Brucella suis urease encoded by ure1 but not ure2 is necessary for intestinal infection of BALB/c mice.

BACKGROUND: In prokaryotes, the ureases are multi-subunit, nickel-containing enzymes that catalyze the hydrolysis of urea to carbon dioxide and ammonia. The Brucella genomes contain two urease operons designated as ure1 and ure2. We investigated the role of the two Brucella suis urease operons on the infection, intracellular persistence, growth, and resistance to low-pH killing.
RESULTS: The deduced amino acid sequence of urease-alpha subunits of operons-1 and -2 exhibited substantial identity with the structural ureases of alpha- and beta-proteobacteria, Gram-positive and Gram-negative bacteria, fungi, and higher plants. Four ure deficient strains were generated by deleting one or more of the genes encoding urease subunits of B. suis strain 1330 by allelic exchange: strain 1330Deltaure1K (generated by deleting ureD and ureA in ure1 operon), strain 1330Deltaure2K (ureB and ureC in ure2 operon), strain 1330Deltaure2C (ureA, ureB, and ureC in ure2 operon), and strain 1330Deltaure1KDeltaure2C (ureD and ureA in ure1 operon and ureA, ureB, and ureC in ure2 operon). When grown in urease test broth, strains 1330, 1330Deltaure2K and 1330Deltaure2C displayed maximal urease enzyme activity within 24 hours, whereas, strains 1330Deltaure1K and 1330Deltaure1KDeltaure2C exhibited zero urease activity even 96 h after inoculation. Strains 1330Deltaure1K and 1330Deltaure1KDeltaure2C exhibited slower growth rates in tryptic soy broth relative to the wild type strain 1330. When the BALB/c mice were infected intraperitoneally with the strains, six weeks after inoculation, the splenic recovery of the ure deficient strains did not differ from the wild type. In contrast, when the mice were inoculated by gavage, one week after inoculation, strain 1330Deltaure1KDeltaure2C was cleared from livers and spleens while the wild type strain 1330 was still present. All B. suis strains were killed when they were incubated in-vitro at pH 2.0. When the strains were incubated at pH 2.0 supplemented with 10 mM urea, strain 1330Deltaure1K was completely killed, strain 1330Deltaure2C was partially killed, but strains 1330 and 1330Deltaure2K were not killed.
CONCLUSION: These findings suggest that the ure1 operon is necessary for optimal growth in culture, urease activity, resistance against low-pH killing, and in vivo persistence of B. suis when inoculated by gavage. The ure2 operon apparently enhances the resistance to low-pH killing in-vitro.

Background

A number of environmentally and medically important bacteria produce the enzyme urease (urea amidohydrolase) [1], which catalyzes the hydrolysis of urea, leading to the production of carbamate and ammonia. In an aqueous environment, the carbamate rapidly and spontaneously decomposes to yield a second molecule of ammonia and one of carbonic acid. The carbonic acid equilibrates in water, as do the two molecules of ammonia, which become protonated to yield ammonium hydroxide ions. The reaction results in an increased pH of the environment [reviewed in [2-5]]. In sites where microorganisms colonize epithelial surfaces, such as the normal flora of the oral cavity or intestines, or when certain pathogenic bacteria infect tissues, the metabolism of urea by microbial ureases can have a profound impact on tissue integrity, microbial ecology, and the overall health of the host.

The ureases of most microbes are composed of three subunits α, β, and γ that are encoded by ureA, ureB and ureC genes respectively. The plant jack bean produces a single-subunit urease [12], whereas, in gastroduodenal pathogen H. pylori, the ureA and ureB genes are sufficient to encode urease. Nevertheless the UreAB subunits of H. pylori can be aligned with the UreABC subunits of other ureolytic bacteria and with the single polypeptide of the jack bean urease. The crystal structure of the Klebsiella aerogenes urease reveals a trimeric configuration [13]. Biochemical analyses of ureases by gel filtration have shown that other bacterial ureases are multimeric and probably have similar stoichiometry [4].

Ureases are structurally complex enzymes, and additional urease subunits are required for the production of a catalytically active holoenzyme in-vivo. Ureases are among the few enzymes that require nickel for activity. Biogenesis of a functional urease in prokaryotes requires the presence and expression of four urease accessory genes, ureDEFG. In vitro experiments using purified accessory proteins support the idea that UreE likely acts as a carrier of nickel [14] and that UreDFG form a chaperone-like complex that keeps the apoenzyme in a configuration competent to accept nickel [15].

Urease activity can be a critical factor in the colonization, persistence and pathogenesis of bacteria. Considering the products produced by urease, it would be logical to assume that one of the enzyme's functions is to allow nitrogen assimilation. In fact, urea represents an assimilable nitrogen source for bacteria that can colonize the human body and there is evidence suggesting that ammonia assimilation from urea occurs in-vivo. A significant proportion of the urea produced in the liver ends up in the intestines, where it can be hydrolyzed and assimilated by several different species of anaerobic, ureolytic bacteria [3]. Similarly, the oral bacterium, Actinomyces naeslundii can use urea as a primary nitrogen source for growth [6]. So there is little doubt that nitrogen acquisition as the result of urease activity can be important in the ecology of complex populations colonizing the human body. However, it is an open question as to whether the capacity to assimilate ammonia produced by urease contributes to the pathogenic potential of bacteria. Instead, it appears that the release of the strongly alkaline ammonia released by urease is a major cause of the damage to the host tissue, and in some cases, a key factor in persistence of pathogens [reviewed in [2]]. Jubier-Maurin et al., (30) identified the nikABCDE operon encoding the specific transport system for nickel in B. suis. Insertional inactivation of nikA strongly reduced the activity of the nickel metalloenzyme urease, which was restored by addition of nickel excess. Intracellular growth rates of the B. suis wild-type and nikA mutant strains in human monocytes were similar, indicating that nikA was not essential for this type of infection.

The Brucellae are gram-negative, facultative intracellular bacterial pathogens of a wide range of vertebrates [7]. This pathogen is the etiologic agent of the disease brucellosis and the pathological manifestations of brucellosis include abortion and sterility in animals [7], and meningitis, endocarditis, spondylitis and arthritis in humans [8]. Paulsen et al., [9] annotated the genome of B. suis strain 1330 (biovar 1), and discovered that unlike many other organisms, Brucella have two urease gene operons located on chromosome I (GenBank accession no. NC_004310). Urease activity is important for the nitrogen assimilation and persistence of other bacterial species like Helicobacter pylori [10,11]. We investigated the role of the two B. suis urease operons on the infection, intracellular persistence, growth, and resistance to low-pH killing. We report that the B. suis ure1 operon, in contrast to ure2, appears to be principally responsible for determining urease activity, optimum growth and resistance to low-pH killing in-vitro and persistence in-vivo.

Results

Organization, and nucleotide and amino acid sequences of urease genes

The ure1 and ure2 operons are located on the chromosome I of B. suis strain 1330 (GenBank accession number NC_004310). The ure1 operon is 5284-bp long and composed of seven coding sequences (CDS). The ure2 operon is 6571-bp long and comprised eight CDS (Figure 1). The ureA gene was the same in size in both operons (302-bp). All the other genes of ure2 operon were slightly longer than their counterparts in ure1 operon. The ureC gene was the longest in each operon (1712-bp in operon-1 and 1721-bp in operon-2). The G+C content of each ure gene was compared with that of its counterpart of the other operon and found not differ substantially between ure genes of operon-1 and operon-2 (Table 1). The identity of each ure gene was compared with that of its counterpart of the other operon. The ureA, ureB, ureC, and ureG genes of the two operons exhibited 52 to 60% identity, whereas the ureD, ureE, and ureF genes did not share significant identity (Table 1).

Figure 1

The schematic representations of the ure operons with corresponding Ure subunits, and deletion sites of mutant strains 1330Δure1K, 1330Δure2K and 1330Δure2C. A: ure1 operon. B: ure2 operon. The numbers represent the location of the genes in the chromosome I.

Table 1

Sequence identities between the two B. suis urease operons

G+C Content			Gene comparison	Identity (%)
Gene	Operon-1	Operon-2
ureA	60.3	57.3	ure1A vs ure2A	52
ureB	58.4	58.1	ure1B vs ure2B	60
ureC	60.4	59.3	ure1C vs ure2C	55
ureD	62.0	58.1	ure1D vs ure2D	23
ureE	59.3	58.9	ure1E vs ure2E	Not significant
ureF	63.3	59.1	ure1F vs ure2F	Not significant
ureG	57.4	56.5	ure1G vs ure2G	54
ureT	-	60.4	-	-

The deduced amino acid sequences encoded by the ureA, ureB, and ureC genes in both operons displayed great identity with the structural urease subunits of a vast range of organisms including Gram-positive bacteria, Gram-negative bacteria, photosynthetic bacteria, fungi, and higher plants (see Table 5). For instance, urease subunits of other organisms exhibited up to 81% identity with the UreC of ure1 and up to 69% identity with the UreC of ure2. The ureases of alpha and beta-proteobacteria exhibited the greatest identity with UreC of operon-1, whereas, the ureases of all species of Yersinia exhibited the greatest identity with the UreC of operon-2.

Table 5

Identity of B. suis urease-1α and urease-2α sequences with the urease α subunits or urease proteins in GenBank

Accession numberWith urease-1α	Organism	Identity%
YP_221060.1|	Brucella abortus	99%
NP_540569.1|	Brucella melitensis	99%
NP_105696.1|	Mesorhizobium loti	81%
AAL83830.1|	Rhizobium leguminosarum	78%
NP_386576.1|	Sinorhizobium meliloti	79%
NP_355353.1|	Agrobacterium tumefaciens	78%
YP_166953.1|	Silicibacter pomeroyi	75%
EAQ05022.1|	Oceanicola batsensis	75%
BAB21067.1|	Rhodobacter capsulatus	75%
ZP_01056362.1|	Roseobacter sp.	73%
ZP_00962028.1|	Sulfitobacter sp.	73%
YP_109255.1|	Burkholderia pseudomallei	70%
AAA25151.1|	Klebsiella Aerogenes	68%
ZP_00990659.1|	Vibrio splendidus	69%
NP_286680.1|	Escherichia coli	67%
NP_886007.1|	Bordetella parapertussis	66%
ZP_00504504.1|	Clostridium thermocellum	63%
NP_176922.1|	Arabidopsis thaliana	64%
YP_248248.1|	Haemophilus influenzae	62%
NP_391545.1|	Bacillus subtilis	62%
ZP_00133792.2|	Actinobacillus Pleuropneumoniae	62%
ABC74584.1|	Yersinia enterocolitica	57%
AAK32714.1|	Helicobacter pylori	59%
NP_336355.1|	Mycobacterium tuberculosis	62%
AAZ99164.1|	Streptococcus vestibularis	57%
AAO85883.1|	Glycine max	63%
BAB78715.1|	Oryza sativa	62%
XP_750204.1|	Aspergillus fumigatus	62%
With urease-2α
NP_539564.1|	Brucella melitensis	99%
YP_222047.1|	Brucella abortus	99%
ZP_00828648.1|	Yersinia frederiksenii	69%
ZP_00797116.1|	Yersinia pestis (and all species of Yersinia)	69%
NP_929433.1|	Photorhabdus luminescens	67%
NP_929433.1|	Photorhabdus luminescens	67%
NP_241120.1|	Bacillus halodurans	59%
YP_237504.1|	Pseudomonas syringae	59%
NP_391545.1|	Bacillus subtilis	57%
YP_368247.1|	Burkholderia sp.	56%
ZP_00612021.1|	Mesorhizobium sp.	57%
NP_533073.1|	Agrobacterium tumefaciens	57%
YP_295218.1|	Ralstonia eutropha	56%
EAQ70376.1|	Synechococcus sp.	57%
105696.1|	Mesorhizobium loti	56%
YP_248248.1|	Haemophilus influenzae	56%
NP_979959.1|	Bacillus cereus	56%
NP_440403.1|	Synechocystis sp.	56%
AAG52306.1|	Arabidopsis thaliana	57%
ZP_00133792.2|	Actinobacillus Pleuropneumoniae	55%
ZP_00990659.1|	Vibrio splendidus	56%
NP_286680.1|	Escherichia coli	56%
YP_204056.1|	Vibrio fischeri	55%
AAP51176.1|	Helicobacter pylori	55%
BAB78715.1|	Oryza sativa	56%
AAR21273.1|	Streptococcus thermophilus	54%
NP_336355.1|	Mycobacterium tuberculosis	55%
AAC46128.1|	Bordetella bronchiseptica	52%
XP_658035.1|	Aspergillus nidulans	54%

Real-time PCR assays produced amplicons in sizes exactly similar to the expected sizes for each ure gene (data not shown). The UreB subunit in the ure2 operon contains a predicted hydrophobic signal sequence and suggests that the subunit may localize in the periplasmic space. All other Ure subunits lack any signal sequences and were predicted to localize in the cytoplasm (data not shown).

Genomic characterization of generated mutant B. suis strains

Four mutant B. suis strains were generated by allelic exchange, i.e., 1330Δure1K, 1330Δure2K, 1330Δure2C, and 1330Δure1KΔure2C. The PCR assays produced a predicted 2.2-kb amplicon from the wild type B. suis strain 1330 and an approximately 3.2-kb amplicon from the mutant strain 1330Δure1Kwith the ureONE-Forward and ureONE-Reverse primers (see Table 6); a predicted 2.2-kb-size amplicon from the strain 1330 and an approximately 2.8-kb product from strain1330Δure2K with ureTWO-Forward and ureTWo-Reverse primers; and a predicted 2.9-kb-sizeamplicon from the strain 1330 and an approximately 3.4-kb product from strain1330Δure2C with primers Ure-2-AB-Forward and Ure-2-AB-Reverse. The PCR assays with the primer pairs ureONE-Forward/ureONE-Reverse and Ure-2-AB-Forward/Ure-2-AB-Reverse confirmed that the double-mutant strain 1330Δure1KΔure2C carried a 575-bp deletion from the ure1DA region and a 1.2-kb deletion from the ure2ABC region (Figures 1A and 1B).

Table 6

Sequences of primers (5’ to 3’) used to amplify ure genes

Primer name	Sequence (5' to 3')
UreaseONE-Forward	CGACGCCGTAGGTAAATC
UreaseONE-Reverse	TGAAATGGACATGGGTATCG
UreaseTWO-Forward	GCTTGCCCTTGAATTCCTTTGTGG
UreaseTWO-Reverse	ATCTGCGAATTTGCCGGACTCTAT
Ure-2-AB-Forward	CGGGGATCCCATCACAATCGGCAAACA
Ure-2-AB-reverse	CGGTCTAGAATGGCGCGAAGGAAGGTT 3'

Expression of urease, urease enzyme activity and growth rates of B. suis strains

Native polyacrylamide gel electrophoresis revealed urease activity at approximately 95-kDa from strains 1330, 1330Δure2K and 1330Δure2C, but not from strains 1330Δure1K or 1330Δure1KΔure2C (Figure 2).

Figure 2

Native 8% polyacrylamide gel assay with B. suis extracts. Lanes-1: ladder; 2: B. suis strain 1330Δure1K; 3: strain 1330Δure2K; 4: strain 1330Δure2C; 5: strain 1330Δure1KΔure2C; and 6: strain 1330.

In a quantitative urease assay, mutants 1330Δure1K and 1330Δure1KΔure2C exhibited 0 activity, the wild type and the mutant 1330Δure2K displayed maximal activity, and mutant 1330Δure2C showed slightly reduced activity (Table 2). In qualitative urease assay, urease test broth started turning positive within 4 h after either strain 1330, 1330Δure2K, or 1330Δure2C were introduced, and acquired a bright pink color after approximately 24 h (Figure 3 and Table 2). In contrast, strains 1330Δure1K and 1330Δure1KΔure2C failed to cause a pink color in the urease test broth even after 96 h of incubation (Figure 3 and Table 2).

Table 2

B. suis strains: generation time (doubling time, h) in TSB and urease activity in urease test broth.

Strain	Doubling time (h)*	Urease activity
		Qualitative**	Quantitative***
1330	5.1	+	9.28
1330Δure1K	5.8	-	~0
1330Δure2K	5.3	+	9.38
1330Δure2C	5.1	+	8.28
1330Δure1K1330Δure2C	6.5	-	~0

*A representative experiment was used to calculate the generation time.

** + represents positive or pink color and – represents negative or yellow color of the uninoculated test broth; the color remained unchanged even 96 h after inoculation

***Specific activity μmoles/min/mg of protein.

Figure 3

Urease test broth 24 hours after inoculation with B. suis strains. Tube-1: strain 1330 (positive), 2: 1330Δure1K (negative), and 3: 1330Δure2K (positive).

Strains 1330Δure1K and 1330Δure1KΔure2C, both urease negative, grew approximately 25% slower than wild type strain 1330. In contrast, strains 1330Δure2K and 1330Δure2C, both urease positive, did not display any measurable differences in growth rate compared to strain 1330 (Table 2).

Survival of B. suis strains in macrophage cell lines

When used to infect J774A.1 or H36.12a [Pixie 12a] mouse macrophage cell lines, the recovery of all the B. suis strains declined 2–3 log10 cfu between 0 and 4 h post-inoculation. During the next 20 h, all the B. suis strains increased 1–2 log10 cfu. There were no significant differences between the wild type and the urease mutant strains in terms of their ability to replicate in macrophages (data not shown).

Survival of B. suis strains in BALB/c mice

Following an intraperitoneal inoculation, the recovery of ure mutants from spleens did not differ from the wild type strain at 6 wks post-infection (Table 3). When the mice were inoculated by gavage, one week after inoculation, strain 1330 was recovered from spleens (Figure 4) as well as from livers (Figure 5). When the mice were inoculated with strain 1330 supplemented with 10 mM urea, nearly 2.2 log10 greater cfu was recovered from spleens and nearly 3.5 log10 greater cfu was recovered from livers. However, when the mice were inoculated with strain 1330Δure1KΔure2C, with or without urea supplementation, no cfu were recovered from spleens (Figure 4) but nearly 2.5 log10 cfu was recovered from livers only when the inoculum was supplemented with 10 mM urea (Figure 5).

Table 3

Splenic recovery of B. suis strains six weeks after intraperitoneal inoculation in BALB/c mice

Strain	Injected dosage (log10 cfu/mouse)	cfu 6 weeks after inoculation (log10/spleen)a
Trial-1
1330 (wild)	5.24	4.41 ± 0.18†
1330Δure1K	5.24	4.61 ± 0.20†
1330Δure2K	5.22	4.40 ± 0.18†
1330ΔctpA (control)	5.25	2.04 ± 0.89‡
Trial-2
1330 (wild)	4.11	4.25 ± 0.23
1330Δure2C	4.16	4.17 ± 0.25
1330Δure1KΔure2C	4.28	4.19 ± 0.31

aIn Trial-1:P value for the difference among mean values was <0.005. The mean value of a strain designated by a dagger (†) is significantly different from the mean value of a strain designated by a double dagger (‡) but is not significantly different between strains designated by the same symbol.

In Trial-2: The observed significance level among mean values was < 0.1

Figure 4

Recovery of Brucella cfu from spleens one week after BALB/c mice were inoculated by gavage with wild type strain 1330 or strain 1330Δure1KΔure2C with or without urea supplementation. P value for the difference among mean values was <0.01. The mean values that share the same symbol do not differ from one another significantly; and the mean values designated by different symbols differ from one another significantly.

Figure 5

Recovery of Brucella cfu from livers one week after BALB/c mice were inoculated by gavage with the wild type strain 1330 or strain 1330Δure1KΔure2C with or without urea supplementation. P value for the difference among mean values was <0.025. The mean values that share the same symbol do not differ one another significantly; and the mean values designated by different symbols differ one another significantly.

In Trial-2: The observed significance level among mean values was < 0.1