Literature DB >> 18492255

Functional comparison of plasma-membrane Na+/H+ antiporters from two pathogenic Candida species.

Yannick Krauke1, Hana Sychrova.   

Abstract

BACKGROUND: The virulence of Candida species depends on many environmental conditions. Extracellular pH and concentration of alkali metal cations belong among important factors. Nevertheless, the contribution of transporters mediating the exchange of alkali metal cations for protons across the plasma membrane to the cell salt tolerance and other physiological properties of various Candida species has not been studied so far.
RESULTS: The tolerance/sensitivity of four pathogenic Candida species to alkali metal cations was tested and the role of one of the cation transporters in that tolerance (presumed to be the plasma-membrane Na+/H+ antiporter) was studied. The genes encoding these antiporters in the most and least salt sensitive species, C. dubliniensis and C. parapsilosis respectively, were identified, cloned and functionally expressed in the plasma membranes of Saccharomyces cerevisiae cells lacking their own cation exporters. Both CpCnh1 and CdCnh1 antiporters had broad substrate specificity and transported Na+, K+, Li+, and Rb+. Their activity in S. cerevisiae cells differed; CpCnh1p provided cells with a much higher salt tolerance than the CdCnh1 antiporter. The observed difference in activity was confirmed by direct measurements of sodium and potassium efflux mediated by these antiporters.
CONCLUSION: We have cloned two genes encoding putative Na+/H+ antiporters in C. parapsilosis and C. dubliniensis, and characterized the transport properties of encoded proteins. Our results show that the activity of plasma-membrane Na+/H+ antiporters is one of the factors determining the tolerance of pathogenic Candida species to high external concentrations of alkali metal cations.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18492255      PMCID: PMC2424070          DOI: 10.1186/1471-2180-8-80

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

The family of Candida species, normally a harmless human commensal of the gastrointestinal and genitourinary tract, can become a human pathogen under certain circumstances. Mainly in HIV and immunocompromised patients, Candida cause a wide range of infections and are the most prevalent pathogenic yeast. One key feature of these fungi is their ability to grow in three different morphologies: yeast, pseudohyphae and true hyphae [1]. This reversible switching from one form to another is dependent on environmental conditions like temperature, pH, nutritional status and external/internal concentration of cations [2]. In general, pathogenic Candida species are osmotolerant yeasts and can grow, with the exception of Candida dubliniensis [3], at relatively high NaCl concentrations, although the presence of salt was shown to negatively influence several virulence traits of Candida albicans [4]. Recent experiments also suggest a relationship between the formation of C. albicans hyphae and the intracellular concentration of potassium [5]. Nevertheless, the regulation of intracellular potassium and sodium concentrations in Candida species has not been studied in detail. Yeast species in general have several transport systems in their plasma membranes at their disposal to maintain homeostasis in alkali metal cations, i.e. a high ratio between potassium (which is the main intracellular cation) and toxic sodium concentrations [6-8]. Among these transport systems, Na+/H+ antiporters play an important role. Most yeasts that have so far been studied (e.g. Saccharomyces cerevisiae, Debaryomyces hansenii) possess only one type of this antiporter in their plasma membranes, which efficiently transports both sodium and potassium cations from the cells, as well as their analogues lithium and rubidium [7,9]. A few yeast species (Yarrowia lipolytica, Schizosaccharomyces pombe) have two antiporters of this family at their disposal, one of them with a substrate preference for sodium and lithium, the other preferring potassium and rubidium [10,11]. The Na+/H+ antiporter that has been studied the most so far is from S. cerevisiae, encoded by the NHA1 gene, and has 12 predicted trans-membrane domains and a very long hydrophilic C-terminus [7]. Beside its function in removing toxic Na+ from cells and maintaining potassium homeostasis, it is involved in several other cellular functions such as regulating intracellular pH [12,13], cell volume [7], plasma membrane potential [14] and the cell cycle [15,16], and it participates in the cell response to osmotic shock [7,17]. The Nha1p orthologs from C. albicans and Candida tropicalis CaCnh1p and CtCnh1p, respectively, were functionally characterized upon heterologous expression in S. cerevisiae. Both showed the same broad substrate specificity as ScNha1p [18,19]. The deletion of CNH1 in C. albicans results in cell sensitivity to high external potassium concentrations [20] and under some conditions causes slight changes in cell morphology [21]. In this work we compared the tolerance of four different pathogenic Candida species to alkali metal cations, performed a search for Nha1/Cnh1 antiporter-encoding orthologs in their genomes, and characterized the transport properties of the Na+/H+ antiporters from the most and least tolerant species, C. parapsilosis and C. dubliniensis respectively.

Results

Candida species differ in their halotolerance

According to the literature [3], C. dubliniensis is relatively sodium sensitive, whereas C. parapsilosis was shown to tolerate high NaCl concentrations [22]. In order to estimate the tolerance of Candida species to different alkali metal cations, the growth of four Candida species and a S. cerevisiae wild type (as a non-osmotolerant control) in the presence of increasing concentrations of various salts was estimated. In the absence of salts, S. cerevisiae cells grew more slowly than all four Candida species, and also the growth of C. parapsilosis was not as robust as with the other three Candida species (Figure 1). All yeast species grew equally well in the presence of lower salt concentrations (cf. Methods) but as the amount of alkali-metal-cation on the plates increased, important differences were observed. Of the tested Candida species, C. dubliniensis had the lowest tolerance to all of the tested salts, it is not able to grow when the salt concentrations are above 1600 mM NaCl, 2300 mM KCl or 200 mM LiCl. Nevertheless, C. dubliniensis is more sodium, potassium and rubidium tolerant than S. cerevisiae, but is much more sensitive to toxic lithium cations (Figure 1). Also, the lithium sensitivity of C. glabrata is higher than that of S. cerevisiae but C. glabrata cells can grow in much higher concentrations of the other salts than S. cerevisiae cells (up to 2300 mM NaCl, 2400 mM KCl, 1800 mM RbCl; Figure 1). C. albicans and C. parapsilosis are the most halotolerant species, and C. parapsilosis seems to grow even better in the presence of high salt concentrations than C. albicans (Figure 1). To summarize, the four Candida species have not only different sensitivity to NaCl, as published previously [3,22] but they differ in their tolerance to alkali metal cations in general. C. albicans and C. parapsilosis are highly halotolerant and C. dubliniensis is halosensitive.
Figure 1

Growth of various Candida species and S. cerevisiae on YPD medium supplemented with salts at 30°C.

Growth of various Candida species and S. cerevisiae on YPD medium supplemented with salts at 30°C.

Comparison of Candida CNH1 genes and encoded antiporters

A search in databases revealed the existence of open reading frames homologous to the CaCNH1 gene in the genomes of C. dubliniensis, C. glabrata and C. parapsilosis. In these species, just one homologous sequence was found, suggesting that their plasma-membrane Na+/H+ antiporters have a broad substrate specificity to alkali metal cations, similar to those of C. albicans and C. tropicalis. We named the identified orthologous genes according to their species of origin, CdCNH1, CgCNH1 and CpCNH1. The CdCNH1 gene is 2454 nt (818 aa) long, CgCNH1 has 2835 nt (945 aa), and the CpCNH1 gene is composed of 2955 nt (985 aa). Neither of them have any introns. The predicted protein structures of these three antiporters were compared with the two Candida antiporters that have already been characterized, CaCnh1 and CtCnh1. Comparison of the protein length and predicted structure of the Cnh1 proteins from five Candida species and S. cerevisiae revealed that CpCnh1p is the longest and C. dublinienis antiporter the shortest member of the Candida Na+/H+antiporters' subfamily (Table 1). For all Candida proteins, the Kyte-Doolittle method predicted a similar structure to ScNha1p with highly conserved N-termini and 12 trans-membrane sections (Tables 1 &2). On the other hand, they differ in the length and composition of their hydrophilic C-termini, as do the antiporters from non-Candida yeast species [23]. The most significant is the difference in length (approx. 180 aa) between the C-termini of CpCnh1p (555 aa), CaCnh1p (366 aa) and CdCnh1p (388 aa). Of the analyzed proteins, CaCnh1p and CdCnh1p show the highest sequence identity in all parts of the protein, though the hydrophobic trans-membrane domains and connecting loops are highly conserved (approx. 90% identity) in all Candida antiporters except for CgCnh1p (Table 2). C. glabrata Cnh1p is more similar to S. cerevisiae Nha1p than to the antiporters from other Candida species in all the features analyzed, which corresponds to the phylogenetic relationships among these yeast species [24].
Table 1

Comparison of deduced secondary structures of plasma-membrane Na+/H+ antiporters from Candida species and S. cerevisiae

YeastAntiporterNumber of amino acid residues

N-terminusTms + loopsC-terminusWhole protein
C. albicansCaCnh1p11419366796
C. dubliniensisCdCnh1p11419388818
C. glabrataCgCnh1p12418515945
C. parapsilosisCpCnh1p11419555985
C. tropicalisCtNha1p11419545975
S. cerevisiaeScNha1p12418555985
Table 2

Identity (%) of Candida and S. cerevisiae alkali-metal-cation antiporters

Entire protein/tms and loops/C-terminus
AntiporterCaCnh1pCdCnh1pCgCnh1pCpCnh1pCtNha1pScNha1p

CaCnh1p-84.2/98.6/67.546.0/69.9/20.564.5/88.3/39.669.0/93.1/41.044.0/68.7/23.5
CdCnh1p46.2/69.4/22.262.7/88.1/35.367.5/93.1/43.846.7/69.5/19.8
CgCnh1p42.7/70.1/21.439.7/69.4/19.657.0/86.8/31.8
CpCnh1p57.1/86.8/34.238.8/68.7/20.6
CtNha1p41.0/69.4/19.0
Comparison of deduced secondary structures of plasma-membrane Na+/H+ antiporters from Candida species and S. cerevisiae Identity (%) of Candida and S. cerevisiae alkali-metal-cation antiporters Though the highest divergence from identity was found in the C-termini of all the compared antiporters, the existence of six conserved C-terminal regions described previously [18] was also confirmed in C.dubliniensis, C. parapsilosis and C. glabrata species (not shown). A new, approximately 25 aa-long conserved region (K/R)(L/I)SR(S/T)(L/A)SRRS(Y/F)Y(K/R)KDDP(H/N)(K/R)RKVYAHR (in CaCnh1p aa 639–664) preceding conserved region no. 5 [18]; was found in the four Candida species, except for C. glabrata. Both the C. dubliniensis and C. parapsilosis species belong to the group of yeasts in which the CTG codon encodes a serine and not a leucine, as in other yeast species (i.e. S. cerevisiae) [25]. One CTG codon exists at aa position 621 in CpCNH1. This serine 621 is localized in the antiporter's hydrophilic C-terminus and not in the membrane part of the protein. It is localized in a small weakly conserved area where at a similar position CdCnh1p (aa 568) and CtCnh1p (aa 644) also have a serine and CaCnh1p (aa 552) has an isoleucine.

Heterologous expression of Candida Cnh1ps in S. cerevisiae BW31a cells and its phenotype

In order to 1) verify whether the identified and analysed open reading frames encode functional plasma-membrane alkali-metal-cation/proton antiporters, and 2) elucidate whether the species' salt tolerance could reflect the activity of these antiporters, corresponding DNA fragments from the most and least salt tolerant species, C. parapsilosis and C. dubliniensis respectively, were expressed in a S. cerevisiae mutant lacking its own export systems for alkali metal cations (BW31a ena1-4Δ nha1Δ [8]). The lack of both Na+-ATPases, Ena1-4 and the Na+/H+ antiporter Nha1 renders these cells extremely sensitive to higher external concentrations of salts, and almost no efflux of sodium or potassium cations from them is observable. The functional expression of heterologous sodium and/or potassium exporters in BW31a cells has clear phenotypes of an increased salt tolerance and measurable alkali metal cation efflux [26]. The CdCNH1 and CpCNH1 genes amplified from genomic DNAs were cloned behind the ScNHA1 promoter and expressed from multicopy vectors, as were the genes ScNHA1 and CaCNH1 [7,19], which served as positive controls in our study. Thus all four antiporters were expressed under the same conditions (strain, vector, promoter) which should ensure similar antiporters' levels in cells. Empty YEp352 and pGRU1 vectors served as negative controls. The functionality of all the constructs were first tested in drop experiments, which showed that 1) the presence of the constructs did not influence the growth rate of cells in standard media, i.e. the heterologous expression of these membrane proteins was not toxic for S. cerevisiae, and 2) the expression of both GFP-tagged and non-tagged CdCnh1 and CpCnh1 proteins brought about the same ability to grow on 800 mM NaCl or 1800 mM KCl, as did the positive controls with ScNha1 and CaCnh1 proteins, whereas the cells without antiporters were not able to grow (not shown). This result also confirmed that the C-terminal GFP-tagging did not influence the activity of the antiporters. In order to estimate the substrate specificity and transport capacity of the antiporters, BW31a cells expressing the four antiporters or transformed with an empty vector were spotted on a series of YNB plates containing increasing NaCl, KCl, LiCl and RbCl concentrations. Cells expressing CpCnhp1p were able to grow in the highest concentrations of salts, as did cells expressing CaCnh1p. Both these Candida antiporters conferred a slightly higher tolerance to the cells than equivalent expression of the native S. cerevisiae antiporter, Nha1p (Figure 2). The tolerance of cells expressing CdCnh1p to high external potassium and rubidium was almost the same as for cells expressing CpCnhp1p and CaCnh1p (Figure 2), but their tolerance to toxic cations was significantly lower, only 1000 mM NaCl, and there was no increase in LiCl tolerance compared to cells with the empty vector (30 mM LiCl in both cases).
Figure 2

Growth of . Cells expressing various antiporters were grown on YNB media supplemented with salts at 30°C. Cells with empty YEp352 vector (-) were used as negative, cells expressing ScNha1p as positive control, respectively. Pictures were taken after 4 (YNB) or 7 days (YNB + salts) of incubation.

Growth of . Cells expressing various antiporters were grown on YNB media supplemented with salts at 30°C. Cells with empty YEp352 vector (-) were used as negative, cells expressing ScNha1p as positive control, respectively. Pictures were taken after 4 (YNB) or 7 days (YNB + salts) of incubation. The proton-antiport mechanism of these Cnh1 proteins was verified in a series of drop tests on plates with various pH values (Table 3). As was previously thought, the cells expressing antiporters showed the highest salt tolerance (at least for three of their four substrates) when grown at lower external pH, i.e. in conditions where the proton gradient across the plasma membrane is the highest. Surprisingly, the expression of both the S. cerevisiae and C. dubliniensis antiporters did not increase the cell tolerance to lithium cations at pH 3.5, suggesting that Li+ was not recognized as their substrate under these conditions. On the other hand, all four antiporters were partially active, even at an externally neutral pH 7.0, as their presence enabled the cells to support higher salt concentrations. This detailed study confirmed again that CdCnh1p has the least ability to improve the salt tolerance of cells (Table 3).
Table 3

pH dependence of salt tolerance of BW31a cells expressing various antiporters.

NaCl (mM)KCl (mM)LiCl (mM)



Antiporter3.55.57.03.55.57.03.55.57.0pHout
-<50020075100010006003515<5
ScNha1p130080015020002000120035257
CaCnh1p13001000200200020001200504010
CdCnh1p110080020020002000120035257
CpCnh1p1300100020020002000130040307

Maximum salt concentrations [mM] allowing growth of S. cerevisiae BW31a cells (transformed with the YEp352 plasmid either empty or harbouring genes encoding antiporters) on YNB media with various pH values.

pH dependence of salt tolerance of BW31a cells expressing various antiporters. Maximum salt concentrations [mM] allowing growth of S. cerevisiae BW31a cells (transformed with the YEp352 plasmid either empty or harbouring genes encoding antiporters) on YNB media with various pH values.

Localization of CdCnh1 and CpCnh1 antiporters in S. cerevisiae cells

As mentioned above, C-terminal GFP-tagging of the CdCnh1 and CpCnh1 proteins did not affected their functionality. Both antiporters improved the cell salt tolerance to a similar degree as the non-tagged versions, and fluorescence microscopy localized them to the plasma membrane of S. cerevisiae BW31a cells (Figure 3) and not to the membranes of intracellular organelles. This result indicates a high probability of the same localization in their organisms of origin, as was previously shown for C. albicans Cnh1p [20].
Figure 3

Localization of GFP-tagged CdCnh1p (A) and CpCnh1p (B) in BW31a cells. Fluorescence (1) and Nomarski (2) micrographs.

Localization of GFP-tagged CdCnh1p (A) and CpCnh1p (B) in BW31a cells. Fluorescence (1) and Nomarski (2) micrographs.

Western blot analysis of antiporters' amount in cells

To verify whether the use of the same vector and promoter for expression ensures similar levels of the four antiporters in BW31a cells, the GFP-tagged proteins were visualized on western blots. Fig. 4 shows that 1) the size of Sc and Cp antiporters was alike, similarly as the size of Ca and Cd transporters (and in agreement with the size deduced from the gene sequence, cf. Table 1 and 2) the quantity of antiporters in extracts of exponentially growing cells was similar, the highest amount apparently being observed for CdCnh1p and the lowest one for CpCnh1 antiporter. The analysis was repeated three times with the same result. The fluorescence microscopy and western blot analysis confirmed that the observed low activity of CdCnh1p and the high activity of CpCnh1 antiporter did not reflect different protein levels in the cells.
Figure 4

Immunodetection of GFP-tagged antiporters in . Cells expressing ScNha1-GFP, CaCnh1-GFP, CdCnh1-GFP and CpCnh1-GFP were grown to exponential phase and proteins extracted. After separation of proteins via SDS-PAGE they were transferred to nitrocellulose membrane and detected with anti-GFP antibody.

Immunodetection of GFP-tagged antiporters in . Cells expressing ScNha1-GFP, CaCnh1-GFP, CdCnh1-GFP and CpCnh1-GFP were grown to exponential phase and proteins extracted. After separation of proteins via SDS-PAGE they were transferred to nitrocellulose membrane and detected with anti-GFP antibody.

Efflux of Na+ and K+ from BW31a cells expressing various antiporters

To confirm the results from drop test experiments and to determine the activity and efflux rate of CdCnh1p and CpCnh1p, the efflux of K+ and Na+ was directly measured. The loss of K+ from BW31a cells expressing C. dubliniensis or C. parapsilosis antiporters was measured directly; to measure Na+ efflux, cell preloading with 100 mM NaCl was necessary (cf. Methods). Cells expressing the CaCnh1 antiporter served as positive, and cells transformed with an empty vector as negative controls, respectively. The initial internal concentration of K+ in exponentially growing cells was almost the same in all strains, in the representative experiment about 549.5 ± 25.7 nmol (mg dry wt)-1. After preloading, cells contained 110.5 ± 6.8 nmol (mg dry wt)-1 Na+. As shown in Figure 5 and Table 4, CpCnh1p exported Na+ and K+ much more efficiently than CdCnh1p. Within 60 minutes, cells with CpCnh1p lost 80% of their internal sodium and 32% of their potassium compared to cells with CdCnh1p, which over the same period only lost 38% of their sodium and 20% of their potassium. The C. albicans antiporter was the most effective, exporting 82% of its host cells' sodium and 55% of their potassium in 60 min, which agrees with previously published results [19]. The Na+ efflux curves for CaCnh1p and CpCnh1p are very similar and almost exponential; most of the sodium is exported in about 40 minutes. The efflux of sodium via CdCnh1p is linear and slow. The sodium efflux via all three antiporters is faster than their potassium efflux, though the initial intracellular concentration of K+ is much higher than that of Na+, approx. 300 vs. 50 mM. These results suggest that the Candida antiporters have, at least upon heterologous expression in S. cerevisiae, a higher affinity for sodium than for potassium cations.
Figure 5

Efflux of cations from BW31a cells expressing various antiporters. The efflux of K+ (A) and Na+ (B) from BW31a cells harbouring the empty plasmid YEp352 (●) or expressing CdCnh1p (■), CpCnh1p (▲), CaCnh1p (♦) antiporters was measured. The initial concentrations of cations in cells (corresponding to 100%) were as follows: Na+, 110.5 ± 6.8 nmol (mg dry wt)-1, K+, 549.5 ± 25.7 nmol (mg dry wt)-1 (representative results are shown).

Table 4

Efflux of potassium and sodium cations from BW31a cells expressing various antiporters.

AntiporterNa+K+
-7.4 ± 0.75.0 ± 1.0
CaCnh1p82.2 ± 0.455.3 ± 1.8
CdCnh1p38.4 ± 3.019.5 ± 2.1
CpCnh1p79.1 ± 2.832.6 ± 3.0

The total loss (%) of Na+and K+was measured over 60 min. The values are the average of three independent experiments, each consisting of three samples per time point, the initial concentrations of cations were: K+, 539.5 ± 29.7 nmol (mg dry wt)-1; Na+, 118.9 ± 19.1 nmol (mg dry wt)-1.

Efflux of potassium and sodium cations from BW31a cells expressing various antiporters. The total loss (%) of Na+and K+was measured over 60 min. The values are the average of three independent experiments, each consisting of three samples per time point, the initial concentrations of cations were: K+, 539.5 ± 29.7 nmol (mg dry wt)-1; Na+, 118.9 ± 19.1 nmol (mg dry wt)-1. Efflux of cations from BW31a cells expressing various antiporters. The efflux of K+ (A) and Na+ (B) from BW31a cells harbouring the empty plasmid YEp352 (●) or expressing CdCnh1p (■), CpCnh1p (▲), CaCnh1p (♦) antiporters was measured. The initial concentrations of cations in cells (corresponding to 100%) were as follows: Na+, 110.5 ± 6.8 nmol (mg dry wt)-1, K+, 549.5 ± 25.7 nmol (mg dry wt)-1 (representative results are shown).

Discussion and Conclusion

The variable sensitivity of Candida species to NaCl has been observed and exploited previously, mainly in connection with the original niche of the species, e.g. the high NaCl tolerance of C. parapsilosis strains isolated from sea water or hypersaline brines [22,27] or in clinical microbiological tests aiming to distinguish among Candida species (NaCl sensitivity of C. dubliniensis[3]). In this work, we performed a series of tests to characterize the tolerance of four different pathogenic Candida species to different alkali metal cations, and addressed the question of whether the observed differences in salt tolerance could be based on the transport activity and/or specificity of Candidas' plasma-membrane Na+/H+ antiporters. Our results showed clearly that, besides differences in their tolerance to sodium, the four species tested also differ in their sensitivity to highly toxic lithium and their tolerance of high external concentrations of non-toxic potassium cations (Figure 1). C. glabrata and C. dubliniensis are the most sensitive to Li+ cations, the latter being the least alkali-metal-cation tolerant of the species tested. To elucidate the role of Na+/H+ antiporters in Candidas' salt tolerance, we isolated and heterologously expressed genes encoding putative antiporters in the most and the least tolerant species, C. parapsilosis and C. dubliniensis. The functional characterization of these encoded proteins in an S. cerevisiae mutant lacking its own alkali-metal-cation exporters revealed that both antiporters have broad substrate specificity. They recognize at least four different cations (K+, Li+, Na+, Rb+), but transport them with varying capacities and/or affinities. C. parapsilosis and C. albicans Cnh1 proteins are very efficient transporters and their capacities exceed that of S. cerevisiae Nha1p. On the other hand, the C. dubliniensis antiporter has a much lower transport activity and its ability to recognize and transport the smallest cation, toxic lithium, is very limited compared to the other two Candida antiporters (Figure 2, Table 3). The large difference between the transport activities of the evolutionary close C. albicans and C. dubliniensis Cnh1 antiporters is worth noting, as these two proteins shared the highest level of identity (Table 2). Their core membrane section (twelve tms and connecting loops) is almost 99% identical and their N-termini, composed of 11 aa residues, are 100% identical. These two antiporters differ slightly (compared to other antiporters) in the length and composition of their hydrophilic C-termini. Whether the observed transport capacities are based on the C-terminal difference remain to be established, though previous studies showed that the C-termini of yeast Na+/H+ antiporters are not the most important factor in this activity [7] and that a single amino-acid exchange in one of the transmembrane domains can significantly influence both the substrate specificity and transport capacity of the antiporter [28,29]. Though the C. parapsilosis Cnh1 antiporter mediates a high and efficient sodium efflux from S. cerevisiae cells (similarly as the CaCnh1p, Figure 5 and Table 4), its physiological role in C. parapsilosis remains to be established. A recent study [20] showed that the Cnh1 antiporter is mainly important in potassium homeostasis in C. albicans cells and its role in Na+ detoxification is rather marginal. The differences observed in alkali-metal-cation tolerance between C. dubliniensis and C. parapsilosis/C. albicans species were also found upon testing the alkali-metal-cation tolerance of S. cerevisiae cells expressing the antiporters of these three species. Efflux measurements confirmed that the differing tolerances of S. cerevisiae cells were based on the differing transport activities of the Candida antiporters. Altogether, our results suggest that the activity of plasma-membrane Na+/H+ antiporters is one of the factors determining the tolerance to high external concentrations of alkali metal cations in pathogenic Candida species.

Methods

Yeast strains, media and growth conditions

To determine the salt tolerance of various Candida species, C. albicans SC5314, C. glabrata ATCC2001, C. dubliniensis CD36 and C. parapsilosis CBS604 were used, together with S. cerevisiae S288c as a control. The CdCNH1 and CpCNH1 genes were isolated from C. dubliniensis CD36 and C. parapsilosis CBS604, and heterologously expressed in S. cerevisiae BW31a (ena1-4Δ nha1Δ, W303 derivative, [8]). Yeast cells were grown in YPD or YNB-NH4+ media supplemented with 2% glucose at 30°C. Salts were added to the media prior to and auxotrophic supplements after autoclaving.

DNA manipulations, plasmid construction and DNA sequencing

For DNA manipulations, standard protocols [30] were used. The CdCNH1 and CpCNH1 gene were amplified by PCR with platinum Pfx polymerase with proofreading activity (Invitrogen) using their isolated genomic DNA [31] as a template. Plasmids for the heterologous expression of these antiporters in S. cerevisiae were constructed by homologous recombination in BW31a cells. The oligonucleotides used are listed in Table 5. Two types of plasmids were constructed. CdCNH1 and CpCNH1 coding sequences were cloned behind the ScNHA1 promoter either in multicopy YEp352 or in pGRU1, enabling C-terminal GFP tagging [7]. All constructs were analysed by sequencing in an ABI PRISM 3100 DNA sequencer using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).
Table 5

Oligonucleotides used for amplification of C. dubliniensis and C. parapsilosis CNH1 genes. Sections homologous to CNH1 genes are underlined.

PrimerSequence (5'-3')
CdCNH1-FTTTTTTGTACATTATAAAAAAAAATCCTGAACTTAGCTAGATCTTATGGCTTGGAGTCAGTTAGAA
CdCNH1-RACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCTACTCCTCTTCATCTTCTCT
CdCNH1-GFP-RCATTTTAATAAAGCTCCGGAGCTTGCATGCCTGCAGGTCGACCTCCTCTTCATCTTCTCTATC
CpCNH1-FTTTTTTGTACATTATAAAAAAAAATCCTGAACTTAGCTAGATCTTATGGTATGGAGTCAACTAGAA
CpCNH1-RACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCTATTCCTCGTCATTTTGATC
CpCNH1-GFP-RCATTTTAATAAAGCTCCGGAGCTTGCATGCCTGCAGGTCGACTTCCTCGTCATTTTGATCACG
Oligonucleotides used for amplification of C. dubliniensis and C. parapsilosis CNH1 genes. Sections homologous to CNH1 genes are underlined.

Salt tolerance determination

The cell tolerance to various alkali metal cations was determined by drop test experiments. 3 μl of serial 10-fold dilutions of saturated cell cultures were spotted on solid media. For Candida species, YPD – 3% agar plates supplemented with increasing amounts of salts were used (800 – 2600 mM NaCl; 1800 – 2500 mM KCl; 20 – 1000 mM LiCl; 700 – 1800 mM RbCl). Determination of the maximum salt tolerance of S. cerevisiae BW31a cells expressing either of the antiporters was performed on solid YNB media supplemented with salts and adjusted to various pH levels as described previously [7]. The following salt concentrations were used: 1) non-adjusted pH, 500–1500 mM NaCl; 1800–2100 mM KCl; 25–40 mM LiCl; 1000–1600 mM RbCl; 2) pH 3.5, 500–1300 mM NaCl; 1600–2200 mM KCl; 20–50 mM LiCl; 3) pH 5.5, 200–1000 mM NaCl; 1900–2200 mM KCl; 15–40 mM LiCl; 4) pH 7.0, 50–200 mM NaCl; 800–1500 mM KCl; 5–10 mM LiCl.

Cation efflux measurements

The transport activity of the antiporters was measured as the cation efflux from cells according to [7] with minor modifications. Cells were grown to OD600 ≈ 0.2 in YNB, harvested and then a pH 5.5 incubation buffer (20 mM MES, supplemented with 10 mM KCl or 10 mM RbCl to prevent Na+ or K+ reuptake respectively) was used. For the determination of Na+ efflux, the cells were preloaded for 60 min with 100 mM NaCl in YNB adjusted to pH 7.0 with NH4OH. The K+ efflux was measured directly in the harvested cells. Samples were taken from cell incubation cultures at regular time intervals over a period of 60 min and the cellular cation content was determined by atomic absorption spectroscopy [7]. Each efflux experiment was repeated at least three times and representative results are shown.

Microscopy analysis

Exponential phase cells (grown in YNB at 30°C, OD600 ≈ 0.15) expressing the CdCHN1 or CpCNH1 gene tagged with the GFP sequence were viewed with an Olympus AX70 microscope using a U-MWB cube with a 450–480 nm excitation filter and 515 nm barrier filter. The micrographs were recorded with a DP70 digital camera using the program DP Controller. For whole-cell pictures, Nomarski optics was used.

Immunoblotting

Exponetially growing (OD600 ≅ 0.15) BW31a cells expressing GFP-tagged antiporters were harvested and concentrated by centrifugation to OD600 = 3.0. The proteins were extracted according to [32] with some modifications. After resuspension of cell pellet in 150 μl freshly prepared 1.85 M NaOH with 7.5% β-mercaptoethanol and incubation for 15 min on ice, 150 μl of cold 50% trichloroacetic acid were added. After incubation on ice for 20 min the collection of precipates by centrifugation at 20,000 × g for 20 min followed. The pellet was resuspended in 190 μl of 50 mM Tris-HCl buffer (pH 6.8), containing 8 M urea, 5% sodium dodecyl sulfate (SDS), 0.1 mM EDTA and 1.5% dithiothreitol (DTT) + 10 μl 1 M Tris base. After incubation for 30 min at 37°C the samples were centrifuged at 20,000 × g for 30 min. Supernatant (7.5 μl) were directly loaded on 8% glycine gel and separated by polyacrylamid gel electrophoresis (PAGE). Separated proteins were transferred via electroblotting on nitrocellulose membrane. To detect the GFP-tagged proteins on membranes, rabbit polyclonal anti-GFP antibody (Santa Cruz Biotech., diluted 1:200), secondary goat anti-rabbit IgG antibody with conjugated peroxidase (BioRad, diluted 1:10,000) and ECL detection kit (Pierce) were used.

Authors' contributions

HS was involved in the design phase, YK provided the experimental data, and both authors drafted the manuscript, read and approved its final version.
  31 in total

1.  The Candida albicans antiporter gene CNH1 has a role in Na+ and H+ transport, salt tolerance, and morphogenesis.

Authors:  Tuck-Wah Soong; Tan-Fong Yong; Narendrakumar Ramanan; Yue Wang
Journal:  Microbiology       Date:  2000-05       Impact factor: 2.777

2.  Functional study of the Saccharomyces cerevisiae Nha1p C-terminus.

Authors:  O Kinclová; J Ramos; S Potier; H Sychrová
Journal:  Mol Microbiol       Date:  2001-05       Impact factor: 3.501

3.  Glucose-induced monoubiquitination of the Saccharomyces cerevisiae galactose transporter is sufficient to signal its internalization.

Authors:  J Horak; D H Wolf
Journal:  J Bacteriol       Date:  2001-05       Impact factor: 3.490

4.  Exploration of yeast alkali metal cation/H+ antiporters: sequence and structure comparison.

Authors:  L Pribylová; K Papousková; M Zavrel; J L Souciet; H Sychrová
Journal:  Folia Microbiol (Praha)       Date:  2006       Impact factor: 2.099

5.  Structurally and functionally conserved domains in the diverse hydrophilic carboxy-terminal halves of various yeast and fungal Na+/H+ antiporters (Nha1p).

Authors:  Shinya Kamauchi; Keiji Mitsui; Satoshi Ujike; Megumi Haga; Norihiro Nakamura; Hiroki Inoue; Shigeru Sakajo; Mitsuyoshi Ueda; Atsuo Tanaka; Hiroshi Kanazawa
Journal:  J Biochem       Date:  2002-06       Impact factor: 3.387

6.  The Candida albicans Na(+)/H(+) antiporter exports potassium and rubidium.

Authors:  O Kinclová; S Potier; H Sychrová
Journal:  FEBS Lett       Date:  2001-08-24       Impact factor: 4.124

7.  A screening for high copy suppressors of the sit4 hal3 synthetically lethal phenotype reveals a role for the yeast Nha1 antiporter in cell cycle regulation.

Authors:  E Simón; J Clotet; F Calero; J Ramos; J Ariño
Journal:  J Biol Chem       Date:  2001-05-29       Impact factor: 5.157

8.  Hypertonic sabouraud broth as a simple and powerful test for Candida dubliniensis screening.

Authors:  Sydney Hartz Alves; Eveline Pipolo Milan; Priscilla de Laet Sant'Ana; Loiva O Oliveira; Janio M Santurio; Arnaldo Lopes Colombo
Journal:  Diagn Microbiol Infect Dis       Date:  2002-05       Impact factor: 2.803

9.  Mutagenesis analysis of the yeast Nha1 Na+/H+ antiporter carboxy-terminal tail reveals residues required for function in cell cycle.

Authors:  Ernesto Simón; Anna Barceló; Joaquín Ariño
Journal:  FEBS Lett       Date:  2003-06-19       Impact factor: 4.124

10.  Effects of alkali metal ions on some virulence traits of Candida albicans.

Authors:  P Hermann; K Forgács; E Gál; B Lenkey; G Nagy; F Rozgonyi
Journal:  Folia Microbiol (Praha)       Date:  2003       Impact factor: 2.099

View more
  12 in total

1.  Comparative analysis of putative pathogenesis-related gene expression in two Rhizoctonia solani pathosystems.

Authors:  Renee Rioux; Harish Manmathan; Pratibha Singh; Benildo de los Reyes; Yulin Jia; Stellos Tavantzis
Journal:  Curr Genet       Date:  2011-09-11       Impact factor: 3.886

Review 2.  Alkali metal cation transport and homeostasis in yeasts.

Authors:  Joaquín Ariño; José Ramos; Hana Sychrová
Journal:  Microbiol Mol Biol Rev       Date:  2010-03       Impact factor: 11.056

3.  Four pathogenic Candida species differ in salt tolerance.

Authors:  Yannick Krauke; Hana Sychrova
Journal:  Curr Microbiol       Date:  2010-03-19       Impact factor: 2.188

4.  Chimeras between C. glabrata Cnh1 and S. cerevisiae Nha1 Na+/H+-antiporters are functional proteins increasing the salt tolerance of yeast cells.

Authors:  Y Krauke; H Sychrová
Journal:  Folia Microbiol (Praha)       Date:  2010-10-13       Impact factor: 2.099

5.  Quantitative Proteomics of an Amphibian Pathogen, Batrachochytrium dendrobatidis, following Exposure to Thyroid Hormone.

Authors:  Jose Thekkiniath; Masoud Zabet-Moghaddam; Kameswara Rao Kottapalli; Mithun R Pasham; Susan San Francisco; Michael San Francisco
Journal:  PLoS One       Date:  2015-06-05       Impact factor: 3.240

6.  Changes in the hemolytic activity of Candida species by common electrolytes.

Authors:  Lei Wan; Gang Luo; Haibin Lu; Dongying Xuan; Hong Cao; Jincai Zhang
Journal:  BMC Microbiol       Date:  2015-08-22       Impact factor: 3.605

7.  Potassium Uptake Mediated by Trk1 Is Crucial for Candida glabrata Growth and Fitness.

Authors:  Vicent Llopis-Torregrosa; Barbora Hušeková; Hana Sychrová
Journal:  PLoS One       Date:  2016-04-08       Impact factor: 3.240

8.  Evaluation of Virulence Factors In vitro, Resistance to Osmotic Stress and Antifungal Susceptibility of Candida tropicalis Isolated from the Coastal Environment of Northeast Brazil.

Authors:  Diana L Zuza-Alves; Sayama S T Q de Medeiros; Luanda B F C de Souza; Walicyranison P Silva-Rocha; Elaine C Francisco; Maria C B de Araújo; Reginaldo G Lima-Neto; Rejane P Neves; Analy S de Azevedo Melo; Guilherme M Chaves
Journal:  Front Microbiol       Date:  2016-11-15       Impact factor: 5.640

9.  Effects of chitosan on Candida albicans: conditions for its antifungal activity.

Authors:  Antonio Peña; Norma Silvia Sánchez; Martha Calahorra
Journal:  Biomed Res Int       Date:  2013-06-17       Impact factor: 3.411

10.  Epidemiology and phospholipase activity of oral Candida SPP. Among patients with central nervous system diseases before and after dental cleaning procedure.

Authors:  Aurélia Silva Ribeiro; Dágma Aparecida Silva; Francislene Pereira Silva; Gleicy Carla Santos; Lívia Maria Soares Campos; Lorena Vivien Neves Oliveira; Daniel Assis Santos
Journal:  Braz J Microbiol       Date:  2010-03-01       Impact factor: 2.476

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.