| Literature DB >> 1696318 |
J D Puglisi1, J R Wyatt, I Tinoco.
Abstract
The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.Entities:
Mesh:
Substances:
Year: 1990 PMID: 1696318 PMCID: PMC7131512 DOI: 10.1016/0022-2836(90)90192-O
Source DB: PubMed Journal: J Mol Biol ISSN: 0022-2836 Impact factor: 5.469