Platinum(II) and palladium(II) complexes of pyridine-2-carbaldehyde thiosemicarbazone as alternative antiherpes simplex virus agents.

The cytotoxicity and the antivirus activity of Pd(II) and Pt(II) complexes with pyridine-2-carbaldehyde thiosemicarbazone (HFoTsc) against HSV replication were evaluated on four HSV strains-two wt strains Victoria (HSV-1) and BJA (HSV-2) and two ACV(R) mutants with different tk gene mutations R-100 (TK(A), HSV-1) and PU (TK(N), HSV-2). The experiments were performed on continuous MDBK cells and four HSV 1 and HSV 2 strains were used, two sensitive to acyclovir and two resistant mutants. The five complexes of HFoTsc, [Pt(FoTsc)Cl], [Pt(FoTsc)(H(2)FoTsc)]Cl(2), [Pt(FoTsc)(2)], [Pd(FoTsc)(H(2)FoTsc)]Cl(2), and [Pd(FoTsc)(2)], were found to be effective inhibitors of HSV replication. The most promising, active, and selective anti-HSV agent was found to be complex [Pt(FoTsc)(H(2)FoTsc)]Cl(2). This complex could be useful in the treatment of HSV infections, since it is resistant to ACV mutants. PCR study of immediate early 300 bp ReIV Us1 region reveals that the complex [Pt(FoTsc)(H(2)FoTsc)]Cl(2) specifically suppressed wt HSV-1 genome 2 hours after the infection, not inducing apoptosis/necrosis on the 8 hours after virus infection. The target was found to be most probably the viral, instead of the host cell DNA.

1. INTRODUCTION

Herpes simplex viruses (HSVs) are highly adapted human pathogens with rapid lytic cycle and ability to invade sensory neurons. The primary agents of recurrent facial and genital herpes lesions are HSV-1 and HSV-2 while genital herpes (GH) is the most common sexually transmitted infection in the world [1-3]. Moreover, GH is the main factor of increasing three to five times the risk of HIV transmission, stimulating HIV replication, and finally leading to the progression of AIDS [4-6]. Acyclovir (ACV) is a prodrug and it is the first nucleoside-based therapeutic effective for the treatment of primary and recurrent HSV infections [7]. Effective HSV suppression with ACV indirectly lowers the HIV load. ACV has to be phosphorylated by the viral thymidine kinase (TK) and subsequently by cellular kinases in order to inhibit competitively HSV DNA polymerase and to terminate the viral DNA chain elongation. However, under systematic administration, resistant mutants appeared with high frequency and their main sources are immune-compromised individuals [7-9]. The two most common causes of resistance are mutations in thymidine kinase (TK) gene, approximately 95% to 96% of ACV-resistant (ACVR) HSV isolated are thymidine-kinase-(TK-)deficient (TKN) or TK-partial (TKP) and the remaining isolates are usually TK-altered (TKA) mutants unable to phosphorylate the prodrug but not the thymidine [9]. The problem for effective treatment of HSV infections is still open, since the resistance to ACV and the cross-resistance to other nucleoside analogs increase with relatively high frequency.

The earliest antivirals are thiosemicarbazones, Tscs. The bioactivity of Tscs is due to the inhibition of ribonucleotide reductase (RR) and due to complexation with essential metals [10-12]. The activity of Pt(II) and Pd(II) complexes of pyridine-2-carbaldehyde (HFoTsc) against the replication of wild type (wt) HSV-1, was recently referred to by Varadinova et al. [13]. The antiviral activity of platinum complexes with antiviral agents acyclovir, penciclovir, and famciclovir has been recently reported [14-16].

The aim of the present study was to evaluate comparatively the activity of complexes of Pd(II) and Pt(II) with pyridine-2-carbaldehyde thiosemicarbazone (HFoTsc) against HSV replication. Special attention was given to the efficacy of compounds against ACVR viruses.

2. EXPERIMENTAL

2.1. Metal complexes

Solvents were purified and dried according to standard procedures. The ligand HFoTsc, 1, and the complexes of Pt(II) and Pd(II) [PtCl(FoTsc)], 2, [Pt(FoTsc)(H, 3, [Pt(FoTsc), 4, [PdCl(FoTsc)], 5, [Pd(FoTsc)(H, 6, and [Pd(FoTsc), 7, were prepared (see Scheme 1) by some of us, as described in the literature [13, 17, 18].

Scheme 1

The reaction scheme for the synthesis of the complexes of Pd(II) and Pt(II) with FoTsc {[M(FoTsc)Cl], [M(FoTsc)(H, [M(FoTsc)} [19, 20].

All the compounds were firstly dissolved in DMSO (Koch-Light Laboratories Ltd, England) till the concentration of 1 M (stock solutions). Serial tenfold dilutions (100–0.000001 μM) were made from them in cells growth medium DMEM (Gibco, USA) supplemented with 5% bovine serum (BS; BioWhittaker, Germany) and antibiotics (penicillin G, 100 units/mL, Balkanpharma, Bulgaria).

2.2. Cells and viruses

Continuous Madin-Darbey bovine kidney (MDBK) cells were used in the experiments. The cells were grown at 37°C in DMEM medium supplemented with 10% BS and antibiotics. During the experimentations, BS content was reduced to 5%. Antiviral experiments were done on the following four viruses: two wild (wt) strains Victoria (HSV-1) and BJA (HSV-2) and two ACVR mutants with different TK gene mutations R-100 (TKA, HSV-1) and PU (TKN, HSV-2). Viruses were grown in MDBK cell monolayers. Cultures were harvested at full cytopathic effect (CPE), froze, thawed, and stored at −70°C.

2.3. Cytotoxicity and (HSV) assays

Confluent cell monolayers were washed and covered with media containing the compounds and cultured at 37°C for 48 hours. Cytopathic effect (CPE) was read by microscopy of unstained cell monolayers. Cell number was counted by the Trypan blue-dye exclusion method.

The cytotoxic concentration CC50 (concentration preventing the death of 50% of cells) and the maximal nontoxic concentration, MNC, were calculated from dose-response curves. The maximal concentration causing no cytotoxicity which does not alter the morphology of monolayers and the cell survival rate was recognized as MNC.

The antiviral activity of the complexes 1–7 against HSV replication was evaluated on the basis of their effects on the infectious HSV titer. MDBK cells were grown in 96-well plates and were infected with particular virus in serial tenfold dilutions. After 1 hour of virus attachment, infected cells were covered with medium and the tested compound in serial tenfold dilutions (starting from MNC) and cultured at 37°C for 48 hours (for wt strains) or 72 hours (for ACVR mutants). Inhibitory concentrations required to inhibit virus yield by 50% (IC50) were calculated from dose-regression curves and were indicative for anti-HSV activity. In order to be able to compare the compounds on the basis of their selective inhibition of virus replication versus cytotoxicity, selective indexes (SI) were calculated as CC50 to IC50 ratio. The data were compared with that of ACV.

2.4. Direct PCR for determination of the effect on the expression of the immediate early (IE) reiterating region IV (ReIV)

Infected and mocked infected cells cultured in compound-free medium served as controls. PCR amplification 22 bp primers (Applied Biosystems, Calif, USA) were designed according to Maertzdorf et al. [21] to amplify 300 bp Us1 ReIV region of HSV-1 genome positions 132333-132634. The sequences (5′ → 3′) of the primer were ReIVUs1F-5′TCCGACGACAGAAACCCACC3′ and ReIVUs1R-5′GTCCCGGAGGACCACAGTGG3′. PCR was performed in a ready-to-go-PCR beads thermocycle (Amersham-Pharma Biotech, NJ, USA).

A 2 μl sample of DNA suspension was added to the reaction mixtures and was overlaid with 25 μl of mineral oil (CinnaGen Inc, Iran). PCR amplification was carried out as follows: an initial denaturation step of 94°C for 5 minutes followed by 35 cycles of alternating denaturation (94°C for 30 seconds), primer annealing (60°C for 60 seconds), and primer extension (72°C for 60 seconds). A final extension step of 5 minutes at 72°C was included. The PCRs were performed in 10 μl volume. Briefly, 2 μl of each sample were added to a separate tube containing 100 μl of lysis buffer (Applied Biosystems) and stored at −20°C over night. After centrifugation at 12000 rpm for 5 minutes, the lysis buffer was removed, pellets were resuspended in nucleolysis buffer (300 μl) phenol (Sigma Corporation of America, NY, USA), pH 7.8; 300 μl chloroform: isoamyl alcohol = 24 : 1 (Sigma Corporation of America), and centrifuged at 12000 rpm for 5 minutes. DNA was extracted by resuspending the pellets in 10% SDS (Sigma Corporation of America) 10 mg/mL proteinase K (Pharma Biotech, USA), 10 mM Tris (Sigma Corporation of America ) and 0.1 mM EDTA (Sigma Corporation of America) at pH 7.4 and centrifuged at 12000 rpm for 5 minutes. A volume of 2 μl of supernatants containing 50–100 ng of the resulting DNA suspension was used per PCR mixture. The reaction mixture contained 5 U/μl cloned recombinant thermostable STS DNA taq polymerase (Applied Biosystems), corresponding primers at a concentration of 20 μl/mL each, and 5 mM/μl deoxynucleoside triphosphate (Pharma Biotech). Amplicons were electrophoresed on a 2% agarose gel and were visualized by ethidium bromide staining.

2.5. Apoptosis/necrosis in the noninfected cells and in cells infected with HSV

The staining methods of one-chain double-helices DNA have been used with 0.1% solution of acridine orange, and for mitochondria a solution of 0.1% of Janus green B has been used. An eukaryotic model of cells infected with HSV virus was used and the following modifications in the purpose of adapting the method to the corresponding system were adapted: (1) fixing of the cell with methanol not with formaldehyde; (2) after a standard procedure of staining in view of a further conservation of the preparations, treating with glycerol PBS = 1 : 1 was used. The experiments were carried out at the 8 hours of infection in the initial period of active virus morphogenesis. The following have been used as controls: (1) cells not infected and untreated with the investigated compounds; (2) cells not infected but treated with compounds; (3) cells infected with HSV and cultivated in a medium without an inhibitor.

The indicators for the lack of apoptosis/necroses were (1) the apple green fluorescence of cytoplasm and the nuclei according to the staining test with acridine orange; (2) a diffuse distribution of mitochondrial, glowing in green according to the staining test with Janus green B.

The indicators of apoptosis were a glowing of the nuclei in yellowish-red on a glowing of the cytoplasm in yellowish-green; a margination of chromatin; and an ejaculation of the nucleus content.

3. RESULTS AND DISCUSSION

CC50 and MNC values were calculated from dose-response curves and were presented in Table 1. All the compounds 1–7 exhibit lower cytotoxicity than ACV. MNC ranged from 1–100 μM. Among them, higher cytotoxicity exhibits [Pt(FoTsc) and [Pd(FoTsc)Cl]. These two complexes are 50 times, [Pd(FoTsc)(H and [Pd(FoTsc) are 500 times, and HFoTsc, [Pt(FoTsc)Cl] and [Pt(FoTsc)(H are 5000 times less cytotoxic than ACV. The less cytotoxic compounds were HFoTsc (1) and its Pt(II) complexes 2 and 3. The structure of 3 corresponds to [M(FoTsc)(H [22-24]. Obviously, the protonated ligand in zwitterion form H decreases the cytotoxicity of Pt(II) but not of Pd(II), complex 6.

Table 1

MNC, CC50, and IC50 (in μM) of HFoTsc and its Pt(II) and Pd(II) metal complexes; NA: not active and ND: not done.

Number	Compound	CC50	MNC	Victoria	BJA	IC50 R-100	PU
1	HFoTsc	830	100	0.001	0.1	1	1
2	[Pt(FoTsc)Cl]	548	100	0.1	5	0.1	0.1
3	[Pt(FoTsc)(H2FoTsc)]Cl2	5820	100	0.01	0.1	1	1
4	[Pt(FoTsc)2]	40	1	0.006	0.001	0.5	0.5
5	[Pd(FoTsc)Cl]	69	1	NA	ND	ND	ND
6	[Pd(FoTsc)(H2FoTsc)]Cl2	63	10	10	0.01	0.1	0.1
7	[Pd(FoTsc)2]	59	10	0.06	1	1	1
8	ACV	25	0.02	0.0002	0.002	0.02	0.02

The data presented on Table 1 show that the cytotoxicity of compounds 1–7 was predetermined by complex specificities.

The activity of compounds 1–7 was evaluated against wt HSV-1, strain Victoria, infection in cultured cells, and the data were compared to that of ACV. The complex 5 did not exhibit any effect on the infectious virus yield and it was excluded from further investigations. The rest of the compounds 1–4, 6–7 were further evaluated against wt HSV-2 strain BJA and two ACVR mutants with different TK gene mutations-R-100 (TKA) and PU (TKN), see Table 2.

Table 2

Selectivity of HFoTsc and its Pt(II) and Pd(II) complexes against HSV infection in cultured cells.

Number	Compound	Selective index (SI)
		Victoria	BJA	R-100	PU
1	HFoTsc	830 000	7000	900	700
2	[Pt(FoTsc)Cl]	5480	110	6400	6200
3	[Pt(FoTsc)(H2FoTsc)]Cl2	582000	52000	5300	5200
4	[Pt(FoTsc)2]	6667	20 000	7200	40
6	[Pd(FoTsc)(H2FoTsc)]Cl2	6.3	6300	6300	1000
7	[Pd(FoTsc)2]	983	59	590	58
8	ACV	125000	10 000	1000	1000

The compounds 1–4 and 6-7 effectively inhibited the growth of wt and of ACVR, HSV-1 and HSV-2 strains and the effect were found to be predetermined by both complex and virus specificities. The most effective inhibitor of the wt HSV-1 growth was the ligand 1 while complex 4 was most sensitive to wt HSV-2. On the contrary, the growth of ACVR viruses was effectively suppressed by the complexes 2 and 6. The complexes of Pt(II) and Pd(II) and HFoTsc are arranged according to their efficacy against all four HSV strains in the following order: The selectivity of compounds 1–7 is shown in Table 2 and it was found to be predetermined by both complex and virus specificities. Complexes 1–7 are arranged according to their selectivity in the following order against all four strains:

for wt HSV-1: 1 > 4 > 3 > 2 > 7 ≫ 6;

for wt HSV-2: 4 > 6 > 1 = 3 ≫ 2 > 7;

for ACVR mutants R-100 and PU: 2 = 6 ≫ 4 > 3 = 7.

for wt HSV-1: 1 > 3 ≥ ACV > 4 > 2 ≥ 7 ≫ 6;

for wt HSV-2: 3 > 4 > ACV > 1 ≥ 6 ≫ 2 > 7;

for ACVR strain R-100: 4 > 2 = 6 > 3 > ACV > 1 > 7;

for ACVR strain PU: 2 > 3 > 6 = ACV > 1 > 7 = 4.

The complex 3 was more sensitive to wt HSV strains, while the complex 2 was more sensitive to ACVR mutants. The complex 7 was the less active and selective inhibitor of HSV replication and the complex 3 selectively inhibited the replication of both wt and ACVR viruses.

The significant activity and selectivity of 3 are probably due to the negative influence on several viral targets. This is based on the fact that in solution, [M(FoTsc)(H complexes dissociate to the metal complex [M(FoTsc)Cl] and the protonated ligand H [22, 23], thus simultaneously suppressing virus-specific RR and the synthesis of DNA progeny.

Virus-specific proteins were identified on the 15 hours by Western blot analysis. Eleven virus-specific proteins were identified in viral control: VP5, VP22, VP23, α-TIF, TK, gB, gC, gE, gD, gH, and gG. In the compounds 1, 3, and 4, VP23, TK, gG/gD, α-TIF, gH, and gE were not identified, see Table 3. These data suggest that compounds 1, 3, and 4 also suppress the morphogenesis, cell-to-cell spread, and transactivation of virus genomes.

Table 3

Data of 1, 3, and 4 for virus-specific proteins from Western blot analysis.

Protein	Kinetic group	MM, kd	Gene	1	3	4	HSV-1 control
VP26	γ2	12	UL35	+	+	+	+
VP24	γ	25	U 49	−	+	+	−
VP22	—	29	UL26	−	−	+	+
VP22/22a	γ1	39–50	UL48	−	+	+	+
α-TIF	γ1	53	Us4/	+	−	−	+
gG/gD	γ1	59	Us6	−	+	−	+
VP11	γ1	71	UL46	−	+	−	+
gE	γ1	90	Us8	−	+	+	+
gH	γ2	110–115	UL22	+	+	+	−
gC	γ2	130	UL44	+	+	—	+
VP5	γ1	155	UL19	+	+	+	+
Pre-	β2/γ1	178–195	UL27	+	−	+	−
gB	β2/γ1	240	UL27	+	+	+	+

In view of the fact that HFoTsc and 3 are not only effective and selective HSV inhibitors, but they also suppress the expression of the essential structure proteins from the β(E) and γ(L) kinetic groups, whose synthesis is impossible without α, IE proteins, the effect of 3 over the expression of the immediately earliest α, IE genes by means of a direct PCR was studied. A direct multiplication was used with PCR by a primer, determining region 300 bp, corresponding to ReIV region of Us1. The results of the gel electrophoresis of DNA extracted from viral infected control cells and treated for 2 hours after infection with the HSV-1 with MNC of [Pt(FoTsc)(H, 3 and HFoTsc and 1 are shown in Figure 1. Just as expected, it was observed that the DNA of control MDBK cells appears as a band corresponding to genomic DNA (Figure 1, lane 3). Incubation of the HSV-1 infected cells with the MNC of [Pt(FoTsc)(H, 3 or the HFoTsc, 1 ligand resulted in a “DNA smears,” which shows the nonspecific fragmentation of DNA (Figure 1, lanes 5 and 6, resp.). The results received by direct PCR show that [Pt(FoTsc)(H, 3 (lane 5), and the ligand HFoTsc 1 (lane 6) suppress the expression of the α, IE virus genes. Altogether, these data suggest that in MDBK infected cells, the nonspecific destruction of viral DNA is obviously caused by Pt(II) ions [25, 26] and may be due to a specific induction of apoptosis.

Figure 1

Amplification of ReIV containing region within wt HSV-1 genome. (1) negative control (lane 1); (2) markers (lane 2); (3) cell control (mock-infected cells cultured in compound-free medium) (lane 3); (4) positive control (HSV-1-infected cells cultured in compound-free medium) (lane 4); (5) [Pt(FoTsc)(H, 3 (lane 5), and (6) HFoTsc, 1 (lane 6).

The effect of 3 on programmed cell death was evaluated morphologically in order to study if the observed DNA fragmentation is cell- and/or virus-specific. Using acridine orange and Janus B green staining morphological changes leading to irreparable margination of chromatin, an ejaculation of the nucleus content and other indicators for apoptosis were not found in wt HSV-1 nor in mock-infected cells on the 8 hours after the action of [Pt(FoTsc)(H, 3. It was observed that complex 3 specifically affects HSV replication simultaneously suppressing virus-specific RR and DNA polymerase and the expression of virus genome immediately after entering host cell nucleus. This also explains the nonspecific virus response to [Pt(FoTsc)(H.

The experimental data show that [Pt(FoTsc)(H · Cl complex is a promising anti-HSV agent which could be useful in the treatment of HSV infections, especially when the causative agent is resistant to ACV mutants. The platinum complex [Pt(FoTsc)(H decreases the cytotoxicity of Pt(II) ion and directs its activity to viral and not to host cell DNA.