Literature DB >> 17359980

Characterisation of cyclin D1 down-regulation in coronavirus infected cells.

Sally M Harrison1, Brian K Dove, Lisa Rothwell, Pete Kaiser, Ian Tarpey, Gavin Brooks, Julian A Hiscox.   

Abstract

The positive strand RNA coronavirus, infectious bronchitis virus (IBV), induces a G2/M phase arrest and reduction in the G1 and G1/S phase transition regulator cyclin D1. Quantitative real-time RT-PCR and Western blot analysis demonstrated that cyclin D1 was reduced post-transcriptionally within infected cells independently of the cell-cycle stage at the time of infection. Confocal microscopy revealed that cyclin D1 decreased in IBV-infected cells as infection progressed and inhibition studies indicated that a population of cyclin D1 could be targeted for degradation by a virus mediated pathway. In contrast to the SARS-coronavirus, IBV nucleocapsid protein did not interact with cyclin D1.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17359980      PMCID: PMC7094712          DOI: 10.1016/j.febslet.2007.02.039

Source DB:  PubMed          Journal:  FEBS Lett        ISSN: 0014-5793            Impact factor:   4.124


Introduction

The ordered growth and division of cells is described as the cell cycle, which can be separated into a number of distinct phases, gap 1 (G1), synthesis (S), gap 2 (G2) and mitosis (M) [1] followed by cytokinesis [2]. Each stage of the cell cycle is regulated and controlled by both positive and negative regulators, for example cyclins and their partner molecules, the cyclin dependent kinases (CDKs) and associated inhibitor complexes (CDKIs) [3]. Many viruses interact with the cell cycle to promote favourable conditions for virus infection and for disrupting host cell proliferation and function [4]. However, the alteration of the host cell cycle by RNA viruses has not been described as extensively when compared to DNA or retroviruses. Coronaviruses are a family of positive strand RNA viruses which replicate in the cytoplasm of infected cells and belong to the order Nidovirales [5]. Infection of cells with the avian coronavirus infectious bronchitis virus (IBV) causes a G2/M phase arrest [6], with changes in the amounts of proteins involved in cell cycle regulation, such as a reduction in cyclin D1 [6]. In the case of the murine coronavirus, mouse hepatitis virus (MHV), infection results in an arrest in the G0/G1 phase of the cell cycle with a resulting decrease in the D‐type cyclins [7]. Over‐expression studies indicated that a component of the viral replicase could arrest cells in this phase of the cell cycle [8]. On the other hand, in patients infected with severe acute respiratory syndrome (SARS) coronavirus hepatocytes have been reported to accumulate in mitosis [9] and this is in contrast to a number of SARS‐coronavirus proteins that when over expressed lead to an accumulation of cells in the G0/G1 phase of the cell cycle [10, 11]. For example, the SARS‐coronavirus nucleocapsid (N) protein has been reported to block S phase progression [12] and prolong the G0/G1 phase and shorten the S phase [13]. Likewise, when over expressed the IBV N protein delays cell growth and results in aberrant cytokinesis [14, 15], which is also observed in infected cells [6, 15]. Cyclin D1, when complexed with either CDK 4 or 6, positively regulates progression of cells through the G1‐S phase of the cell cycle. Like all cyclins, levels of cyclin D1 fluctuate depending on the particular stage of the cell cycle, with levels of cyclin D1 accumulating in the G1 phase. Cyclin D1 is then rapidly degraded via the cellular proteosome during S phase allowing DNA synthesis to occur [16]. Levels then begin to rise again during the G2 and M phases of the cell cycle. Regulation of cyclin D1 expression is controlled by the abundance of cyclin D1 mRNA, sub‐localisation and degradation [17]. In this study the reduction of cyclin D1 was investigated in IBV infected cells.

Materials and methods

Cells and viruses

The growth and titration of IBV Beaudette‐US, an embryo‐adapted IBV strain [18], and the growth of Vero cells were performed as described previously [6]. Cell culture experiments were performed within sub‐confluent cells to avoid artefact G0/G1 populations due to contact inhibition and in the absence of antibiotic or anti‐fungal agents. Cells were infected with IBV at 2 × 106 pfu/ml (∼MOI = 1) at 70% confluent and incubated for 1 h at 37 °C, after which the virus was replaced with cell growth media. UV inactivation of IBV was performed as described previously [6].

Vero cell enrichment

Vero cells were cell‐cycle enriched as described previously [6] by serum deprivation (G0), double thymidine treatment (G1/S) and nocodazole treatment (G2/M) [6]. The efficiency of cell cycle synchronisation was determined by flow cytometric analysis [6].

Treatment of cells with LiCl and MG132

Vero cells were seeded at 2 × 105 and grown to 70% confluency before being mock or IBV infected at 2 × 106 pfu/ml. At 8 h post infection the cells were treated with 10 μM MG132 or 0.5, 1, 2.5 or 5 mM LiCl or a combination of both where detailed. At 24 h post infection the cells were lysed and total cellular protein quantified by BCA assay. Western blot analysis was then performed using antibodies against cyclin D1, GAPDH and IBV proteins. Alternatively, cells were fixed and made permeable for subsequent immunofluoresence analysis.

Leptomycin B (LMB) treatment of cells

Mock and IBV‐infected Vero cells were treated with 2.5 ng/ml LMB at 1 h post infection. At 16 h post infection, cells were processed as appropriate either for Western blot or immunofluoresence analysis. LMB activity was shown using a previously described luciferase assay [19] and carried out in triplicate.

Transient cell transfection and plasmids

Vero cells were cultured in six well plates until 70% confluent, then transfected with l μg of plasmid DNA using Lipofectamine transfection reagent (Invitrogen). The constructs utilised in this study, pEGFP‐IBVN or PEGFP‐IBVNΔNES, were used for the expression of either wild type N protein or N protein in which nuclear export signal has been deleted, are fused to EGFP [20, 21, 22]. The ECFP‐cyclin D1 fusion protein expression plasmid, pECFP‐cyclin D1 was constructed by amplifying human cyclin D1 from a Gateway Destination Vector (pEXP1‐dest) (Invitrogen) containing cyclin D1, using the following primers which incorporated a SacII and XhoI restriction: Forward: 5′ GGAATATTCTCGAGCGATGGAACACCAGCTC 3′ and Reverse 5′ TTATTATTCCGCGGCTAGATGTCCACGTC 3′, before being ligated into pECFP‐C1 (cyan fluorescent protein).

Western blot analysis

Mock, UV inactivated virus treated and IBV infected Vero cells were harvested 24 h post‐infection and lysed with radioimmuoprecipitation (RIPA) buffer. Total protein was quantified by BCA assay (Promega) and 10 μg of total protein from each sample was analyzed by Western blot [6]. IBV proteins were detected with chicken anti‐IBV polyclonal sera (1:20 000, Charles River). Cyclin D1 was detected with a rabbit anti‐cyclin D1 polyclonal antibody (1:500, Santa Cruz). Mouse anti‐GAPDH (6C5) monoclonal antibody (1:40 000, AbCam) was used to detect glyceraldehyde‐3‐phosphatedehydrogenase (GAPDH).

Cellular RNA preparation

Total cellular RNA was extracted at 0 h and 24 h post‐infection by the RNeasy method (Qiagen).

Taqman analysis of cyclin D1 mRNA

Cyclin D1 mRNA levels in mock, IBV infected and cells treated with UV‐inactivated virus were quantified by TaqMan real time PCR. Primers and probes for both cyclin D1 and 28S were designed using the Primer Express software program (Applied Biosystems). Cyclin D1 forward primer: GTGAACAAGCTCAAGTGGAACCT; reverse primer: TGGCATTTTGGAAAGGAAGTG; probe: TGACCCCGCACGATTTCATCGA. 28S forward primer: GGCGAAAGACTAATCGAACCAT; reverse primer: CGAGAGCGCCAGCTATCCT; probe: TAGTAGCTGGTTCCCTCCGAAGTTTCCCT and experiments performed as described previously [23, 24]. Where appropriate these probes were designed across exon–exon boundaries so no genomic DNA or unprocessed RNA would be amplified. IBV genomic RNA was quantified using previously describe primer/probe sets: forward primer: CGTACCGGTTCTGTTGTGTGA; reverse primer: GCCCAACGCTAGGCTCAA and probe: TCACCTCCCCCCACATACCTCTAAGGG [25]. Quantification was based on increased fluorescence detected due the 5′ exonuclease activity of the Taq DNA polymerase during PCR amplification hydrolysing the target specific probes. The reporter signal was normalised by the reference dye 6‐carboxy‐c‐rhodamine, which was not actually involved in amplification. Results were expressed in terms of C t values (threshold cycle value); the cycle at which the change in reporter dye passes a significance threshold (ΔR n). Variation in sampling and RNA preparation was accounted for by standardising the C t values for gene‐specific products for each sample to the C t value of 28S rRNA product for the same sample. RNA levels between samples in the same experiment were normalised by pooling values from all samples in that experiment and calculating the mean C t value for 28S rRNA‐specific gene product. Variations in each individual 28S rRNA sample compared to the mean were then calculated. Differences in input of total RNA were calculated by determining the slope of the 28S rRNA log10 dilution series regression line. Using the slopes of the respective gene specific or 28S rRNA log10 dilution series regression lines, the difference in input total RNA, as represented by the 28S rRNA, was then used to adjust the gene specific C t values [25]. This was done as follows:where C t is the mean sample C t; N t is the experimental 28S mean; C t′ is the mean 28S of sample; S is the IBV 5′ UTR/IBV 3′UTR slope; and S′ is the 28S slope. Results were then expressed as 40‐C t values.

Analysis of the sub‐cellular localisation of native cyclin D1

Confocal sections were captured using a Zeiss LSM 510 Meta laser scanning confocal microscope [26]. Native cyclin D1 was labelled with rabbit anti cyclin D1 (1:200, Santa Cruz) and detected with either goat anti rabbit FITC (1:200, Sigma) (green) or chicken anti rabbit Texas Red (1:200, Sigma) (red). Where appropriate, IBV‐infected cells were fixed post‐infection and IBV proteins were labelled with chicken anti‐IBV polyclonal sera (1:200, Charles River) and detected with rabbit anti chicken antibody conjugated to AlexaFluor633 (Molecular Probes/Invitrogen 1:200) (far red). Images were scanned four times. No cross talk between channels was determined by switching off the appropriate excitation laser and imaging the corresponding emission. In cells co‐transfected with pEGFP‐IBVN and pECFP‐cyclin D1 the respective fusion proteins were analyzed by meta‐confocal microscopy [21, 27].

Results and discussion

To determine whether the reduction of cyclin D1 protein was caused by replicating virus or as a cellular response to the presence of virus particles, the amount of cyclin D1 protein from IBV infected or UV‐inactivated virus treated cells was compared to that of mock‐infected cells (Fig. 1 A). Densitometric analysis indicated there was an approximately 14‐fold reduction in the level of cyclin D1 protein in IBV‐infected cells compared to either mock‐infected or cells treated with UV‐inactivated virus (data not shown). This data are in contrast to the retrovirus, HIV, and DNA virus, cytomegalovirus, which can cause cell cycle perturbations in the absence of replicating virus [28, 29]. UV‐inactivation of IBV was determined by Western blot analysis to detect viral proteins (Fig. 1A) and RT‐PCR to viral RNA (data not shown). No viral RNA or their products were detected in cells treated with UV‐inactivated virus.
Figure 1

Western blot analysis of cyclin D1 (A) and IBV proteins (B) in mock‐infected (mock) or cells infected with IBV (IBV) or treated with UV‐inactivated IBV (UV). Time post infection is indicated above the respective lane and the migration of molecular weight markers is indicated to the left. Equal protein loading was confirmed by Western blot analysis of GAPDH. The data shown is one of three separate experiments. (C) TaqMan analysis of the amount of cyclin D1 mRNA at the indicated times (h) in asynchronously (AS) replicating cells either mock (M) or infected with IBV (I) or treated with UV‐inactivated virus (UV).

Western blot analysis of cyclin D1 (A) and IBV proteins (B) in mock‐infected (mock) or cells infected with IBV (IBV) or treated with UV‐inactivated IBV (UV). Time post infection is indicated above the respective lane and the migration of molecular weight markers is indicated to the left. Equal protein loading was confirmed by Western blot analysis of GAPDH. The data shown is one of three separate experiments. (C) TaqMan analysis of the amount of cyclin D1 mRNA at the indicated times (h) in asynchronously (AS) replicating cells either mock (M) or infected with IBV (I) or treated with UV‐inactivated virus (UV). Real‐time RT‐PCR (TaqMan) was used to quantify the amount of cyclin D1 mRNA between mock‐infected, UV‐inactivated virus treated and IBV‐infected cells. Total RNA was prepared from the three separate experiments and cyclin D1 mRNA from each sample analyzed in triplicate. Representative data from one experiment is shown (Fig. 1B). There was no significant difference in the level of cyclin D1 mRNA between each population, suggesting the reduction of cyclin D1 in IBV‐infected cells is post‐transcription. To confirm that real‐time RT‐PCR could distinguish between different levels of RNA, the amount of virus RNA was assayed at 0, 1, 4, 8, 12 and 24 h pi, using primer and probe sets to detect viral genomic RNA. The results indicated that there was an approximately 8‐fold increase in viral genomic RNA between 1 and 24 h post‐infection (each 40‐C t value indicates a twofold difference) (Table 1 ) and demonstrated that real‐time RT‐PCR can distinguish changes in RNA levels.
Table Table 1

Real time RT‐PCR analysis of IBV genomic RNA levels during a 24 h infection in Vero cells as shown by corrected 40‐C t values

Time post‐infection (h)Correct 40‐C t values
00
112.704 ± 0.391
410.336 ± 0.045
814.545 ± 0.183
1215.076 ± 0.119
2416.068 ± 0.124
Real time RT‐PCR analysis of IBV genomic RNA levels during a 24 h infection in Vero cells as shown by corrected 40‐C t values Although IBV will infect dividing cells one of the major targets of infection is the upper epithelial cell layer [30] which contains quiescent cells in the G0 phase of the cell cycle. In order to model this, Vero cells were enriched in the G0 phase of the cell cycle by serum starvation which was confirmed by flow cytometry [6] (Fig. 2 A), resulting in an average of 87% of cells in the G0 phase, 10% in the S phase and 3% in the G2/M phase of the cell cycle. This compared to non‐confluent asynchronously growing cells, in which an average of 58% of cells are in G0/G1, 38% in S phase and 4% in the G2/M phase (data not shown and [6]). The cells were then simultaneously released and treated with either UV‐inactivated virus or infected with IBV and the levels of cyclin D1 protein (determined by Western blot) and mRNA (determined by TaqMan as per above) compared to that of mock‐infected cells at 24 h post‐infection and release. The data indicated that the amount of cyclin D1 protein was reduced in IBV infected cells compared to mock‐infected or UV‐inactivated virus treated cells (Fig. 2B). However, the level of cyclin D1 mRNA was not significantly different for cells either treated with IBV or UV‐inactivated virus or left untreated (Fig. 2C). However, there was an approximately fourfold increase (two 40‐C t values) in cyclin D1 mRNA in these cells compared to cells at 0 h (Fig. 2C), which may reflect an increase in mRNA and protein synthesis due to entry into the cell cycle.
Figure 2

(A) Propidium iodide (PI) plot and BrdU/PI staining of cell cycle profiles of cells enriched in the G0 phase of the cell cycle using serum starvation (for the latter plot the X‐axis is the intensity of PI staining and the Y‐axis is the intensity of BrdU staining). (B) Western blot analysis of GAPDH, cyclin D1 and IBV proteins in mock infected cells (Mock) and cells treated with UV‐inactivated virus (UV) and infectious virus (IBV) at the times indicated post‐infection (h) in cells enriched in the GO phase of the cell cycle and then released. The migration of molecular weight markers is indicated to the left. (C) TaqMan analysis of the amount of cyclin D1 mRNA in cells enriched in the G0 phase of the cell cycle (indicated G0) and then released at the indicated times (h), in either mock (M) or cells infected with IBV (I) or treated with UV‐inactivated virus (UV).

(A) Propidium iodide (PI) plot and BrdU/PI staining of cell cycle profiles of cells enriched in the G0 phase of the cell cycle using serum starvation (for the latter plot the X‐axis is the intensity of PI staining and the Y‐axis is the intensity of BrdU staining). (B) Western blot analysis of GAPDH, cyclin D1 and IBV proteins in mock infected cells (Mock) and cells treated with UV‐inactivated virus (UV) and infectious virus (IBV) at the times indicated post‐infection (h) in cells enriched in the GO phase of the cell cycle and then released. The migration of molecular weight markers is indicated to the left. (C) TaqMan analysis of the amount of cyclin D1 mRNA in cells enriched in the G0 phase of the cell cycle (indicated G0) and then released at the indicated times (h), in either mock (M) or cells infected with IBV (I) or treated with UV‐inactivated virus (UV). Cyclin D1 mainly functions during the G1 phase and at the G1/S phase transition before being rapidly degraded via the ubiquitin pathway during S phase [17]. Cyclin D1 levels then begin to rise again in the G2/M phase. Therefore, we investigated the effect on cyclin D1 mRNA and protein in IBV‐infected cells which had been enriched at either the G1/S or G2/M phase border. Vero cells were enriched in these phases using, either a double thymidine block or nocodazole treatment [6]. After treatment, cell cycle profiles were determined using dual flow cytometry and the data indicated that the cells had been enriched at the G1/S or G2/M phase border (Figs. 3 A and 4 A, respectively). For double thymidine treated cells there were an average of 88% of cells in the G1 phase, 3% in S phase and 9% in the G2/M phase, and in cells treated with nocodazole, there were an average of 20% of cells in G1, 23% in S phase and 57% in the G2/M phase, as described previously [6]. The cells were then simultaneously released and treated with either UV‐inactivated virus or infected with IBV and the levels of cyclin D1 protein (determined by Western blot) and mRNA (determined by TaqMan as per above) compared to that of mock‐infected cells at 24 h post‐infection and release. The data indicated that the amount of cyclin D1 protein was reduced in IBV‐infected cells compared to mock‐infected or UV‐inactivated virus treated cells for both cell cycle conditions (Figs. 3B and 4B). There was no significant difference in the levels of cyclin D1 mRNA for both conditions (Figs. 3C and 4C). This mirrored the observations of cyclin D1 protein and mRNA in asynchronously growing and G0 enriched Vero cells, and indicated that reduction in cyclin D1 levels by IBV was not dependent on the cell cycle stage at the time of infection. Interestingly, in the cells enriched in the G2/M phase of the cell cycle whilst the amount of cyclin D1 protein was greater in mock‐infected cells at 24 h post‐infection compared to 0 h, in infected cells the amount of cyclin D1 remained unchanged compared to that at 0 h. This result could be attributed to the fact that in uninfected cycling cells cyclin D1 is rapidly degraded in S phase and then increases again in the G2 phase [31], whereas IBV arrests cells in the early G2 phase of the cell cycle [6] and therefore cyclin D1 levels may not have started to increase.
Figure 3

(A) Propidium iodide (PI) plot and BrdU/PI staining of cell cycle profiles of cells enriched in the G1/S phase of the cell cycle using a double‐T block (for the latter plot the X‐axis is the intensity of PI staining and the Y‐axis is the intensity of BrdU staining). (B) Western blot analysis of GAPDH, cyclin D1 and IBV proteins in mock infected cells (Mock) and cells treated with UV‐inactivated virus (UV) and infectious virus (IBV) at the times indicated post‐infection (h) in cells enriched in the G1/S phase of the cell cycle and then released. The migration of molecular weight markers is indicated to the left. (C) TaqMan analysis of the amount of cyclin D1 mRNA in cells enriched in the G1/S phase of the cell cycle (indicated G1S) and then released at the indicated times (h), in either mock (M) or cells infected with IBV (I) or treated with UV‐inactivated virus (UV).

Figure 4

(A) Propidium iodide (PI) plot and BrdU/PI staining of cell cycle profiles of cells enriched in the G2/M phase of the cell cycle using nocodazole (for the latter plot the X‐axis is the intensity of PI staining and the Y‐axis is the intensity of BrdU staining). (B) Western blot analysis of GAPDH, cyclin D1 and IBV proteins in mock infected cells (Mock) and cells treated with UV‐inactivated virus (UV) and infectious virus (IBV) at the times indicated post‐infection (h) in cells enriched in the G2/M phase of the cell cycle and then released. The migration of molecular weight markers is indicated to the left. (C) TaqMan analysis of the amount of cyclin D1 mRNA in cells enriched in the G2/M phase of the cell cycle (indicated G2M) and then released at the indicated times (h), in either mock (M) or cells infected with IBV (I) or treated with UV‐inactivated virus (UV).

(A) Propidium iodide (PI) plot and BrdU/PI staining of cell cycle profiles of cells enriched in the G1/S phase of the cell cycle using a double‐T block (for the latter plot the X‐axis is the intensity of PI staining and the Y‐axis is the intensity of BrdU staining). (B) Western blot analysis of GAPDH, cyclin D1 and IBV proteins in mock infected cells (Mock) and cells treated with UV‐inactivated virus (UV) and infectious virus (IBV) at the times indicated post‐infection (h) in cells enriched in the G1/S phase of the cell cycle and then released. The migration of molecular weight markers is indicated to the left. (C) TaqMan analysis of the amount of cyclin D1 mRNA in cells enriched in the G1/S phase of the cell cycle (indicated G1S) and then released at the indicated times (h), in either mock (M) or cells infected with IBV (I) or treated with UV‐inactivated virus (UV). (A) Propidium iodide (PI) plot and BrdU/PI staining of cell cycle profiles of cells enriched in the G2/M phase of the cell cycle using nocodazole (for the latter plot the X‐axis is the intensity of PI staining and the Y‐axis is the intensity of BrdU staining). (B) Western blot analysis of GAPDH, cyclin D1 and IBV proteins in mock infected cells (Mock) and cells treated with UV‐inactivated virus (UV) and infectious virus (IBV) at the times indicated post‐infection (h) in cells enriched in the G2/M phase of the cell cycle and then released. The migration of molecular weight markers is indicated to the left. (C) TaqMan analysis of the amount of cyclin D1 mRNA in cells enriched in the G2/M phase of the cell cycle (indicated G2M) and then released at the indicated times (h), in either mock (M) or cells infected with IBV (I) or treated with UV‐inactivated virus (UV). Previous Western blot data indicated that cyclin D1 protein levels were significantly reduced in infected cells by 24 h post‐infection [6]. Immunofluoresence analysis of cyclin D1 in infected cells indicated that cyclin D1 protein was less than in mock‐infected cells from 4 h post‐infection and was absent from the nucleus by 24 h post‐infection, reflecting the Western blot analysis (Fig. 5 ). However, at early time points there are insufficient cells infected to distinguish cyclin D1 changes by Western blot analysis. Therefore, to study the degradation of cyclin D1 protein by Western blot analysis coupled to confocal microscopy time points post‐16 h infection were utilised.
Figure 5

Confocal microscopy analysis of the sub‐cellular localisation of cyclin D1 (green) in mock and IBV‐infected (red) asynchronously replicating cells at the times indicated post‐infection. Antibody controls are also presented with the corresponding transmission phase contrast images.

Confocal microscopy analysis of the sub‐cellular localisation of cyclin D1 (green) in mock and IBV‐infected (red) asynchronously replicating cells at the times indicated post‐infection. Antibody controls are also presented with the corresponding transmission phase contrast images. In replicating cells, cyclin D1 can be phosphorylated on Thr286 by glycogen synthase kinase 3 beta (GSK3β) promoting nuclear export and subsequent degradation in the cytoplasm [32, 33]. However, cyclin D1 can also be exported for degradation independently of GSK3β via unknown mechanisms [34]. To distinguish between these two possibilities, cells were either mock or infected with IBV and then treated at 8 h post‐infection with varying concentrations of LiCl, which have been shown to decrease GSK3β activity [35]. Western blot analysis was used to detect cyclin D1, IBV and GAPDH proteins. The data indicated that the amount of cyclin D1 protein was greater in LiCl treated mock‐infected cells compared to IBV‐infected cells (Fig. 6 A) and this was reflected in the accumulation of nuclear cyclin D1 as revealed immunofluoresence analysis (Fig. 6B). Increasing concentrations of LiCl resulted in a dose dependent increase in the amount of cyclin D1 protein in both mock and infected cells. This indicated that there was a population of cyclin D1 whose nuclear export was GSK3β dependent. However, in IBV infected LiCl treated cells the amount of cyclin D1 was less than in mock‐infected cells and therefore indicated that a population of cyclin D1 was still being targeted for degradation.
Figure 6

(A) Western blot analysis of cyclin D1, IBV and GAPDH proteins in mock‐infected or virus infected (IBV) cells treated with various of concentrations of LiCl (indicated). The data shown is one of three separate experiments which had identical results. (B) Confocal microscopy analysis of the sub‐cellular localisation of cyclin D1 (green) in mock and IBV‐infected (red) asynchronously replicating cells treated with 0 and 5 mM LiCl.

(A) Western blot analysis of cyclin D1, IBV and GAPDH proteins in mock‐infected or virus infected (IBV) cells treated with various of concentrations of LiCl (indicated). The data shown is one of three separate experiments which had identical results. (B) Confocal microscopy analysis of the sub‐cellular localisation of cyclin D1 (green) in mock and IBV‐infected (red) asynchronously replicating cells treated with 0 and 5 mM LiCl. Cyclin D1 is exported from the nucleus to the cytoplasm via the exportin CRM‐1 [36, 37]. To test whether this was the case in IBV‐infected cells, mock and infected cells were treated with the CRM‐1 inhibitor, leptomycin B (LMB). To confirm that the LMB treatment was active in these experiments, an RNA export assay was used based on the export of HIV‐1 REV that utilizes the CRM1 pathway [19]. A luciferase gene was placed within an inefficiently spliced intron that contained the REV response element (creating plasmid pLUCSALRRE). The pre‐mRNA is normally retained in the nucleus and the exported, spliced mRNA lacks the luciferase gene. Export is facilitated through co‐expressing HIV‐1 Rev protein under the control of a CMV promoter (plasmid pRev), which ensures that the pre‐mRNA is actively exported through the CRM1 pathway and luciferase activity would therefore be detected. The presence of LMB would inhibit the REV‐dependent mRNA export, confirming that LMB treatment of cells was effectively blocking the CRM1‐dependent export pathway. Therefore, in order to assess the activity of LMB Vero cells were transfected with pLUCSALRRE with or without LMB and also in the absence and presence of pRev (Fig. 7 A). The data indicated that in the absence of pRev there was no significant difference in luciferase activity between LMB treated or untreated cells, and this level was taken as background activity. In contrast, when the pRev protein was present, the level of luciferase was 70% less in LMB treated cells compared to untreated cells, indicating that LMB reduced CRM1‐mediated export.
Figure 7

(A) Histogram showing the activity of LMB in relation to its effect to inhibit CRM1 mediated export of HIV‐1 Rev protein. The first and third columns are where the luciferase reporter RNA construct is expressed in combination with the HIV‐1 Rev protein (plasmid pRev, denoted Rev). Whereas the second column and fourth columns are where the luciferase reporter RNA construct (plasmid pLUCSALRRE) is expressed in the absence of the HIV‐1 Rev protein. The third and fourth columns is data from LMB positive cells (indicated +LMB) whereas the first and second column is data derived from cells not treated with LMB (indicated −LMB). (B) Confocal microscopy analysis of cyclin D1 (green) in mock‐infected and IBV‐infected (red) asynchronously replicating cells either untreated or treated with LMB. (C) Western blot analysis of cyclin D1, IBV and GAPDH proteins in mock‐infected or IBV‐infected asynchronously replicating cells either untreated or treated with LMB.

(A) Histogram showing the activity of LMB in relation to its effect to inhibit CRM1 mediated export of HIV‐1 Rev protein. The first and third columns are where the luciferase reporter RNA construct is expressed in combination with the HIV‐1 Rev protein (plasmid pRev, denoted Rev). Whereas the second column and fourth columns are where the luciferase reporter RNA construct (plasmid pLUCSALRRE) is expressed in the absence of the HIV‐1 Rev protein. The third and fourth columns is data from LMB positive cells (indicated +LMB) whereas the first and second column is data derived from cells not treated with LMB (indicated −LMB). (B) Confocal microscopy analysis of cyclin D1 (green) in mock‐infected and IBV‐infected (red) asynchronously replicating cells either untreated or treated with LMB. (C) Western blot analysis of cyclin D1, IBV and GAPDH proteins in mock‐infected or IBV‐infected asynchronously replicating cells either untreated or treated with LMB. Immunofluoresence analysis indicated that in mock‐infected cells in the presence or absence of LMB cyclin D1 was retained in the nucleus (Fig. 7B). Whereas in the presence of LMB in infected cells cyclin D1 was observed in the nucleus, although to a lesser extent. (Fig. 7B). The stabilising affect of LMB on cyclin D1 in infected cells was confirmed by Western blot analysis (Fig. 7C). To test whether degradation of cyclin D1 in virus infected cells was mediated via the cellular proteosomal pathway cells were either mock or infected with IBV or treated with UV‐inactivated virus, and then treated 8 h post‐infection with the proteosomal inhibitor MG132. This inhibitor has been used to investigate ubiquitin mediated degradation of cyclin D1 in coxsackie virus infected cells [38]. Western blot analysis was used to detect cyclin D1, GAPDH and IBV proteins. The data indicated more cyclin D1 protein in MG132 treated cells compared to untreated (Fig. 8 A), which was confirmed by immunofluoresence analysis of both mock and infected cells in the presence and absence of MG132 (Fig. 8B). This indicated that in both mock and IBV infected cells the degradation of cyclin D1 was dependent on the cellular proteosomal pathway. However, as the amount of cyclin D1 in IBV infected cells was less than in mock infected cells treated with MG132 there may be a population of cyclin D1 that is being degraded via an unknown mechanism. In the presence of 5 mM LiCl and 10 μM MG132 cyclin D1 levels were part stabilised in IBV infected cells as revealed by both Western blot and immunofluoresence analysis (Fig. 9 A and B, respectively) (although there as variation on a cell to cell basis indicated by immunofluoresence).
Figure 8

(A). Western blot analysis of cyclin D1, IBV N and GAPDH proteins in mock (M) and virus infected (I) or cells treated with UV‐inactivated virus (UV) at 24 h post‐infection. Treatment MG132 is denoted (+) and untreated (−). (B) Confocal microscopy analysis of cyclin D1 (green) in mock‐infected and IBV‐infected (red) asynchronously replicating cells either untreated or treated with MG132.

Figure 9

(A) Western blot analysis of cyclin D1, IBV N and GAPDH proteins in mock (M) and virus‐infected (I) asynchronously replicating cells at 24 h post‐infection treated with LiCl (at the concentrations indicated) and with 10 uM MG132. (B) Confocal microscopy analysis of cyclin D1 (green) in mock‐infected and IBV‐infected (red) asynchronously replicating cells treated with 5 mM LiCl and 10 uM MG132.

(A). Western blot analysis of cyclin D1, IBV N and GAPDH proteins in mock (M) and virus infected (I) or cells treated with UV‐inactivated virus (UV) at 24 h post‐infection. Treatment MG132 is denoted (+) and untreated (−). (B) Confocal microscopy analysis of cyclin D1 (green) in mock‐infected and IBV‐infected (red) asynchronously replicating cells either untreated or treated with MG132. (A) Western blot analysis of cyclin D1, IBV N and GAPDH proteins in mock (M) and virus‐infected (I) asynchronously replicating cells at 24 h post‐infection treated with LiCl (at the concentrations indicated) and with 10 uM MG132. (B) Confocal microscopy analysis of cyclin D1 (green) in mock‐infected and IBV‐infected (red) asynchronously replicating cells treated with 5 mM LiCl and 10 uM MG132. Although the treatment of infected cells with LiCl, MG132 or LMB results in the increased stabilisation of cyclin D1 compared to untreated infected cells, there is still less cyclin D1 than when compared to mock‐infected treated cells, indicating that a viral protein and/or signalling pathway may be responsible for the export of cyclin D1 from the nucleus to the cytoplasm for its subsequent degradation. One candidate viral protein, could be the IBV N protein which can traffic between the nucleolus and the cytoplasm [22, 26] and interactions with the nucleolus and its proteins may be one mechanism by which RNA viruses can disrupt the cell cycle [39]. IBV N protein is a phospho‐protein which binds RNA with high affinity [40, 41]. In the case of the severe acute respiratory syndrome coronavirus (SARS‐CoV), N protein has been shown to interact with cyclin D1 in cells expressing N protein [12]. To investigate whether IBV N protein could interact with cyclin D1 co‐localisation studies using confocal microscopy and pull down studies were performed. However, no co‐localisation was observed in cells expressing IBV N protein tagged to the fluorescent fusion protein, EGFP (Fig. 10 A). This may have been due to the fact that IBV N protein localises principally to the cytoplasm and nucleolus, rather than the nucleus [26, 42], which is in contrast to cyclin D1 which is predominately nuclear, therefore the two molecules could not interact. To test this hypothesis a mutant EGFP‐tagged N protein was used in which the nuclear export signal had been deleted and whose localisation was nuclear and nucleolar [26]. However, no co‐localisation was observed (Fig. 10B). Likewise, cyclin D1 was tagged N‐terminally with ECFP, which resulted in the accumulation of the fusion protein predominately in the cytoplasm. Transfection of cells with this plasmid and also expressing EGFP‐IBV N protein indicated that no co‐localisation was observed between these two proteins in the cytoplasm (Fig. 10C).
Figure 10

Confocal microscopy analysis of the sub‐cellular localisation of cyclin D1 (red) and (A) EGFP‐IBV N protein and (B) EGFP‐IBV NΔNES (both green). (C) Confocal microscopy analysis of the sub‐cellular localisation of EGFP‐IBV N protein (green) and ECFP‐cyclin D1 (false coloured red). (D) Western blot analysis of pull down analysis of the tumour suppressor protein, p53, using either bead only controls, recombinant IBV N protein, the hepatitis C virus NS5a protein as a positive control, and total cell protein extract. Molecular weight markers are indicated to the left.

Confocal microscopy analysis of the sub‐cellular localisation of cyclin D1 (red) and (A) EGFP‐IBV N protein and (B) EGFP‐IBV NΔNES (both green). (C) Confocal microscopy analysis of the sub‐cellular localisation of EGFP‐IBV N protein (green) and ECFP‐cyclin D1 (false coloured red). (D) Western blot analysis of pull down analysis of the tumour suppressor protein, p53, using either bead only controls, recombinant IBV N protein, the hepatitis C virus NS5a protein as a positive control, and total cell protein extract. Molecular weight markers are indicated to the left. No interaction was also found with a biochemical pull down of cell extracts using a recombinant his‐tagged N protein [40, 43] anchored to a solid matrix as a target (data not shown). Whereas as a control N protein could pull down the tumour suppressor protein p53 (Fig. 10D) which we have shown previously co‐localises with N protein [44]. Likewise IBV N protein co‐localises with and can pull down nucleolin [15, 26]. The possibility remains that other viral proteins could direct the trafficking of cyclin D1 from the nucleus to the cytoplasm. This study demonstrated that actively replicating IBV is required to decrease cyclin D1 and that this change is regulated post‐transcription. This may be mediated by the arrest in the G2 phase of the cell cycle of infected cells prior to the stage when cyclin D1 levels would usually begin to rise. Furthermore, in infected cells cyclin D1 is redistributed from the nucleus to the cytoplasm, where we hypothesize it is targeted for degradation, by a viral protein dependent trafficking pathway. However, the precise mechanism of this pathway remains to be determined.
  40 in total

Review 1.  Four-dimensional control of the cell cycle.

Authors:  J Pines
Journal:  Nat Cell Biol       Date:  1999-07       Impact factor: 28.824

2.  C-terminal sequences direct cyclin D1-CRM1 binding.

Authors:  Sharon Benzeno; J Alan Diehl
Journal:  J Biol Chem       Date:  2004-10-28       Impact factor: 5.157

3.  Subcellular localization of the severe acute respiratory syndrome coronavirus nucleocapsid protein.

Authors:  Jaehwan You; Brian K Dove; Luis Enjuanes; Marta L DeDiego; Enrique Alvarez; Gareth Howell; Paul Heinen; Maria Zambon; Julian A Hiscox
Journal:  J Gen Virol       Date:  2005-12       Impact factor: 3.891

4.  Nucleolin is regulated both at the level of transcription and translation.

Authors:  Katrina Bicknell; Gavin Brooks; Pete Kaiser; Hongying Chen; Brian K Dove; Julian A Hiscox
Journal:  Biochem Biophys Res Commun       Date:  2005-07-08       Impact factor: 3.575

5.  Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells.

Authors:  V Stambolic; L Ruel; J R Woodgett
Journal:  Curr Biol       Date:  1996-12-01       Impact factor: 10.834

6.  Murine coronavirus replication induces cell cycle arrest in G0/G1 phase.

Authors:  Chun-Jen Chen; Shinji Makino
Journal:  J Virol       Date:  2004-06       Impact factor: 5.103

7.  Characterization of the nuclear export signal in the coronavirus infectious bronchitis virus nucleocapsid protein.

Authors:  Mark L Reed; Gareth Howell; Sally M Harrison; Kelly-Anne Spencer; Julian A Hiscox
Journal:  J Virol       Date:  2007-01-03       Impact factor: 5.103

8.  Characterisation of cyclin D1 down-regulation in coronavirus infected cells.

Authors:  Sally M Harrison; Brian K Dove; Lisa Rothwell; Pete Kaiser; Ian Tarpey; Gavin Brooks; Julian A Hiscox
Journal:  FEBS Lett       Date:  2007-02-28       Impact factor: 4.124

9.  Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.

Authors:  Khalid Amine Timani; Qingjiao Liao; Linbai Ye; Yingchun Zeng; Jing Liu; Yi Zheng; Li Ye; Xiaojun Yang; Kong Lingbao; Jingrong Gao; Ying Zhu
Journal:  Virus Res       Date:  2005-06-29       Impact factor: 3.303

10.  The nucleocapsid protein of severe acute respiratory syndrome-coronavirus inhibits the activity of cyclin-cyclin-dependent kinase complex and blocks S phase progression in mammalian cells.

Authors:  Milan Surjit; Boping Liu; Vincent T K Chow; Sunil K Lal
Journal:  J Biol Chem       Date:  2006-01-23       Impact factor: 5.157

View more
  10 in total

1.  Quantitative proteomics using stable isotope labeling with amino acids in cell culture reveals changes in the cytoplasmic, nuclear, and nucleolar proteomes in Vero cells infected with the coronavirus infectious bronchitis virus.

Authors:  Edward Emmott; Mark A Rodgers; Andrew Macdonald; Sarah McCrory; Paul Ajuh; Julian A Hiscox
Journal:  Mol Cell Proteomics       Date:  2010-05-13       Impact factor: 5.911

2.  Characterization of the interaction between human respiratory syncytial virus and the cell cycle in continuous cell culture and primary human airway epithelial cells.

Authors:  Weining Wu; Diane C Munday; Gareth Howell; Gareth Platt; John N Barr; Julian A Hiscox
Journal:  J Virol       Date:  2011-07-27       Impact factor: 5.103

3.  Generation and characterization of chicken bone marrow-derived dendritic cells.

Authors:  Zhiguang Wu; Lisa Rothwell; John R Young; Jim Kaufman; Colin Butter; Pete Kaiser
Journal:  Immunology       Date:  2009-05-15       Impact factor: 7.397

4.  Coronavirus Porcine Epidemic Diarrhea Virus Nucleocapsid Protein Interacts with p53 To Induce Cell Cycle Arrest in S-Phase and Promotes Viral Replication.

Authors:  Mingjun Su; Da Shi; Xiaoxu Xing; Shanshan Qi; Dan Yang; Jiyu Zhang; Yuru Han; Qinghe Zhu; Haibo Sun; Xiaoran Wang; Haoyang Wu; Meijiao Wang; Shan Wei; Chunqiu Li; Donghua Guo; Li Feng; Dongbo Sun
Journal:  J Virol       Date:  2021-07-26       Impact factor: 5.103

Review 5.  Recent progress in studies of arterivirus- and coronavirus-host interactions.

Authors:  Yanxin Zhong; Yong Wah Tan; Ding Xiang Liu
Journal:  Viruses       Date:  2012-06-19       Impact factor: 5.048

6.  The nucleocapsid protein of human coronavirus NL63.

Authors:  Kaja Zuwała; Anna Golda; Wojciech Kabala; Michał Burmistrz; Michal Zdzalik; Paulina Nowak; Sylwia Kedracka-Krok; Mirosław Zarebski; Jerzy Dobrucki; Dominik Florek; Sławomir Zeglen; Jacek Wojarski; Jan Potempa; Grzegorz Dubin; Krzysztof Pyrc
Journal:  PLoS One       Date:  2015-02-20       Impact factor: 3.240

7.  Characterisation of cyclin D1 down-regulation in coronavirus infected cells.

Authors:  Sally M Harrison; Brian K Dove; Lisa Rothwell; Pete Kaiser; Ian Tarpey; Gavin Brooks; Julian A Hiscox
Journal:  FEBS Lett       Date:  2007-02-28       Impact factor: 4.124

8.  The Porcine Deltacoronavirus Replication Organelle Comprises Double-Membrane Vesicles and Zippered Endoplasmic Reticulum with Double-Membrane Spherules.

Authors:  Nicole Doyle; Philippa C Hawes; Jennifer Simpson; Lorin H Adams; Helena J Maier
Journal:  Viruses       Date:  2019-11-05       Impact factor: 5.048

9.  Molecular mechanisms and pharmacological interventions in the replication cycle of human coronaviruses.

Authors:  Fernando Moreira Simabuco; Rodrigo Esaki Tamura; Isadora Carolina Betim Pavan; Mirian Galliote Morale; Armando Morais Ventura
Journal:  Genet Mol Biol       Date:  2020-11-23       Impact factor: 1.771

10.  A model for the dynamic nuclear/nucleolar/cytoplasmic trafficking of the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid protein based on live cell imaging.

Authors:  Jae-Hwan You; Gareth Howell; Asit K Pattnaik; Fernando A Osorio; Julian A Hiscox
Journal:  Virology       Date:  2008-06-12       Impact factor: 3.616

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.