Literature DB >> 16734668

Delineation and modelling of a nucleolar retention signal in the coronavirus nucleocapsid protein.

Mark L Reed1, Brian K Dove, Richard M Jackson, Rebecca Collins, Gavin Brooks, Julian A Hiscox.   

Abstract

Unlike nuclear localization signals, there is no obvious consensus sequence for the targeting of proteins to the nucleolus. The nucleolus is a dynamic subnuclear structure which is crucial to the normal operation of the eukaryotic cell. Studying nucleolar trafficking signals is problematic as many nucleolar retention signals (NoRSs) are part of classical nuclear localization signals (NLSs). In addition, there is no known consensus signal with which to inform a study. The avian infectious bronchitis virus (IBV), coronavirus nucleocapsid (N) protein, localizes to the cytoplasm and the nucleolus. Mutagenesis was used to delineate a novel eight amino acid motif that was necessary and sufficient for nucleolar retention of N protein and colocalize with nucleolin and fibrillarin. Additionally, a classical nuclear export signal (NES) functioned to direct N protein to the cytoplasm. Comparison of the coronavirus NoRSs with known cellular and other viral NoRSs revealed that these motifs have conserved arginine residues. Molecular modelling, using the solution structure of severe acute respiratory (SARS) coronavirus N-protein, revealed that this motif is available for interaction with cellular factors which may mediate nucleolar localization. We hypothesise that the N-protein uses these signals to traffic to and from the nucleolus and the cytoplasm.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16734668      PMCID: PMC7488588          DOI: 10.1111/j.1600-0854.2006.00424.x

Source DB:  PubMed          Journal:  Traffic        ISSN: 1398-9219            Impact factor:   6.215


The nucleolus is a dynamic subnuclear structure involved in ribosome subunit biogenesis, in RNA processing, in cell cycle control and as a sensor for cell stress 1, 2, 3, 4). Morphologically, the nucleolus can be divided into fibrillar centre(s) (FC), a dense fibrillar component (DFC) and an outer granular component (GC). A directed proteomic analysis, followed by subsequent bioinformatic analysis revealed that the nucleolus is composed of at least 700 proteins 5, 6, 7). Whilst the rules and signals governing the nuclear localization and nuclear export of proteins are well defined, those concerning nucleolar localization/retention are not. In the case of nuclear localization signals (NLSs), these can be classified into several categories. The majority of motifs identified thus far such as ‘pat4’, ‘pat7’ and bipartite signals are composed of basic amino acids within a given sequence length 8, 9, 10). Protein nuclear export signals (NESs) again vary, but one of the most common and well characterized is an approximately 11 amino acid leucine‐rich signal, typified by LxxxLxxLxxL, where a number of hydrophobic amino acids can substitute for L, and the spacer regions (x) can vary in number (9, 11). In contrast to the NLSs and NESs, nucleolar localization/retention signals (NoRSs) and pathways are not well characterized (12), and the signals can vary, but are usually rich in arginine and lysine, although there is no obvious consensus. For example, the MQRKPTIRRKNLRLRRK motif identified in survivin‐deltaEx3 protein (13) and the RSRKYTSWYVALKR motif of the 18‐kDa fibroblast growth factor‐2 (14). Nucleolar localization can also be regulated by binding accessory proteins, such as nucleostemin binding to GTP (15). Compared with NESs where the leucine‐rich export signal (for CRM‐1 type nuclear export receptors) is accessible for interaction with carrier proteins (16), the structural context of a NoRS is not well characterized. In many cases, proteins localizing to both the cytoplasm/nucleus/nucleolus contain multiple signals to determine their subcellular localization 17, 18, 19, 20). This highlights the difficulty in identifying NoRSs, in that, many proteins which localize to the nucleolus also localize to the nucleus and contain both classical nuclear and nucleolar signals which can also overlap (14, 21, 22). We use the avian infectious bronchitis virus (IBV), coronavirus nucleocapsid (N) protein, as a model to study nucleolar retention. We have previously shown that N protein is present in the cytoplasm but can also actively localize to the nucleolus 23, 24, 25) and interact with the nucleolar proteins nucleolin and fibrillarin (26). Coronaviruses can also interact with host cell processes, such as the cell cycle (27, 28) and signal transduction pathways (29, 30). Coronaviruses together with the closely related arteriviruses are nidoviruses, a group of positive strand RNA viruses, which cause a variety of different diseases (31, 32). For example, IBV and severe acute respiratory syndrome coronavirus (SARS‐CoV) both cause respiratory disease (33, 34), whereas murine coronaviruses can cause hepatitis and demyelination (35) and porcine coronaviruses, respiratory and gastroenteric diseases (36). IBV (Beaudette strain) N protein, composed of 409 amino acids with a predicted molecular weight of 45 kDa, is a phosphoprotein which can bind viral RNA with high affinity (37) and also modulate cellular processes (24, 26). On the basis of amino acid sequence comparison, three conserved regions (1,2 and 3) have been identified in the coronavirus N protein, which in the case of IBV N protein can map to the N‐terminal (amino acids 1–133), central (amino acids 134–265) and C‐terminal parts of the protein (amino acids 266–409), respectively (38). Also, mass spectroscopy revealed that conserved phosphorylation sites are present in regions 2 and 3 of both avian and porcine coronavirus N proteins (37, 39). Given the subcellular localization of IBV N protein to the nucleolus, but not nucleus, we hypothesized that the protein would contain a unique NoRS and possibly a signal for export of the protein into the cytoplasm. Therefore, using a combination of deletion and substitution mutagenesis, coupled with live cell imaging and confocal microscopy, we have tested this prediction.

Results

Bioinformatic analysis and preliminary molecular investigation of nuclear import and export signals in IBV N protein

To identify whether there were potential NLSs (which could form part of a NoRS) and/or NESs in IBV N protein, we first conducted a bioinformatic analysis of the protein using existing motif prediction algorithms. PredictNLS (8) and PSORTII (40) were used to identify potential NLSs, and the NES predictor (NetNES) was used (16) to identify potential NESs. PredictNLS found no NLSs, whereas PSORTII indicated that IBV N protein contained two potential overlapping NLSs in region 3 between residues 358–366, a pat4 motif (RPKK) and a pat7 motif (PKKEKKL) (Figure 1A). NetNES predicted a potential CRM‐1‐dependent NES between residues 291 and 298 (LQLDGLHL) (also in region 3) (Figure 1A). To investigate whether these and other unknown signals operated to determine the subcellular trafficking of N protein, we divided the protein into three regions [based on conservation between IBV strains and other coronavirus N proteins (38)] and combinations of regions 1 plus 2 and 2 plus 3 and cloned these downstream of enhanced cyan fluorescent fusion protein (ECFP) generating plasmids pECFP‐IBVNR1+2, pECFP‐IBVNR2+3, pECFP‐IBVNR1, pECFP‐IBVNR2 and pECFP‐IBVNR3. When expressed in cells, these would lead to the synthesis of ECFP fused to regions 1 plus 2, 2 plus 3 and expressed individually, regions 1, 2 and 3, respectively (Figure 1B). Vero cells, a model cell line to study IBV‐cell interactions (24, 26, 41, 42), were transfected with plasmids pECFP‐IBVNR1+2, pECFP‐IBVNR2+3, pECFP‐IBVNR1, pECFP‐IBVNR2 and pECFP‐IBVNR3. Recombinant fusion proteins were imaged at 24 h post‐transfection using live cell imaging (direct fluorescence). As a control, cells were also transfected with pECFP‐C1, which leads to the expression of ECFP only and also wild‐type N protein cloned down stream of EGFP, plasmid pEGFP‐IBVN, as described (25) (Figure 2). In a parallel series of experiments, cells were cotransfected with pECFP‐IBVNR1+2, pECFP‐IBVNR2+3, pECFP‐IBVNR1, pECFP‐IBVNR2 and pECFP‐IBVNR3 and pEGFP nucleolin (Figure 2). This latter construct allowing the expression of a nucleolar marker protein, nucleolin, tagged to EGFP (25). Dual‐transfected cells were fixed at 24 h post‐transfection for confocal analysis by direct fluorescence.
Figure 1

(A ) Amino acid sequence of IBV (Beaudette strain) N protein with the positions of the predicted NES and NLSs indicated.(B)Block diagram detailing the 409 amino acid length of N protein C‐terminally fused to EGFP and the three regions of N protein fused C‐terminally to ECFP as used in this study. The putative NLSs and NESs are indicated.

Figure 2

Live cell imaging showing the subcellular localization of fluorescent fusion proteins; ECFP, EGFP‐IBV N, ECFP‐IBVNR1, ECFP‐IBVNR2 and ECFP‐IBVNR3, ECFP‐IBVNR1+2 and ECFP‐IBVNR2+3 proteins. Vero cells were visualized 24 h post‐transfection in culture conditions using a Nikon Eclipse TS100 microscope. Confocal analysis of the subcellular localization of ECFP‐IBVNR1, ECFP‐IBVNR2 and ECFP‐IBVNR3, ECFP‐IBVNR1+2 and ECFP‐IBVNR2+3 proteins in cells coexpressing EGFP‐nucleolin, at 24 h post‐transfection. The IBV fusion peptides are coloured green and the nucleolin fusion protein coloured red. Merged images are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Amino acid sequence of IBV (Beaudette strain) N protein with the positions of the predicted NES and NLSs indicated.(B)Block diagram detailing the 409 amino acid length of N protein C‐terminally fused to EGFP and the three regions of N protein fused C‐terminally to ECFP as used in this study. The putative NLSs and NESs are indicated. Live cell imaging showing the subcellular localization of fluorescent fusion proteins; ECFP, EGFP‐IBV N, ECFP‐IBVNR1, ECFP‐IBVNR2 and ECFP‐IBVNR3, ECFP‐IBVNR1+2 and ECFP‐IBVNR2+3 proteins. Vero cells were visualized 24 h post‐transfection in culture conditions using a Nikon Eclipse TS100 microscope. Confocal analysis of the subcellular localization of ECFP‐IBVNR1, ECFP‐IBVNR2 and ECFP‐IBVNR3, ECFP‐IBVNR1+2 and ECFP‐IBVNR2+3 proteins in cells coexpressing EGFP‐nucleolin, at 24 h post‐transfection. The IBV fusion peptides are coloured green and the nucleolin fusion protein coloured red. Merged images are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate. Live cell imaging indicated that as previously shown, ECFP localized to both the cytoplasm and nucleus, but not the nucleolus, whereas EGFP‐IBVN protein localized to both the cytoplasm and nucleolus but not the nucleus, as described previously (23, 25). ECFP‐IBVNR1+2 protein localized to the nucleus and nucleolus, whereas ECFP‐IBVNR2+3 protein was predominantly cytoplasmic in localization. Confocal analysis of dual‐transfected cells was used to confirm the presence of the nucleolus using the marker protein, EGFP nucleolin, and reflected the live cell imaging results (Figure 2). The data also indicated that ECFP‐IBVNR1+2 colocalized with nucleolin but not ECFP‐IBVNR2+3. Live cell analysis of the single region constructs (pECFP‐IBVNR1, pECFP‐IBVNR2 and pECFP‐IBVNR3) indicated that ECFP‐IBVNR1 localized predominantly to the nucleolus and also localized to the nucleus, ECFP‐IBVNR2 localized predominantly to the nucleus and appeared also to accumulate in the nucleolus to the same level as the nucleus, whereas ECFP‐IBVNR3 localized predominantly to the cytoplasm. Confocal analysis confirmed these findings and indicated that ECFP‐IBVNR1 colocalized with nucleolin, whereas ECFP‐IBVNR2 was indeterminate and ECFP‐IBVNR3 did not (Figure 2). This data suggested that a potential NoRS could be located in region 1, that region 2 contained a potential NLS(s) not identified by the bioinformatic analysis and also a possible NoRS. The data also suggested that because region 3 was directed to the cytoplasm, the putative NES was dominant to the predicted NLSs. None of these fusion proteins had a distribution similar to ECFP only. Therefore the potential of regions 1 and 2 to direct nucleolar localization and region 3 to promote nuclear export was investigated.

Delineation of a NoRS in region 1 of N protein

Having identified that region 1 of IBV N protein localized to the nucleolus, the hypothesis was tested that it contained a NoRS to target the protein to the nucleolus. To investigate this prediction, a series of expression constructs containing fragments of region 1 were constructed, based on the rationale of keeping sequences of basic and non‐basic amino acids discrete, pECFP‐IBVNR11−50, pECFP‐IBVNR151−100 and pECFP‐IBVNR1101−132 (Figure 3A). Vero cells were transfected with these constructs and analyzed by live cell imaging at 24 h post‐transfection. The data indicated that ECFP‐IBVNR11−50 and ECFP‐IBVNR1101−132 had a similar localization pattern to ECFP only, whereas ECFP‐IBVNR151−100 localized predominantly to the nucleus and nucleolus (Figure 3B). These data were confirmed by cotransfecting cells with either pECFP‐IBVNR11−50, pECFP‐IBVNR151−100 or pECFP‐IBVNR1101−132, and pEGFP‐nucleolin, fixed at 24 h post‐transfection and analyzed using confocal microscopy (Figure 3B). The data also indicated that ECFP‐IBVNR151−100 colocalized with nucleolin, whereas the other two fusion proteins did not. Therefore, the fragment containing amino acids 51–100 of IBV N protein could direct an exogenous protein to the nucleolus.
Figure 3

(A ) Block diagram detailing the fragments of IBV N protein region 1 cloned into pECFP‐C1.(B)Sub‐cellular localization of fluorescent fusion proteins ECFP‐IBVNR11−50, ECFP‐IBVNR151−100 and ECFP‐IBVNR1101−132 in Vero cells using live cell imaging and coexpressed with EGFP‐nucleolin in fixed cells and analyzed by META‐confocal microscopy. ECFP and EGFP florescence is false coloured green and red, respectively. Merged images are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Block diagram detailing the fragments of IBV N protein region 1 cloned into pECFP‐C1.(B)Sub‐cellular localization of fluorescent fusion proteins ECFP‐IBVNR11−50, ECFP‐IBVNR151−100 and ECFP‐IBVNR1101−132 in Vero cells using live cell imaging and coexpressed with EGFP‐nucleolin in fixed cells and analyzed by META‐confocal microscopy. ECFP and EGFP florescence is false coloured green and red, respectively. Merged images are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate. To further refine the amino acids involved in nucleolar retention, 20 amino acid overlapping motifs encompassing amino acids 61–100 were cloned downstream of ECFP, creating plasmids pECFP‐IBVNR161−80, pECFP‐IBVNR171−90 and pECFP‐IBVNR181−100 for the expression of recombinant fusion proteins (Figure 4A). Amino acids 51–60 were not included in this analysis as there were no arginine and lysine residues present in this sequence and basic amino acids form part of known NoRSs. Vero cells were transfected with pECFP‐IBVNR161−80, pECFP‐IBVNR171−90 and pECFP‐IBVNR181−100 and analyzed 24 h post‐transfection using live cell imaging. Also, cells were cotransfected with these constructs and pEGFP‐nucleolin, fixed at 24 h post‐transfection and analyzed using confocal microscopy (Figure 4B). The data indicated that ECFP‐IBVNR171−90 and ECFP‐IBVNR161−80 localized to the nucleus and nucleolus (and colocalized with nucleolin). However, ECFP‐IBVNR181−100 localized to the cytoplasm and nucleus but not the nucleolus (and did not colocalize with nucleolin). Therefore, the amino acids at positions 61–90 in IBV N protein were able to direct an exogenous protein to the nucleus/nucleolus.
Figure 4

(A ) Amino acid sequence of IBV N protein region 1 overlapping peptides placed C‐terminal of ECFP and (B ), analysis of the subcellular localization of these peptides (ECFP‐IBVNR1 ECFP and EGFP florescence is shown as green and red, respectively. Merged images with ECFP false coloured red are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Amino acid sequence of IBV N protein region 1 overlapping peptides placed C‐terminal of ECFP and (B ), analysis of the subcellular localization of these peptides (ECFP‐IBVNR1 ECFP and EGFP florescence is shown as green and red, respectively. Merged images with ECFP false coloured red are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate. To further define the amino acids involved in nucleolar trafficking, we conducted a tetra‐alanine substitution mutagenesis of amino acids 71–90. These were placed down stream of ECFP, creating expression plasmids, pECFP‐IBVNR171WRRQ→AAAA, pECFP‐IBVNR175ARFK→AAAA, pECFP‐IBVNR179PGKG→AAAA, pECFP‐IBVNR183GRKP→AAAA and pECFP‐IBVNR187VPDA→AAAA. Therefore, in some cases, the wild‐type alanine was not substituted. Amino acids 61–70 were excluded from the substitution analysis as no basic residues were present. These expression plasmids were transfected into Vero cells and the distribution of the respective fluorescent fusion proteins analyzed by live cell imaging at 24 h post‐transfection (Figure 5A). The data indicated that substituting 71WRRQ with AAAA (pECFP‐IBVNR171WRRQ→AAAA) abolished nucleolar retention of the recombinant fusion protein and that substitution of 75ARFK with AAAA (pECFP‐IBVNR175ARFK→AAAA) resulted in reduced nucleolar retention. The remaining tetra‐alanine substitutions had no effect on nucleolar retention, indicating that amino acids 71WRRQARFK78 were involved in nucleolar retention.
Figure 5

(A ) Amino acid sequence of tetra‐alanine substitution mutagenesis of pECFP‐NR1 In some cases, the substitution maintained the wild‐type alanine and analysis of the subcellular localization of these peptides (ECFP‐IBVNR171WRRQ→AAAA, ECFP‐IBVNR175ARFK→AAAA, ECFP‐IBVNR179PGKG→AAAA, ECFP‐IBVNR183GRKP→AAAA and ECFP‐IBVNR187VPDA→AAAA) using live cell imaging of Vero cells at 24 h post‐transfection. (B)Live cell imaging of cells expressing EGFP‐IBVNΔNoRS and corresponding bright field images. Several examples are shown. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Amino acid sequence of tetra‐alanine substitution mutagenesis of pECFP‐NR1 In some cases, the substitution maintained the wild‐type alanine and analysis of the subcellular localization of these peptides (ECFP‐IBVNR171WRRQ→AAAA, ECFP‐IBVNR175ARFK→AAAA, ECFP‐IBVNR179PGKG→AAAA, ECFP‐IBVNR183GRKP→AAAA and ECFP‐IBVNR187VPDA→AAAA) using live cell imaging of Vero cells at 24 h post‐transfection. (B)Live cell imaging of cells expressing EGFP‐IBVNΔNoRS and corresponding bright field images. Several examples are shown. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate. To test whether this amino acid sequence was involved in directing the nucleolar localization of N protein, this motif was deleted in the context of full length N protein tagged to EGFP (plasmid pEGFP‐IBVNΔNoRS). This plasmid was transfected into Vero cells and the subcellular localization of the resulting fusion protein EGFP‐IBVNΔNoRS investigated using live cell imaging. There was no nucleolar localization at 24 h post‐transfection (Figure 5B, several examples are shown) compared with approximately 50% in cells expressing EGFP‐IBV N protein (data not shown). This data also indicated that the NoRS identified in region 1 was necessary for nucleolar retention in IBV N protein. As described, the preliminary investigation using the single and double region constructs indicated a potential NoRS in region 2. If the latter signal was functional, then we would have expected a proportion of cells expressing EGFP‐IBVNΔNoRS in the nucleolus. However, no nucleolar localization was observed, indicating that the WRRQARFK motif was necessary for nucleolar localization. To determine whether the eight amino acid sequence identified in region 1 was sufficient to direct nucleolar retention, this motif was placed downstream of ECFP and DsRed, creating vectors pECFP‐WRRQARFK and pDsRed‐WRRQARFK, respectively. As controls, an amino acid sequence C‐terminal of the region 1 NoRS, GRKPVPDA, identified in the tetra‐alanine substitution mutagenesis as not being involved in nucleolar retention, was placed down stream of ECFP, creating vector pECFP‐GRKPVPDA. Transfection of Vero cells with pECFP‐WRRQARFK and pECFP‐GRKPVPDA indicated that WRRQARFK directed ECFP to the nucleolus and nucleus, whereas GRKPVPDA did not (Figure 6A). In the case of the former construct, relative fluorescence revealed that there was approximately fourfold more ECFP in the nucleolus than in the nucleus. To investigate the role of both WRRQ and ARFK in nucleolar targeting, each motif was substituted for alanine and placed downstream of ECFP, creating expression vectors pECFP‐WRRQAAAA and pECFP‐AAAAARFK. Transfection and expression of these constructs in Vero cells (Figure 6A) indicated that whilst WRRQ could direct ECFP to the nucleus and nucleolus, ARFK was required for efficient nucleolar retention. In contrast, ECFP‐AAAAARFK by itself localized predominately to the cytoplasm, weakly to the nucleus and was absent from the nucleolus (Figure 6A).
Figure 6

(A ) Sub‐cellular localization of fluorescent fusion proteins ECFP‐WRRQARFK, ECFP‐GRKPVPDA, ECFP‐AAAAARFK and ECFP‐WRRQAAAA in Vero cells using confocal microscopy.(B)Analysis of colocalization of DsRed‐WRRQARFK with EGFP‐fibrillarin and EGFP‐nucleolin. IBV fusion peptides were false coloured green and nucleolar markers proteins in red. Shown is the nucleus and nucleolus. Merged images are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Sub‐cellular localization of fluorescent fusion proteins ECFP‐WRRQARFK, ECFP‐GRKPVPDA, ECFP‐AAAAARFK and ECFP‐WRRQAAAA in Vero cells using confocal microscopy.(B)Analysis of colocalization of DsRed‐WRRQARFK with EGFP‐fibrillarin and EGFP‐nucleolin. IBV fusion peptides were false coloured green and nucleolar markers proteins in red. Shown is the nucleus and nucleolus. Merged images are also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate. To investigate whether the WRRQARFK motif targeted a specific part of the nucleolus, cells were cotransfected with pDsRed‐WRRQARFK and either pEGFP‐nucleolin or pEGFP‐fibrillarin (Figure 6B, several examples are shown). These fusion proteins provided distinct markers for the nucleolus (25). The data indicated that WRRQARFK could also direct DsRed to the nucleolus (as well ECFP, Figure 6A) and that WRRQARFK tagged to the appropriate florescent protein colocalized predominately with EGFP‐fibrillarin and EGFP‐nucleolin and formed a punctate appearance in the nucleolus, which we tentatively defined as the DFC. Note that DsRed‐WRRQARFK was also observed in the nucleus and cytoplasm, but the images are resolved in the linear range for the nucleolar signal, which is the predominant component of this localization.

Investigation of potential nucleolar targeting signals in IBV N protein region 2

Similar to the approach used to identify the NoRS in region 1, region 2 was subdivided into two distinct components. Amino acids 133–200 and 201–265 were placed downstream of ECFP, creating expression vectors pECFP‐IBVN133−200 and pECFP‐IBVN133−200 (Figure 7A). Expression of these plasmids in Vero cells indicated that amino acids 133–200 directed ECFP to the cytoplasm and nucleus and had a subcellular localization similar to ECFP. In contrast, amino acids 201–265 directed ECFP to the nucleus with no evidence of nucleolar exclusion. Further investigation revealed that amino acids 201–220 and 211–230 when fused to ECFP directed this protein to the nucleus and nucleolus, whereas amino acids 221–240 directed ECFP to the nucleus but not to the nucleolus (Figure 7B). Relative fluorescence indicated that the ratio of ECFP between the nucleus and nucleolus with amino acids 201–220 and 211–220 was approximately 1:1, which is in contrast to that observed with the NoRS identified in region 1, in which there was four times more signal in the nucleolus than the nucleus. Taken together with the lack of nucleolar retention observed in cells expressing the region 1 NoRS deletion mutant, in the context of full length N protein, we propose that WRRQARFK is necessary and sufficient to direct N protein to the nucleolus, and no other signals are involved.
Figure 7

(A ) Block diagram detailing fragments of IBV N protein region 2 cloned into pECFP‐C1. Sub‐cellular localization of ECFP‐IBVNR2133−200 and ECFP‐IBVNR2201−265 in Vero cells imaged using live cell microscopy. (B)Confocal analysis of the subcellular localization of IBV peptides (detailed)‐fused C‐terminal of ECFP in Vero cells. The transmission phase contrast image is also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Block diagram detailing fragments of IBV N protein region 2 cloned into pECFP‐C1. Sub‐cellular localization of ECFP‐IBVNR2133−200 and ECFP‐IBVNR2201−265 in Vero cells imaged using live cell microscopy. (B)Confocal analysis of the subcellular localization of IBV peptides (detailed)‐fused C‐terminal of ECFP in Vero cells. The transmission phase contrast image is also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

Comparison of the IBV N protein NoRS with known cellular and viral NoRS

To investigate whether our identified NoRS was unique or had a mammalian cellular or viral equivalent, we conducted a search using the basic local alignment search tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/). No known mammalian cellular or non‐avian coronavirus viral protein sequences were highlighted. Using AlignX, a consensus NoRS was derived by comparing the IBV N protein NoRS with known cellular and viral NoRS which have been shown to target exogenous proteins to the nucleolus (Figure 8). The consensus sequence was composed of two basic groups, both of which were arginine rich. Compared with this consensus sequence, analysis revealed that the arg72 and arg73 of the IBV N protein NoRS were conserved, arg76 and lys78 were similar and Gln74 were weakly similar.
Figure 8

AlignX analysis of the IBV N protein NoRS with known cellular and viral NoRSs which can target an exogenous protein to the nucleolus. Conserved amino acids are shaded blue, similar amino acids shaded in green and weakly similar amino acids in green font. The cellular and viral NoRSs are described in NoRS Aplysia learning‐associated protein (68), NoRS HIV‐1 Tat (69), NoRS (GGNNV) protein alpha (70), NoRS angiogen (71), NoRS HSV gamma1 34.5 (21), NoRS HIV‐1 rev (72), NoRS fibroblast growth factor‐2 (14), NoRS survivin‐deltaEx3 (13), NoRS MDM2 (73), NoRS NF‐kappa (74), NoRS nuclear VCP‐like protein (NVL2) (75), NoRS p120 (22), NoRS HICp40 (76) and NoRS herpes/mareks MEQ (77).

AlignX analysis of the IBV N protein NoRS with known cellular and viral NoRSs which can target an exogenous protein to the nucleolus. Conserved amino acids are shaded blue, similar amino acids shaded in green and weakly similar amino acids in green font. The cellular and viral NoRSs are described in NoRS Aplysia learning‐associated protein (68), NoRS HIV‐1 Tat (69), NoRS (GGNNV) protein alpha (70), NoRS angiogen (71), NoRS HSV gamma1 34.5 (21), NoRS HIV‐1 rev (72), NoRS fibroblast growth factor‐2 (14), NoRS survivin‐deltaEx3 (13), NoRS MDM2 (73), NoRS NF‐kappa (74), NoRS nuclear VCP‐like protein (NVL2) (75), NoRS p120 (22), NoRS HICp40 (76) and NoRS herpes/mareks MEQ (77).

Delineation of a leucine‐rich NES in IBV N protein

Bioinformatic analysis of N protein indicated that a predicted NES was located between amino acids 291–298, LQLDGLHL. To test whether this motif functioned as an NES, these amino acids were deleted in the context of wild‐type N protein‐fused C‐terminal of ECFP, creating plasmid pECFP‐IBVNΔ291−298. As a control, amino acids 268–275 (VTAMLNLV), encompassing a hydrophobic region, were deleted in the context of wild‐type N protein‐fused C‐terminal of ECFP, creating plasmid pECFP‐IBVNΔ268−275. Vero cells were transfected with these plasmids and analyzed by live cell imaging at 24 h post‐transfection. The data indicated that the predicted NES deletion mutant (ECFP‐IBVNΔ291−298) localized predominately to the nucleus and nucleolus, whereas the control deletion (ECFP‐IBVNΔ268−275) had no apparent effect on the subcellular localization of the protein (Figure 9A) when compared to wild‐type N protein‐fused C‐terminal of EGFP (2, 9) (23, 25, 43).
Figure 9

(A ) Live cell imaging showing the subcellular localization of EGFP‐IBVN compared with EGFP‐IBV N fusion protein with a deleted NES (EGFP‐IBVN(B)Live cell imaging showing the subcellular localization of the NES knockout (ECFP‐IBVNR3Δ291−298) and specific alanine substitution mutants in the context of the ECFP IBV N region 3 fusion proteins. Bright field images are also presented. (C)Confocal analysis of selected alanine substitution mutants in the context of EGFP‐IBV N protein. The transmission phase contrast image is also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate.

(A ) Live cell imaging showing the subcellular localization of EGFP‐IBVN compared with EGFP‐IBV N fusion protein with a deleted NES (EGFP‐IBVN(B)Live cell imaging showing the subcellular localization of the NES knockout (ECFP‐IBVNR3Δ291−298) and specific alanine substitution mutants in the context of the ECFP IBV N region 3 fusion proteins. Bright field images are also presented. (C)Confocal analysis of selected alanine substitution mutants in the context of EGFP‐IBV N protein. The transmission phase contrast image is also presented. Scale bar is 10 μm, and the nucleolus (No) is arrowed where appropriate. Given that the bioinformatic analysis indicated that region 3 contained potential NLSs, we investigated whether the NES was dominant to these signals. The above NES deletion was made in the context of the region 3 fusion protein, pECFP‐IBVNR3, creating plasmid pECFP‐IBVNR3Δ291−298 for the expression of recombinant fusion protein. Live cell imaging of this protein in Vero cells at 24 h post‐transfection indicated that when the NES was deleted (Figure 9B) region 3 had a similar localization pattern to ECFP only (Figure 2), in that the fragment localized to the nucleus and cytoplasm but not nucleolus. This data indicated that despite containing two predicted NLSs, region 3 did not accumulate in the nucleus or nucleolus, as would be predicted if it contained such active signals. To investigate the relative importance of leucine residues in nuclear export, appropriate alanine substitutions were made either in the context of the NES in region 3 only or in the context of wild‐type N protein. To determine whether residues 293L and 298L were involved in nuclear export, these positions were substituted for alanine both individually and together in the context of ECFP fused to region 3 (pECFP‐IBVNR3), creating plasmids, pECFP‐IBVNR3293L→A, pECFP‐IBVNR3298L→A and pECFP‐IBVNR3293/298L→A (respectively). These plasmids were transfected into Vero cells and the subcellular localization of the resulting fusion proteins analyzed by direct florescence using live cell imaging (Figure 9B). The data indicated that none of these changes affected the distribution of the fusion protein, suggesting that these amino acids were not involved in nuclear export. Amino acids 291L was substituted for alanine in the context of EGFP‐IBVN, creating plasmid pEGFP‐IBVN291L→A. Expression of this fusion protein in Vero cells and analysis using relative fluorescence indicated an increased level of N protein in the nucleus (Figure 9C) when compared with expression of the wild‐type N protein (Figure 2), thus suggesting that position 291L is involved in nuclear export. This is in contrast with EGFP‐IBVN293L→A expressed in Vero cells where there is no apparent difference in the localization to wild‐type N protein (Figure 2).

Discussion

NoRSs are not well characterized, and we have made use of the avian IBV coronavirus N protein to study these. To investigate whether IBV N protein contained a NoRS, initially the protein was expressed as a series of single and overlapping regions. This preliminary analysis indicated that IBV N protein contained a NoRS in region 1. Deletion mutagenesis delineated a 20 amino acid motif that modulated nucleolar retention. Subsequent tetra‐alanine substitution mutagenesis highlighted that four residues were crucial for the targeting function, 71WRRQ, with residues 75ARFK also promoting retention. The role of this novel octa‐peptide in nucleolar localization was confirmed by deletion mutagenesis in the context of full length N protein and by placing the motif C‐terminal of ECFP and DsReD. These latter constructs also colocalized with nucleolin and fibrillarin, suggesting that the WRRQARFK motif directs a protein to the DFC. Certainly, IBV N protein has been shown to localize to the DFC (43). This is the first description of a defined NoRS in a coronavirus N protein which localizes to the nucleolus. Although region 2 could localize ECFP to the nucleolus, the NoRS identified in region 1 resulted in nucleolar accumulation of fluorescent fusion proteins when comparing the ratio of protein in the nucleus versus the nucleolus. Region 2, although containing no predicted NLSs (and subcellular localization motifs), localized predominately to the nucleus. When region 2 was fused to region 3, ECFP localized predominately to the cytoplasm, suggesting that if a NLS is present, it is submissive to the NES in region 3. Studies have suggested that phosphorylation can control nucleolar retention of certain proteins (44). However, mass spectroscopic analysis revealed that no phosphorylated amino acids are present in region 1 (37), and therefore, we hypothesize that phosphorylation plays no role in the specific nucleolar targeting activity. However, in full length, protein conformational changes may be induced by phosphorylation and/or cleavage to expose relevant motifs to direct the protein to appropriate subcellular localizations. Bioinformatic analysis found that some of the most abundant motifs within the nucleolar proteome were the RNA‐recognition motif and the DEAD/H box helicase domain (6). Although the non‐phosphorylated form of IBV N protein binds cellular RNA with high affinity (37), this protein contains no known cellular RNA‐binding motifs. In addition, phosphorylated N protein (which is present inside the cell) has low affinity for non‐viral RNA (37). Sequence analysis reveals that region 3 of IBV N protein contains the amino acid sequence 371DEAD. However, the helicase activity of this protein is unknown. In addition, region 3 does not localize to the nucleolus, even when the NES was deleted. Also, other tri‐peptide or tetra‐peptide motifs containing either GR or RG motifs are over‐represented in the nucleolar proteome (6) but not represented in the IBV N protein sequence. Therefore, we propose that WRRQARFK motif acts exclusively as the NoRS for IBV N protein. The three dimensional structure of IBV N protein region 1 was modelled based on the solution structure of the equivalent region of SARS‐CoV N protein (45). Amino acid sequence alignment between the two regions (Figure 10A) and superimposition of the model on the structure of SARS‐CoV N protein (Figure 10B) indicated that a credible molecular model of IBV N protein region 1 could be generated by comparative modelling methods (Figure 10C). Coupled to the tetra‐alanine amino acid substitution mutagenesis analysis and subcellular localization of ECFP‐WRRQARFK and DsRed‐WRRQARFK to the nucleolus and comparison with cellular and viral NoRSs, the data indicated that Arg72 and Arg73 were present at the bottom of a pocket and were thus accessible for interaction with cellular factors which may be involved in nucleolar targeting/retention.
Figure 10

(A ) Sequence alignment of IBV N protein region 1 to SARS‐CoV N protein region 1. Identical amino acids are indicated by an asterisk and the position of the tetra‐alanine substitutions on IBV N protein are indicated by coloured boxes which correspond to their position on the three‐dimensional model. (B)Mapping the modelled structure of the IBV N protein region 1 (red) on the solution structure of SARS‐CoV protein region 1 (white). (C)Three‐dimensional model of region 1 of IBV N protein, the position of the tetra‐alanine substitutions, is indicated by the appropriate colour as shown in (A).

(A ) Sequence alignment of IBV N protein region 1 to SARS‐CoV N protein region 1. Identical amino acids are indicated by an asterisk and the position of the tetra‐alanine substitutions on IBV N protein are indicated by coloured boxes which correspond to their position on the three‐dimensional model. (B)Mapping the modelled structure of the IBV N protein region 1 (red) on the solution structure of SARS‐CoV protein region 1 (white). (C)Three‐dimensional model of region 1 of IBV N protein, the position of the tetra‐alanine substitutions, is indicated by the appropriate colour as shown in (A). Although the focus of this study was to elucidate whether IBV N protein contained a NoRS, a functional NES was also identified in region 3. Interestingly, region 3 also contained two predicted NLSs, which could either have been submissive to the NES or not functional. Such basic regions are found in the C‐terminal regions of other coronavirus N proteins and in the case of SARS‐CoV proposed to act as an NLS (46). However, subsequent experimental data showed that this sequence was non‐functional (25, 47). Deletion mutagenesis of the IBV NES in the context of a region 3 peptide again suggested that the region 3 NLS was non‐functional in IBV. Our current and previous studies (23, 24) indicated that by fusing EGFP/ECFP with IBV N protein increased the molecular weight of this protein above the size exclusion limit of the nuclear pore complex. The fusion peptides generated in this study are close to the size exclusion limit (50–60 kDa) (9). The region 3 fusion protein (∼43 kDa) is below the size exclusion limit and could theoretically diffuse into and out of the nucleus. However, as discussed above, the peptide localized to the cytoplasm, again indicating the presence of a functional NES. Similar to other RNA viruses, IBV replication is error prone and the genome also undergoes recombination (48, 49). Therefore, due to selection pressure, there is sequence variability causing the formation of different IBV strains (50), which has led to different clinical outcomes, such as predominately respiratory or nephropathogenic disease (34). This variability is reflected in the amino acid sequence of the N protein, with presumably essential amino acids remaining unchanged or being conserved. Comparison of the Beaudette strain N protein amino acid sequence (used in this study) with nine other strains of IBV including a nephropathogenic strain (accession numbers are shown in square brackets) Ark99 [M85244], DE072[AF203001], M41[M28566], N2/75 [U52598], N1/62 [U52596], N9/74 [U52597], QXIBV [AF199412], KB8523[M21515] and LX4[AAQ21592] revealed that the essential NoRS 71WRRQ motif was identical in all strains, as was amino acid 78K. With regard to the NES located between amino acids 291–298, amino acids 291L and 296L were identical, whereas 293L was not, and 298L was identical in all but one strain, where it was substituted for a valine (and thus was conserved). Substitution of appropriate leucine residues in the NES would support the role of the conserved leucines being the functional in nuclear export. Analysis of the SARS‐CoV N protein revealed that although it contains a potential NoRS(s) which has been mapped to region 2 (25), the protein localizes to the cytoplasm only in infected cells (25, 47). However, it can localize to the nucleus/nucleolus when expressed in the absence of other viral proteins (51, 52), albeit with low frequency when compared with IBV N protein (25). Unlike IBV N protein, SARS‐CoV N protein does not possess a recognizable CRM‐1‐dependent NES but instead contains an uncharacterized cytoplasmic retention/NES in region 3 (25). Coronaviruses are closely related to arteriviruses, and although the arterivirus N protein has no discernable homology to the coronavirus N protein, and has a molecular weight of 15 kDa, several arterivirus N proteins have been shown to localize to the nucleolus (53, 54). In the case of the arterivirus porcine reproductive and respiratory syndrome virus (PRRSV) N protein, two NLSs were identified, one which directed the protein to the nucleus and one which directed the protein to the nucleus and nucleolus (53). In comparison to the IBV N protein NoRS, the PRRSV NoRS was lysine rather than arginine rich. Bioinformatic analysis using NetNES predictor revealed no obvious NES in this protein, although the equine arteritis virus N protein is sensitive to leptomycin B treatment (54). An emerging paradigm is that both plant and animal positive strand RNA viruses can interact with nucleus, the nucleolus and nucleolar proteins to recruit factors to aid in virus replication and/or subvert host cell function 55, 56, 57, 58, 59, 60, 61, 62, 63). If viral proteins target subnuclear structures such as the nucleolus, then they must contain appropriate signalling motifs, not only for localization but crucially for export back to the cytoplasm. If such proteins were to be retained in the nucleolus, then we would predict that virus replication would be down‐regulated, as the principle site of replication for positive‐strand RNA viruses is the cytoplasm. Disrupting the efficiency of nucleolar localization/nuclear export of viral proteins may therefore be a way of attenuating positive‐strand virus replication, whether as part of an antiviral strategy or for the design of recombinant vaccines. Certainly, the replication of HIV‐1 can be inhibited by disrupting the interaction of HIV‐1 with the nucleolus (64, 65). In summary, IBV N protein contains an eight amino acid motif which is necessary and sufficient for nucleolar retention and a functional NES to traffic the protein to the cytoplasm.

Materials and Methods

Cell culture

Vero (monkey‐derived kidney epithelial) cells were grown at 37 °C with 5% CO2 in minimum Eagles media (MEM) supplemented with 10% foetal calf serum and penicillin/streptomycin as described previously (24).

Construction of plasmids

The N gene from the Beaudette strain (accession number: AAA46214) of IBV served as a template for PCR of region and subregion constructs. Primers used incorporated 5′‐XhoI site and 3′‐SacII site for cloning into pECFP‐C1 (enhanced cyan fluorescent protein) (Clontech, Palo Alto, CA, USA). At all times, numbers used in primer or construct names denoting amino acid numbers refer to their position on the full length N protein. Primers used for the constructs were as follows: pECFP‐NR1 (amino acids 1–133), forward primer GGCCGGTCCTCGAGCCATGGCAAGCGGTAAAGCAGCTGG and reverse primer GACCGGTCCCGCGGCTAATCTCTTGTACCCTGATTGGATC; pECFP‐NR2 (amino acids 133–265), forward primer GGCCGGTCCTCGAGCCATGGATCCTGATAAGTTTGACCAATA and reverse primer GACCGGTCCCGCGGCTAATCCTTAATACCTTCCTCATTCATCT and ECFP‐NR3 (amino acids 265–409), forward primer GGCCGGTCCTCGAGC CATGGGGCGTGTTACAGCAATGCTCAA and reverse primer GACCGGTCCCGCGGCTAAAGTTCATTCTCTCCTAGAGCTGCAT. Double region construct (pECFP‐NR2+3) was produced using a combination of the appropriate forward and reverse primers. Double region construct pECFP‐NR1+2 was constructed as described previously (43). Production of the N1 subregion constructs utilized the following primer combinations: pECFP‐NR11−50, forward primer GGCCGGTCCTCGAGCCATGGCAAGCGGTAAA and reverse primer GACCGGTCCCGCGGCTACTTGGGCGGAGG; pECFP‐NR151−100, forward primer GGCCGGTCCTCGAGCCATGTTTGAAGGTAGCGGT and reverse primer GACCGGTCCCGCGGCTAAGGTCCTGTTCC and pECFP‐NR1101−133, forward primer GGCCGGTCCTCGAGCCATGGCCGCTGACCTGAAC and reverse primer GACCGGTCCCGCGGCTAATCTCTTGTACCCTG. PCR products were purified and subcloned into pCR2.1 TOPO vector (Invitrogen, Carlsbad, CA, USA). DNA was purified by alkaline lysis (66), and digested using XhoI and SacII before being ligated into pECFP‐C1 using T4 DNA ligase (Invitrogen), as per the manufacturer's instructions. To produce the full‐length inserts used for delineation of the NoRS in N1, the following oligonucleotides comprising restriction overhangs: (5′, XhoI; 3′, SacII) ECFP‐N1b61−80, forward primer TCGAGCCATGAACATTAAGCCAAGCCAGCAACATGGATACTGGAGACGCCAAGCCAGGTTTAAGCCAGGCTAGCCGC and reverse primer GGCTAGCCTGGCTTAAACCTGGCTTGGCGTCTCCAGTATCCATGTTGCTGGCTTGGCTTAATGTTCATGGC; ECFP‐N1b71−90, forward primer TCGAGCCATGTGGAGACGCCAAGCCAGGTTTAAGCCAGGCAAAGGTGGAAGAAAACCAGTCCCAGATGCTTAGCCGC and reverse primer GGCTAAGCATCTGGGACTGGTTTTCTTCCACCTTTGCCTGGCTTACCTGGCTTGGCGTCTCCACATGGC and ECFP‐N1b81−100, forward primer TCGAGCCATGAAAGGTGGAAGAAAACCAGTCCCAGATGCTTGGTACTTTTACTATACTGGAACAGGACCTTAGCCGC and reverse primer GGCTAAGGTCCTGTTCCAGTATAGTAAAAGTACCAAGCATCTGGGACTGGTTTTCTTCCACCTTTCATGGC. Tetra‐alanine substitution analysis of the region N1b71−90 was also undertaken utilizing full‐length oligonucleotides with 5′‐XhoI and 3′‐SacII restriction overhangs: ECFP‐N1b71WRRQ→AAAA, TCGAGCCATGGCCGCCGCCGCCGCCAGGTTTAAGCCAGGCAAAGGTGGAAGAAAACCAGTCCCAGATGCTTAGCCGC and GGCTAAGCATCTGGGACTGGTTTTCTTCCACCTTTGCCTGGCTTAAACCTGGCGGCGGCGGCGGCCATGGC; ECFP‐N1b75ARFK→AAAA, TCGAGCCATGTGGAGACGCCAAGCCGCCGCCGCCCCAGGCAAAGGTGGAAGAAAACCAGTCCCAGATGCTTAGCCGC and GGCTAAGCATCTGGGACTGGTTTTCTTCCACCTTTGCCTGGGGCGGCGGCGGCTTGGCGTCTCCACATGGC; ECFP‐N1b79PGKG→AAAA, TCGAGCCATGTGGAGACGCCAAGCCAGGTTTAAGGCCGCCGCCGCCGGAAGAAAACCAGTCCCAGATGCTTAGCCGC and GGCTAAGCATCTGGGACTGGTTTTCTTCCGGCGGCGGCGGCCTTAAACCTGGCTTGGCGTCTCCACATGGC; ECFP‐N1b83GRKP→AAAA, TCGAGCCATGTGGAGACGCCAAGCCAGGTTTAAGCCAGGCAAAGGTGCCGCCGCCGCCGTCCCAGATGCTTAGCCGC and GGCTAAGCATCTGGGACGGCGGCGGCGGCACCTTTGCCTGGCTTAAACCTGGCTTGGCGTCTCCACATGGC and ECFP‐N1b87VPDA→AAAA, TCGAGCCATGTGGAGACGCCAAGCCAGGTTTAAGCCAGGCAAAGGTGGAAGAAAACCAGCCGCCGCCGCCTAGCCGC and GGCTAGGCGGCGGCGGCTGGTTTTCTTCCACCTTTGCCTGGCTTAAACCTGGCTTGGCGTCTCCACATGGC. The octa‐peptide nucleolar localization signal (described below) was deleted in the context of full‐length N protein by overlapping PCR using forward primer Jae1 forward GAATTCATGGCAATGGCAAGCGGTAAAGCAGCTGGA and reverse primer NoRS reverse TCCACCTTTGCCTGGGTATCCATGTTGCTGGC to generate one PCR product and forward primer NoRS forward GCCAGCAACATGGATACCCAGGCAAAGGTGGA and Jae1 reverse GGATCCTCAAAGTTCATTCTCTCCTAGATGC (25) to generate the second PCR product. A second round of PCR was performed using both PCR products as templates and Jac1 forward and reverse primers. The resulting product was subcloned into pCR2.1, and then the fragment restricted into pEGFP‐C2 (enhanced green fluorescent protein). To investigate whether the octa‐peptide was sufficient to direct nucleolar localization, the signal and appropriate control peptides were placed C‐terminal of ECFP and/or DsRed by generating overlapping oligonucleotides with 5′‐XhoI and 3′‐SacII restriction overhangs for direct ligation into either pECFP‐C1 or pDsRed‐C1 which had been digested with the appropriate restriction enzymes. WRRQARFK was placed C‐terminal of ECFP and DsRed, creating pECFP‐WRRQARFK and pDsRed‐WRRQARFK, forward primer TCGAGCCATGTGGAGACGCCAAGCCAGGTTTAAGTAGCCGC and reverse primer GGCTACTTAAACCTGGCTTGGCGTCTCCACATGGC. The same cloning strategy was used to generate pECFP‐GRKPVPDA (forward primer TCGAGCCATGGGAAGAAAACCAGTCCCAGATGCTTAGCCGC and reverse primer GGCTAAGCATCTGGGACTGGTTTTCTTCCCATGGC), pECFP‐WRRQAAAA (forward primer TCGAGCCATGTGGAGACGCCAAGCCGCCGCCGCCTAGCCGC and reverse primer GGCTAGGCGGCGGCGGCTTGGCGTCTCCACATGGC) and pECFP‐AAAAARFK (forward primer TCGAGCCATGGCCGCCGCCGCCGCCAGGTTTAAGTAGCCGC and reverse primer GGCTACTTAAACCTGGCGGCGGCGGCGGCCATGGC). To investigate potential targeting signals in region 2 of IBV N protein, a similar cloning strategy was used. Region 2 was subdivided between amino acids 133–200 and 201–265 and placed C‐terminal of ECFP. PCR primers used were pECFP‐IBVNR2133−200 (forward primer GGCCGGTCCTCGAGCCATGGATCCTGATAAGTTT and reverse primer GACCGGTCCCGCGGCTATGCACGAGCAAT) and pECFP‐IBVNR2201−265 (forward primer GGCCGGTCCTCGAGCCATGGCAAAGATAATCCAG and reverse primer GACCGGTCCCGCGGCTAATCCTTAATACCTTCCTC). Potential targeting signals located between amino acids 201–240 were further investigated using expression constructs comprised of overlapping oligonucleotides to generate amino acid peptides C‐terminal of ECFP (as described above for region 1): pECFP‐IBVNR2201−220 (forward primer TCGAGCCATG GCAAAGATAATCCAGGATCAGCAGAAAAAGGGCTCTCGCATTACCAAGGCAAAGGCAGATTAGCCGC and reverse primer GGCTAATCTGCCTTTGCCTTGGTAATGCGAGAGCCCTTTTTCTGCTGATCCTGGATTATCTTTGCCATGGC), pECFP‐IBVNR2211−230 (forward primer TCGAGCCATGGGCTCTCGCATTACCAAGGCAAAGGCAGATGAAATGGCTCATCGCCGGTATTGCAAGCGCTAGCCGC and reverse primer GGCTAGCGCTTGCAATACCGGCGATGAGCCATTTCATCTGCCTTTGCCTTGGTAATGCGAGAGCCCATGGC) and pECFP‐IBVNR2221−240 (forward primer TCGAGCCATGGAAATGGCTCATCGCCGGTATTGCAAGCGCACTATCCCACCTAATTATAGGGTTGATCAATAGCCGC and reverse primer GGCTATTGATCAACCCTATAATTAGGTGGGATAGTGCGCTTGCAATACCGGCATGAGCCATTTCCATGGC). Deletion mutagenesis was undertaken using the Stratagene (La Jolla, CA, USA) Quikchange II kit as per the manufacturer's instructions. The following primers were used to delete each putative NES site: EGFP‐IBVNΔL268‐L275 (control), forward primer GTATTAAGGATGGGCGTCCTAGCAGCCATGCT and reverse primer AGCATGGCTGCTAGGACGCCCATCCTTAATAC and EGFP‐IBVNΔ291−298 (NES), forward primer GAAGTAGAGTGACACCCAAATTTGAATTTACTACTGTGGTCC and reverse primer GGACCACAGTAGTAAATTCAAATTTGGGTGTCACTCTACTTC. Alanine substitution mutagenesis of the NES in the context of region 3 (ECFP‐IBVNR3) was undertaken using the Stratagene Quikchange Multi kit as per the manufacturer's instructions. Primers used to make the following constructs were pECFP‐IBVNR3293L→A, forward primer GAGTGACACCCAAACTTCAAGCCGATGGGCTTCACTTGAGA and reverse primer TCTCAAGTGAAGCCCATCGGCTTGAAGTTTGGGTGTCACTC and pECFP‐IBVNR3298L→A, forward primer CTTCAACTAGATGGGCTTCACGCCAGATTTGAATTTACTACTGTGGT and reverse primer ACCACAGTAGTAAATTCAAATCTGGCGTGAAGCCCATCTAGTTGAAG. pECFP‐IBVNR3293/298L→A was produced using a combination of the above primers as per kit instructions. Overlapping PCR as described above was used to substitute 291L for A (pEGFP‐IBVN291L→A) and 293L for A (pEGFP‐IBVN293L→A), in the context of EGFP‐IBVN. Unique primer combinations were 291L for A (forward GAAGTAGAGTGACACCCAAAGCCCAACTAGATGGGCTTCACTT and reverse AAGTGAAGCCCATCTAGTTGGGCTTTGGGTGTCACTCTACTTC) and 293L for A (forward GAGTGACACCCAAACTTCAAGCCGATGGGCTTCACTTGAGA and reverse TCTCAAGTGAAGCCCATCGGCTTGAAGTTTGGGTGTCACTC). The sequences of all constructs used in this study were confirmed by sequencing and where appropriate expression of the resulting fusion proteins by Western blot (data not shown).

Live cell imaging

Vero cells were transfected with 1 µg DNA to 5 µg polyethylenimine (PEI). DNA and PEI were mixed in a total volume of 200 µL serum‐free Dulbecco's modified Eagles media (DMEM) and incubated at 20 °C for 30 min. Thirty‐millimetre cell cultures dishes were seeded with 2 × 105 cells in MEM as per cell culture methods. Transfection mix was added in drop‐wise to cells and incubated at 37 °C with 5% CO2 for 24 h. Live cell imaging was performed using a Nikon Eclipse TS100 microscope utilizing the appropriate filter for each tag (e.g. Filter B‐2A, excitation 450–490 nm for ECFP/EGFP). Fluorescence and bright‐field images were captured using a Nikon Digital Sight DS‐L1.

Confocal microscopy

Confocal sections of fixed samples were captured on an LSM510 META microscope (Carl Zeiss Ltd., Oberkochen, Germany) equipped with a × 40 and × 63, NA 1.4, oil immersion lens. Pinholes were set to allow optical sections of 1 mm to be acquired. In singly transfected cells, ECFP was excited with the 458 nm argon laser line running at 10%, and emission was collected through a BP435‐485 emission filter. EGFP was excited with the 488 nm argon laser line running at 2%, and emission was collected through a LP505 filter. DsRed was excited with the helium : neon 543 nm laser line in all cases, and emission was collected through a LP560 filter. Due to excitation of the EGFP molecule by the 458 nm argon laser line, EGFP and ECFP cotransfected samples were linearly unmixed using the META detector. Lambda plots of EGFP and ECFP were generated from singly transfected reference samples excited with the 458 nm argon laser line and collected with the META detector between 461 and 536 nm, in 10.7‐nm increments. These lambda plots were then utilized to separate, or unmix, overlapping emission signal from cotransfected samples. All fluorescence was measured in the linear range as the detector is a photomultiplier, and the range indicator was utilized to ensure that no saturated pixels were obtained on image capture. Images were scanned 16 times. No cross‐talk between channels was determined by switching off the appropriate excitation laser and imaging the corresponding emission (43). Relative fluorescent intensity was measured every 0.2 mm and averaged for the cytoplasm, nucleus and nucleolus. In this study, all confocal images showing IBV N protein or derived peptides and nucleolar marker proteins are presented in green and red, respectively (false coloured where appropriate using the Zeiss LSM Image Browser). Colocalization is shown in yellow.

Protein alignment and comparative modelling

AlignX (VectorNTI, version 9.0) was used to align amino acid sequences for generation of a consensus NoRS. The application uses a modified Clustal W algorithm. The sequences of the IBV N protein region 1 was searched against the Protein Databank and the N‐terminal RNA‐binding domain of SARS‐CoV nucleocapsid protein [(45); PDB entry 1ssk chain A] identified as a suitable template structure for comparative modelling (with a BLAST E‐value of 1 × 10–18 for residues of the protein region 1). The model is based on the coordinates of the NMR, minimized average structure. They share 38% sequence identity over 137 residues. The sequence alignment (Figure 8B) was used to construct a model for IBV N protein region 1 using the comparative protein structure modelling program MODELLER (67).

Acknowledgments

This work was funded by the BBSRC, project grant number BBSB03416 to GB and JAH and studentship BBSSP200310434 to JAH. The confocal microscope facility in the Astbury Centre for Structural Molecular Biology was funded by the Wellcome Trust and SRIF, and we thank Gareth Howell for his help in using this facility and Jae‐Hwan You in our laboratory for the provision of the pEGFP‐IBVN clone. The authors also thank Mark Harris, Eric Hewitt and John Findlay and members of the coronavirus group for critically reviewing this manuscript and suggesting appropriate experiments.
  76 in total

Review 1.  Molecular biology of umbraviruses: phantom warriors.

Authors:  Michael E Taliansky; David J Robinson
Journal:  J Gen Virol       Date:  2003-08       Impact factor: 3.891

2.  Involvement of the nucleolus in plant virus systemic infection.

Authors:  S H Kim; E V Ryabov; J W S Brown; M Taliansky
Journal:  Biochem Soc Trans       Date:  2004-08       Impact factor: 5.407

3.  Nucleolar proteome dynamics.

Authors:  Jens S Andersen; Yun W Lam; Anthony K L Leung; Shao-En Ong; Carol E Lyon; Angus I Lamond; Matthias Mann
Journal:  Nature       Date:  2005-01-06       Impact factor: 49.962

4.  Mass spectroscopic characterization of the coronavirus infectious bronchitis virus nucleoprotein and elucidation of the role of phosphorylation in RNA binding by using surface plasmon resonance.

Authors:  Hongying Chen; Andrew Gill; Brian K Dove; Stevan R Emmett; C Fred Kemp; Mark A Ritchie; Michael Dee; Julian A Hiscox
Journal:  J Virol       Date:  2005-01       Impact factor: 5.103

5.  Subcellular localization of the severe acute respiratory syndrome coronavirus nucleocapsid protein.

Authors:  Jaehwan You; Brian K Dove; Luis Enjuanes; Marta L DeDiego; Enrique Alvarez; Gareth Howell; Paul Heinen; Maria Zambon; Julian A Hiscox
Journal:  J Gen Virol       Date:  2005-12       Impact factor: 3.891

6.  Identification of the nuclear and nucleolar localization signals of the protein p120. Interaction with translocation protein B23.

Authors:  B C Valdez; L Perlaky; D Henning; Y Saijo; P K Chan; H Busch
Journal:  J Biol Chem       Date:  1994-09-23       Impact factor: 5.157

7.  Structure of the N-terminal RNA-binding domain of the SARS CoV nucleocapsid protein.

Authors:  Qiulong Huang; Liping Yu; Andrew M Petros; Angelo Gunasekera; Zhihong Liu; Nan Xu; Philip Hajduk; Jamey Mack; Stephen W Fesik; Edward T Olejniczak
Journal:  Biochemistry       Date:  2004-05-25       Impact factor: 3.162

8.  Identification of nuclear/nucleolar localization signal in Aplysia learning associated protein of slug with a molecular mass of 18 kDa homologous protein.

Authors:  Hyoung Kim; Deok-Jin Chang; Jin-A Lee; Yong-Seok Lee; Bong-Kiun Kaang
Journal:  Neurosci Lett       Date:  2003-06-05       Impact factor: 3.046

9.  Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses.

Authors:  Carlos P Rubbi; Jo Milner
Journal:  EMBO J       Date:  2003-11-17       Impact factor: 11.598

Review 10.  The molecular biology of coronaviruses.

Authors:  M M Lai; D Cavanagh
Journal:  Adv Virus Res       Date:  1997       Impact factor: 9.937

View more
  31 in total

1.  Quantitative proteomics using stable isotope labeling with amino acids in cell culture reveals changes in the cytoplasmic, nuclear, and nucleolar proteomes in Vero cells infected with the coronavirus infectious bronchitis virus.

Authors:  Edward Emmott; Mark A Rodgers; Andrew Macdonald; Sarah McCrory; Paul Ajuh; Julian A Hiscox
Journal:  Mol Cell Proteomics       Date:  2010-05-13       Impact factor: 5.911

2.  Ribonucleocapsid formation of severe acute respiratory syndrome coronavirus through molecular action of the N-terminal domain of N protein.

Authors:  Kumar Singh Saikatendu; Jeremiah S Joseph; Vanitha Subramanian; Benjamin W Neuman; Michael J Buchmeier; Raymond C Stevens; Peter Kuhn
Journal:  J Virol       Date:  2007-01-17       Impact factor: 5.103

3.  Identification of a common subnuclear localization signal.

Authors:  Karim Mekhail; Luis Rivero-Lopez; Ahmad Al-Masri; Caroline Brandon; Mireille Khacho; Stephen Lee
Journal:  Mol Biol Cell       Date:  2007-07-25       Impact factor: 4.138

Review 4.  Nucleolar targeting: the hub of the matter.

Authors:  Edward Emmott; Julian A Hiscox
Journal:  EMBO Rep       Date:  2009-02-20       Impact factor: 8.807

5.  Nuclear and Nucleolar Localization of Bovine Adenovirus-3 Protein V.

Authors:  Xin Zhao; Suresh K Tikoo
Journal:  Front Microbiol       Date:  2021-01-06       Impact factor: 5.640

Review 6.  Controlling subcellular delivery to optimize therapeutic effect.

Authors:  Mohanad Mossalam; Andrew S Dixon; Carol S Lim
Journal:  Ther Deliv       Date:  2010-07

7.  PNRC accumulates in the nucleolus by interaction with B23/nucleophosmin via its nucleolar localization sequence.

Authors:  Yuanzhong Wang; Bin Chen; Yuping Li; Dujin Zhou; Shiuan Chen
Journal:  Biochim Biophys Acta       Date:  2010-10-01

8.  Multiple controls regulate nucleostemin partitioning between nucleolus and nucleoplasm.

Authors:  Lingjun Meng; Hiroaki Yasumoto; Robert Y L Tsai
Journal:  J Cell Sci       Date:  2006-12-15       Impact factor: 5.285

9.  Nucleolar trafficking of nucleostemin family proteins: common versus protein-specific mechanisms.

Authors:  Lingjun Meng; Qubo Zhu; Robert Y L Tsai
Journal:  Mol Cell Biol       Date:  2007-10-08       Impact factor: 4.272

10.  Characterization of Localization and Export Signals of Bovine Torovirus Nucleocapsid Protein Responsible for Extensive Nuclear and Nucleolar Accumulation and Their Importance for Virus Growth.

Authors:  Makoto Ujike; Yukako Kawachi; Yui Matsunaga; Yuka Etho; Hideki Asanuma; Wataru Kamitani; Fumihiro Taguchi
Journal:  J Virol       Date:  2021-01-13       Impact factor: 5.103

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.