead to different protein products. This may imply the low functional importance of this region since no phenotype would be identified unless the protein product is changed or truncated. The SNP identified in the B domain was located in c. 3780 on exon 14, which changed aspartic acid to glutamic acid. Through family studies in a Caucasian population, Machiah et al. hypothesized that Asp1241Glu influences about 5% F8 levels and modifies thrombosis risk by modulating the rate of secretion into the circulation by family studies [28]. Scanavini et al. also conducted a case-control study and demonstrated that the F8 D1241E polymorphism was associated with decreased F8 activity [29]. Affected males with large deletions can be readily detected by the absence of an amplification product in PCR. Up to 98% of all frequent deletions can be detected, but in carriers, the nondeleted X chromosome hampers detection, making identification of hemophilia A carrier status difficult. In one particular family, the PCR product of an affected male patient failed to show exon 4 to exon 10. But of the same family, the same exon region in the female cases was successfully amplified by PCR and sequenced. Large deletion was suspected, but we were unable to distinguish the female carriers from the wild type. We designed the multiplex PCR [12,15] so that we could differentiate between them by examining different peak heights with the use of different gene dosages(Fig 4). In addition, the absence of peaks from exon 4 to exon 10 confirmed the deletion in the affected male. Multiplex PCR is an in-house designed reaction, which compares the dosage of several genes. This system may also be adapted for diagnostic use in other genetic diseases involving deletion and duplication mutations. We had two heterozygous females from two unrelated families. Hemophilia A is transmitted through heterozygous females denoted as carriers, who are generally asymptomatic. This is because random X inactivation results in approximately equal proportions of somatic cells, in which either the normal X or the mutated X chromosome is active [23,30]. Because females have two X chromosomes and only 5% of FVIII is enough for the body to maintain hemostasis, it is very rare to have a female HA patient with very low FVIII activity and severe bleeding symptoms [31]. Even though the disease is extremely rare in females, a few cases have been documented as a result of different pathophysiologic mechanisms [32-34]. The skewed X-chromosome inactivation is the most common possible mechanism for the phenomenon [31,35-39]. The hemophilia A mutation screening is laborious and expensive, even when employing DHPLC as a screening method. In order to facilitate throughput and minimize the cost of hemophilia A mutation screening, we evaluated a new mutation scanning technique, high resolution melting system(HRM). We performed high resolution melting analysis on 43 samples, including carriers and affected cases. All the carriers were easily to be distinguished (100%). Nevertheless, we were unable to identify three out of 28 affected cases. The detection rate was 93%. We had a reason to believe that it is easier for the heteroduplex to release double-stranded DNA dye, so that HRM is more sensitive to carrier detection. DHPLC is not ideal in detecting affected case until mixed together with normal DNA. On the other hand, even though HRM was able to distinguish the affected male from the wild type, the sensitivity did not reach 100% despite optimizing condition. Therefore, mixing up the affected male DNA with normal control would improve the detection rate for both DHPLC and HRM. Besides, we proved that the analysis was greatly enhanced by good primer design that avoided DNA-dimer formation. The sensitivity of the analysis was not only influenced by the size of PCR products but also the primers and the PCR condition. We recommend the software, LightCycler Probe Design Software 2.0, as the tool for primer design. As for clinical application, once the intron 1 and 22 inversion has been ruled out, HRM becomes a good initial screening method, especially for those families with obligate carriers. Comparing with our familiar method, DHPLC, HRM costs less ($0.6 versus $3.0 per sample per amplicon, respectively), takes less time (3 hours versus 10 hours) and works more efficiently (96 or 384 wells at one time). The analysis of HRM takes only fifteen minutes. With this highly sensitive and specific tool, we will be able to manage a large quantity of clinical samples and do mutation screening.

Conclusion

In conclusion, we are capable of detecting 100% of mutations in the F8 gene; also our study identified a number of novel mutations in the largest cohort of Taiwanese patients yet to be reported. Furthermore, we validate HRM for hemophilia A mutation screening. Mutation detection is best started with obligate carriers. We proposed a cost-effective screening protocol with sequential combination of different genetic diagnostic tools. HRM saves time and money, and we have proven the use of such technique to be effective for mutation screening.

Abbreviations

DHPLC: Denaturing High Performance Liquid Chromotography; F8 gene: FVIII gene; HA: Hemophilia A; HRM: High resolution Melting; LD-PCR: Long-distance PCR

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

S–YL and C–CH carried out the molecular genetic studies. WT and S–SC participated in the clinical diagnosis, sequence alignment and sample collecting. S–YL and C–TC drafted the manuscript. C–CH, H–NH and Y–NS participated in the design of the study and performed the statistical analysis. C–NL conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:
  39 in total

1.  Twin study of genetic and aging effects on X chromosome inactivation.

Authors:  Marianne Kristiansen; Gun P S Knudsen; Lise Bathum; Anna K Naumova; Thorkild I A Sørensen; Thomas H Brix; Anders J Svendsen; Kaare Christensen; Kirsten O Kyvik; Karen H Ørstavik
Journal:  Eur J Hum Genet       Date:  2005-05       Impact factor: 4.246

2.  Single-tube polymerase chain reaction for rapid diagnosis of the inversion hotspot of mutation in hemophilia A.

Authors:  Q Liu; G Nozari; S S Sommer
Journal:  Blood       Date:  1998-08-15       Impact factor: 22.113

3.  Subcycling-PCR for multiplex long-distance amplification of regions with high and low GC content: application to the inversion hotspot in the factor VIII gene.

Authors:  Q Liu; S S Sommer
Journal:  Biotechniques       Date:  1998-12       Impact factor: 1.993

4.  X inactivation in females with X-linked disease.

Authors:  J M Puck; H F Willard
Journal:  N Engl J Med       Date:  1998-01-29       Impact factor: 91.245

5.  Uneven X inactivation in a female monozygotic twin pair with Fabry disease and discordant expression of a novel mutation in the alpha-galactosidase A gene.

Authors:  I Redonnet-Vernhet; J K Ploos van Amstel; R P Jansen; R A Wevers; R Salvayre; T Levade
Journal:  J Med Genet       Date:  1996-08       Impact factor: 6.318

6.  Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

Authors:  K M Ririe; R P Rasmussen; C T Wittwer
Journal:  Anal Biochem       Date:  1997-02-15       Impact factor: 3.365

7.  Factor VIII gene inversions in severe hemophilia A: results of an international consortium study.

Authors:  S E Antonarakis; J P Rossiter; M Young; J Horst; P de Moerloose; S S Sommer; R P Ketterling; H H Kazazian; C Négrier; C Vinciguerra; J Gitschier; M Goossens; E Girodon; N Ghanem; F Plassa; J M Lavergne; M Vidaud; J M Costa; Y Laurian; S W Lin; S R Lin; M C Shen; D Lillicrap; S A Taylor; S Windsor; S V Valleix; K Nafa; Y Sultan; M Delpech; C L Vnencak-Jones; J A Phillips; R C Ljung; E Koumbarelis; A Gialeraki; T Mandalaki; P V Jenkins; P W Collins; K J Pasi; A Goodeve; I Peake; F E Preston; M Schwartz; E Scheibel; J Ingerslev; D N Cooper; D S Millar; V V Kakkar; F Giannelli; J A Naylor; E F Tizzano; M Baiget; M Domenech; C Altisent; J Tusell; M Beneyto; J I Lorenzo; C Gaucher; C Mazurier; K Peerlinck; G Matthijs; J J Cassiman; J Vermylen; P G Mori; M Acquila; D Caprino; H Inaba
Journal:  Blood       Date:  1995-09-15       Impact factor: 22.113

8.  The factor VIII D1241E polymorphism is associated with decreased factor VIII activity and not with activated protein C resistance levels.

Authors:  Daniela Scanavini; Cristina Legnani; Barbara Lunghi; Federico Mingozzi; Gualtiero Palareti; Francesco Bernardi
Journal:  Thromb Haemost       Date:  2005-03       Impact factor: 5.249

9.  Characterization of the factor VIII defect in 147 patients with sporadic hemophilia A: family studies indicate a mutation type-dependent sex ratio of mutation frequencies.

Authors:  J Becker; R Schwaab; A Möller-Taube; U Schwaab; W Schmidt; H H Brackmann; T Grimm; K Olek; J Oldenburg
Journal:  Am J Hum Genet       Date:  1996-04       Impact factor: 11.025

10.  Screening for mutations in haemophilia A patients by multiplex PCR-SSCP, Southern blotting and RNA analysis: the detection of a genetic abnormality in the factor VIII gene in 30 out of 35 patients.

Authors:  W C Pieneman; P P Deutz-Terlouw; P H Reitsma; E Briët
Journal:  Br J Haematol       Date:  1995-06       Impact factor: 6.998

View more
  7 in total

1.  LightCycler technology in molecular diagnostics.

Authors:  Elaine Lyon; Carl T Wittwer
Journal:  J Mol Diagn       Date:  2009-02-05       Impact factor: 5.568

2.  High resolution melting for F9 gene mutation analysis in patients with haemophilia B.

Authors:  Roberta Salviato; Donata Belvini; Paolo Radossi; Giuseppe Tagariello
Journal:  Blood Transfus       Date:  2018-02-28       Impact factor: 3.443

3.  Severe Hemophilia A in a Male Old English Sheep Dog with a C→T Transition that Created a Premature Stop Codon in Factor VIII.

Authors:  Jay N Lozier; Mark T Kloos; Elizabeth P Merricks; Nathaly Lemoine; Margaret H Whitford; Robin A Raymer; Dwight A Bellinger; Timothy C Nichols
Journal:  Comp Med       Date:  2016       Impact factor: 0.982

4.  Complexity and diversity of F8 genetic variations in the 1000 genomes.

Authors:  J N Li; I G Carrero; J F Dong; F L Yu
Journal:  J Thromb Haemost       Date:  2015-10-20       Impact factor: 5.824

5.  High resolution melting: improvements in the genetic diagnosis of hypertrophic cardiomyopathy in a Portuguese cohort.

Authors:  Susana Santos; Vanda Marques; Marina Pires; Leonor Silveira; Helena Oliveira; Vasco Lança; Dulce Brito; Hugo Madeira; J Fonseca Esteves; António Freitas; Isabel M Carreira; Isabel M Gaspar; Carolino Monteiro; Alexandra R Fernandes
Journal:  BMC Med Genet       Date:  2012-03-19       Impact factor: 2.103

6.  Genetic and Bioinformatic Strategies to Improve Diagnosis in Three Inherited Bleeding Disorders in Bogotá, Colombia.

Authors:  Juliana Lago; Helena Groot; Diego Navas; Paula Lago; María Gamboa; Dayana Calderón; Diana C Polanía-Villanueva
Journal:  Genes (Basel)       Date:  2021-11-18       Impact factor: 4.096

7.  Factor VIII inhibitor development in Egyptian hemophilia patients: does intron 22 inversion mutation play a role?

Authors:  Laila M Sherief; Osama A Gaber; Hala Mosaad Youssef; Hanan S Sherbiny; Wesam A Mokhtar; Asmaa A A Ali; Naglaa M Kamal; Yehia H Abdel Maksoud
Journal:  Ital J Pediatr       Date:  2020-09-14       Impact factor: 2.638

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.