| Literature DB >> 17187661 |
Le-Hoa Truong1, Julia S Kuliwaba, Helen Tsangari, Nicola L Fazzalari.
Abstract
Previous studies have shown a generalised increase in bone mass in <span class="Species">patients with <span class="Disease">osteoarthritis (OA). Using molecular histomorphometry, this study examined the in vivo expression of mRNA encoding bone anabolic factors and collagen type I genes (COL1A1, COL1A2) in human OA and non-OA bone. Bone samples were obtained from the intertrochanteric (IT) region of the proximal femur, a skeletal site distal to the active site of disease, from individuals with hip OA at joint replacement surgery and from autopsy controls. Semi-quantitative reverse transcription-polymerase chain reaction analysis revealed elevated mRNA expression levels of alkaline phosphatase (p < 0.002), osteocalcin (OCN) (p < 0.0001), osteopontin (p < 0.05), COL1A1 (p < 0.0001), and COL1A2 (p < 0.002) in OA bone compared to control, suggesting possible increases in osteoblastic biosynthetic activity and/or bone turnover at the IT region in OA. Interestingly, the ratio of COL1A1/COL1A2 mRNA was almost twofold greater in OA bone compared to control (p < 0.001), suggesting the potential presence of collagen type I homotrimer at the distal site. Insulin-like growth factor (IGF)-I, IGF-II, and transforming growth factor-beta1 mRNA levels were similar between OA and control bone. Bone histomorphometric analysis indicated that OA IT bone had increased surface density of bone (p < 0.0003), increased trabecular number (Tb.N) (p < 0.0003), and decreased trabecular separation (Tb.Sp) (p < 0.0001) compared to control bone. When the molecular and histomorphometric data were plotted, positive associations were observed in the controls for OCN/glyceraldehyde-3-phosphate dehydrogenase (GAPDH) versus bone tissue volume (r = 0.82, p < 0.0007) and OCN/GAPDH versus Tb.N (r = 0.56, p < 0.05) and a negative association was observed for OCN/GAPDH versus Tb.Sp (r = -0.64, p < 0.02). These relationships were not evident in trabecular bone from patients with OA, suggesting that bone regulatory processes leading to particular trabecular structures may be altered in this disease. The finding of differential gene expression, as well as architectural changes and differences in molecular histomorphometric associations between OA and controls, at a skeletal site distal to the active site of joint degeneration supports the concept of generalised involvement of bone in the pathogenesis of OA.Entities:
Mesh:
Substances:
Year: 2006 PMID: 17187661 PMCID: PMC1794534 DOI: 10.1186/ar2101
Source DB: PubMed Journal: Arthritis Res Ther ISSN: 1478-6354 Impact factor: 5.156
Figure 1X-ray of a normal proximal femur, showing the intertrochanteric region (rectangle) used for sampling.
Primer design for semi-quantitative reverse transcription-polymerase chain reaction analysis
| Target gene | Primer sequence (5'-3') | PCR product size (bp) | Annealing temperature (°C) | Number of PCR cycles | GenBank accession number |
| Sense | ccaacgtggctaagaatgTC | 434 | 58 | 30 | |
| Antisense | catctcgttgtctgagtacc | ||||
| Sense | ggtgcagcctttgtgtccaagc | 159 | 62 | 29 | |
| Antisense | GTCAGCCAACTCGTCACAGTCC | ||||
| Sense | AGCCGTGGGAAGGACAGTTATG | 472 | 62 | 29 | |
| Antisense | GAGTTTCCATGAAGCCACAAAC | ||||
| Sense | GAGCCTGCGCAATGGAATAAAG | 344 | 62 | 33 | |
| Antisense | CCTGTCTCCACACACGAACTG | ||||
| Sense | GAGGAGTGCTGTTTCCGCAG | 263 | 62 | 27 | |
| Antisense | ACGTTTGGCCTCCCTGAACG | ||||
| Sense | CTAGACCCTTTCTCCTCCAGGAGACG | 224 | 62 | 26 | |
| Antisense | GCTGGGGGTCTCCCGGCAAAAGGT | ||||
| Sense | CGGCAAGGTGTTGTGCGATG | 339 | 62 | 33 | |
| Antisense | CACGGAAATTCCTCCGGTTG | ||||
| Sense | CGCTGGTGAAGTTGGCAAACCA | 778 | 66 | 31 | |
| Antisense | GAGGACCACGAAGCCCTTCTTTC | ||||
| Sense | CATGGAGAAGGCTGGGGCTC | 415 | 62 | 23 | |
| Antisense | CACTGACACGTTGGCAGTGG |
ALP, alkaline phosphatase; COL1A, collagen type I alpha chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IGF, insulin-like growth factor; OCN, osteocalcin; OPN, osteopontin; PCR, polymerase chain reaction; TGF-β1, transforming growth factor-β1.
Figure 2Representative gene expression as determined by semi-quantitative reverse transcription-polymerase chain reaction (PCR) using total RNA extracted from intertrochanteric trabecular bone. Target genes included alkaline phosphatase (ALP) (434 bp), osteocalcin (OCN) (159 bp), osteopontin (OPN) (472 bp), insulin-like growth factor (IGF)-I (344 bp), IGF-II (263 bp), transforming growth factor-β1 (TGF-β1) (224 bp), COL1A1 (339 bp), COL1A2 (778 bp), and the housekeeping gene GAPDH (415 bp). Specimens were obtained from a 60-year-old female (F 60) and a 59-year-old male (M 59) undergoing total hip replacement for primary osteoarthritis (OA). The control specimens were obtained at autopsy from a 61-year-old female (F 61) and a 60-year-old male (M 60) without any bone-related disease. PCR products representing each mRNA species were visualised on SYBR Gold®-stained 2% agarose gels. COL1A, collagen type I alpha chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure 3Relative polymerase chain reaction product/GAPDH ratios for alkaline phosphatase (ALP), osteocalcin (OCN), and osteopontin (OPN) and the relative ratio of COL1A1/COL1A2. mRNA expression in intertrochanteric trabecular bone was compared between the osteoarthritis (OA) (n = 15) and control (n = 13) groups. Patients with OA had significantly elevated (a) ALP/GAPDH (p < 0.002), (b) OCN/GAPDH (p < 0.0001), (c) OPN/GAPDH (p < 0.05), and (d) COL1A1/COL1A2 (p < 0.0001) mRNA ratios versus controls. Data are expressed as parametric mean ± standard deviation (open diamond) and non-parametric median (closed diamond) and quartile (dash) range. COL1A, collagen type I alpha chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Semi-quantitative reverse transcription-polymerase chain reaction product/GAPDH ratios for OA and control individuals
| Ratio | OA | Control |
| ( | ( | |
| IGF-I/GAPDH | 0.52 (0.49–0.56)a | 0.63 (0.38–0.71) |
| IGF-II/GAPDH | 0.79 (0.74–0.94)a | 0.58 (0.39–0.94) |
| TGF-β1/GAPDH | 0.76 ± 0.22 | 0.72 ± 0.09 |
| COL1A1/GAPDH | 0.55 (0.47–0.59) | 0.00 (0.00–0.24)b |
| COL1A2/GAPDH | 0.37 ± 0.04 | 0.22 ± 0.14c |
aOA IGF-I/GAPDH versus OA IGF-II/GAPDH: p < 0.0003; bp < 0.0001; cp < 0.002. Parametric values are mean ± standard deviation. Non-parametric values are median (quartiles). COL1A, collagen type I alpha chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IGF, insulin-like growth factor; OA, osteoarthritis; TGF-β1, transforming growth factor-β1.
Figure 4Changes in osteocalcin (OCN)/GAPDH mRNA with age. The relative OCN/GAPDH ratios were determined in intertrochanteric trabecular bone from individuals with osteoarthritis (OA) (n = 15) and control individuals (n = 13). In OA, OCN/GAPDH mRNA increased significantly with age (OCN/GAPDH = 0.01 [Age] + 0.43; r = 0.57, p < 0.03). In controls, OCN/GAPDH mRNA significantly declined with age (OCN/GAPDH = -0.01 [Age] + 0.82; r = -0.62, p < 0.03). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure 5Association between the relative ratios of COL1A1/GAPDH mRNA and COL1A2/GAPDH mRNA. Gene expression was determined in intertrochanteric trabecular bone from patients with osteoarthritis (OA) (n = 15) and controls (n = 13). A significant correlation was observed between the two parameters in patients with OA (COL1A1/GAPDH = 1.71 [COL1A2/GAPDH] – 0.10; r = 0.66, p < 0.008) and controls (COL1A1/GAPDH = 0.91 [COL1A2/GAPDH] – 0.06; r = 0.70, p < 0.008). COL1A, collagen type I alpha chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure 6Association between the relative ratios of insulin-like growth factor (IGF)-II/GAPDH mRNA and IGF-I/GAPDH mRNA. Gene expression was determined in intertrochanteric trabecular bone from patients with osteoarthritis (OA) (n = 15) and controls (n = 13). A significant correlation was observed between the two parameters in patients with OA (IGF-II/GAPDH = 1.49 [IGF-I/GAPDH] + 0.01; r = 0.64, p < 0.02) and controls (IGF-II/GAPDH = 1.34 [IGF-I/GAPDH] – 0.09; r = 0.73, p < 0.005). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Trabecular bone structure and bone turnover indices in osteoarthritis and control intertrochanteric bone samples
| Histomorphometric parameter | Osteoarthritis | Control |
| ( | ( | |
| BV/TV (percentage) | 10.4 ± 4.1 | 7.6 ± 3.1 |
| BS/TV (mm2/mm3) | 2.3 ± 0.7 | 1.3 ± 0.4a |
| BS/BV (mm2/mm3) | 20.5 (17.3–28.6) | 18.0 (14.7–20.6) |
| Tb.Th (μm) | 98 ± 39 | 111 ± 34 |
| Tb.Sp (μm) | 817 (760–892) | 1,406 (1,203–2,202)b |
| Tb.N (number/mm) | 1.11 ± 0.36 | 0.63 ± 0.19a |
| OV/TV (percentage) | 0.12 (0.07–0.15) | 0.05 (0.04–0.13) |
| OS/BS (percentage) | 7.8 (3.7–9.7) | 7.2 (4.2–9.7) |
| ES/BS (percentage) | 4.6 (3.4–6.4) | 4.5 (2.0–7.6) |
ap < 0.0003; bp < 0.0001. Parametric values are mean ± standard deviation. Non-parametric values are median (quartiles). BS/BV, specific surface of bone; BS/TV, bone surface density; BV/TV, bone tissue volume; ES/BS, eroded surface; OS/BS, osteoid surface; OV/TV, osteoid volume; Tb.N, trabecular number; Tb.Sp, trabecular separation; Tb.Th, trabecular thickness.
Figure 7Associations between osteocalcin (OCN)/GAPDH mRNA and the histomorphometric parameters of bone tissue volume (BV/TV), trabecular number (Tb.N), and trabecular separation (Tb.Sp). The relative OCN/GAPDH mRNA expression and architectural parameters were determined in intertrochanteric trabecular bone from osteoarthritis (OA) (n = 14) and control (n = 13) individuals. (a) In controls, there was a significant increase in BV/TV with increasing OCN/GAPDH mRNA (BV/TV = 27.7 [OCN/GAPDH] – 6.3; r = 0.82, p < 0.0007) in contrast to the patients with OA (BV/TV = -7.57 [OCN/GAPDH] + 17.38; r = -0.31, p = not significant [NS]). (b) A significant increase in Tb.N with increasing OCN/GAPDH mRNA was observed in controls (Tb.N = 1.16 [OCN/GAPDH] + 0.05; r = 0.56, p < 0.05). In OA, there was no significant association between Tb.N and OCN/GAPDH mRNA (Tb.N = 0.09 [OCN/GAPDH] + 1.03; r = 0.04, p = NS). (c) In controls, there was a significant decline in Tb.Sp with increasing OCN/GAPDH mRNA (Tb.Sp = -3,977.9 [OCN/GAPDH] + 3,626.1; r = -0.64, p < 0.02) and no significant change in Tb.Sp with OCN/GAPDH mRNA in OA individuals (Tb.Sp = -353.5 [OCN/GAPDH] + 1,214.4; r = -0.19, p = NS). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.