Variations in gene organization and DNA uptake signal sequence in the folP region between commensal and pathogenic Neisseria species.

BACKGROUND: Horizontal gene transfer is an important source of genetic variation among Neisseria species and has contributed to the spread of resistance to penicillin and sulfonamide drugs in the pathogen Neisseria meningitidis. Sulfonamide resistance in Neisseria meningitidis is mediated by altered chromosomal folP genes. At least some folP alleles conferring resistance have been horizontally acquired from other species, presumably from commensal Neisseriae. In this work, the DNA sequence surrounding folP in commensal Neisseria species was determined and compared to corresponding regions in pathogenic Neisseriae, in order to elucidate the potential for inter-species DNA transfer within this region.
RESULTS: The upstream region of folP displayed differences in gene order between species, including an insertion of a complete Correia element in Neisseria lactamica and an inversion of a larger genomic segment in Neisseria sicca, Neisseria subflava and Neisseria mucosa. The latter species also had DNA uptake signal sequences (DUS) in this region that were one base different from the DUS in pathogenic Neisseriae. Another interesting finding was evidence of a horizontal transfer event from Neisseria lactamica or Neisseria cinerea that introduced a novel folP allele to the meningococcal population.
CONCLUSION: Genetic recombination events immediately upstream of folP and horizontal transfer have resulted in sequence differences in the folP region between the Neisseria species. This variability could be a consequence of the selective pressure on this region exerted by the use of sulfonamide drugs.

Background

Horizontal gene transfer via natural transformation is believed to be the main mechanism to generate genetic diversity among Neisseriae [1-3]. Horizontal transfer has for example contributed to the spread of resistance to penicillin in pathogenic Neisseriae, where the origin of the transforming DNA was traced to commensal Neisseria species [4]. Sulfonamide resistance in some strains of Neisseria meningitidis (the meningococcus) has also been acquired by horizontal transfer [5]. As evidence, a mosaic pattern of fragments with high sequence divergence was detected in the chromosomal folP gene, the sulfonamide resistance determinant. The origin of the transforming DNA is still unknown, but presumable donors are commensal Neisseria species.

We have previously demonstrated that commensal Neisseria isolates from healthy carriers exhibit high level sulfonamide resistance, most likely due to sulfonamide-resistant variants of folP [6]. These commensal folP genes differ substantially from previously described folP genes, but the findings suggest that sulfonamide resistance is a property carried among species of the commensal flora. Thus, the commensal flora can be a reservoir of sulfonamide resistance genes that might be transferred to pathogenic species.

Efficient transformation is dependent upon a reasonable sequence similarity between donor and recipient to facilitate homologous recombination. In addition, DNA uptake in pathogenic Neisseriae is markedly enhanced by the presence of a DNA uptake signal sequence (DUS) in the donor DNA [7,8]. Thus, the sequence within and immediately surrounding folP, especially the presence of DUS in that region, should influence how efficient commensal Neisseria species may transfer sulfonamide resistance to Neisseria meningitidis. This work presents the gene organization and the distribution of DUS in the folP region in some commensal Neisseria species and compares these to the corresponding parts of the genomes from three Neisseria meningitidis strains and Neisseria gonorrhoeae FA1090.

Results

Gene organization in commensal Neisseriae

The sequence surrounding folP was determined for Neisseria subflava by sequencing 6.8 kb of the genome. (N. subflava was chosen because sulfonamide-resistant commensal Neisseriae found in healthy carriers were phenotypically characterized as being most related to this species [6]). The corresponding sequences from N. meningitidis strains MC58 [9] and Z2491 [10], as well as N. gonorrhoeae FA1090 [11] were aligned with the N. subflava sequence. Included in this comparison was also a sequence from the on-going genome sequencing project of N. meningitidis strain 8013 (The Pasteur Institute, France). PCR primers designed from this alignment were then used to determine the gene order surrounding folP in one strain each of N. sicca, N. cinerea, N. lactamica and N. mucosa. The results are outlined in Figure 1 (see Additional file for sequence data). N. subflava, N. sicca and N. mucosa had identical gene order: directly downstream of folP was a putative phosphomanno-/phosphoglucomutase family gene (designated manB), followed by a putative membrane-associated gene belonging to the dedA family (dedA). Upstream of folP was an aromatic amino-acid amino-transferase gene (tyrB), followed by a tRNA-Arg gene, an open reading frame similar to a cytochrome c5 gene (cyt5) and a copy of the Correia repeat unit [12].

Figure 1

Comparison of gene arrangements in human . The N. subflava sequence (accession number AJ581792 in the EMBL database) is displayed in alignment with corresponding parts from other Neisseria species. Open reading frames are visualized as colored block arrows (the tip of each arrow symbolizing the stop codon) and labeled with their designations according to the text. Non-coding regions are visualized as solid lines. The dedA gene and the Correia element in N. subflava were only partially sequenced. The symbol // means that 13 kb sequence separating tyrB from dedA has been omitted in the figure. The intergenic regions are defined by dotted vertical lines and designated TC (tyrB-cyt5), DM (dedA-manB), MF (manB-folP) and FU (folP-upstream), respectively.

N. gonorrhoeae, N. lactamica, N. cinerea and the N. meningitidis strains had the same gene succession as N. mucosa/N. sicca/N. subflava downstream of folP, but the genes found upstream of folP were completely different. Instead of being located upstream folP, the gene sequence tyrB-tRNA-cyt5-Correia was in these species located 14 kb downstream of folP. The direction of tyrB and the following genes in relation to folP was also the opposite compared to the case in N. subflava/N. sicca/N. mucosa. This indicates that the difference in gene organization was due to an inversion of a genomic segment consisting of the folP gene and the region between folP and tyrB. Another interesting observation was that the distance between folP and the upstream gene in N. lactamica was longer than in other species, due to the insertion of a Correia element. This Correia element was identical to some of the elements found in pathogenic Neisseriae. It had the typical features for these repeats: it was flanked by TA repeats, had a putative integration host factor binding site and its length and inverted terminal repeats indicated that it belonged to the α family of Correia elements [13].

Presence of the aroX gene

Two of the meningococcal strains (MC58 and 8013) and N. gonorrhoeae FA1090 had a putative chorismate mutase-related gene (aroX) immediately upstream of folP followed by a putative asmA gene (see Figure 1). The third meningococcal strain (Z2491), N lactamica and N. cinerea lacked aroX in this position and instead had asmA next to folP. PCR analysis revealed that aroX was present upstream of folP in six out of eight clinical strains examined (see Figure 2). Interestingly, the two clinical strains lacking aroX both had folP genes identical to Z2491. This folP allele is associated with sulfonamide resistance [5] and displays a very high degree of sequence divergence surrounding the start codon of the gene, compared to other meningococci: 26 altered positions in a 61 base pairs sequence. In fact, this divergent part was almost identical to corresponding sequences in N. cinerea and N. lactamica, suggesting that horizontal transfer from one of these commensal species removed the aroX gene and simultaneously altered the "wild type" meningococcal sequence immediately upstream of, and the first part of, folP.

Figure 2

PCR amplification of the region between . A 1293 base pair product denotes the presence of aroX between folP and asmA. M: molecular marker; a: Neisseria meningitidis (Nm) strain 952 (SuS); b: Nm 1014 (SuS); c: Nm BT054 (SuS); d: Nm 418 (SuR); e: Nm 3976 (SuR); f: Nm BT227 (SuR); g: Nm MO035 (SuR); h: Nm MO124 (SuR); i: Neisseria lactamica (SuS); j: Neisseria cinerea (SuS). SuS = sulfonamide-susceptible, SuR = sulfonamide-resistant.

Difference in DNA uptake signal sequences

The complete 6.8 kb sequence obtained from N. subflava and the intergenic regions amplified by PCR from N. sicca, N. lactamica and N. cinerea were examined for presence of the neisserial DNA uptake signal sequence (DUS) 5'-GCCGTCTGAA-3'. The meningococcal and gonococcal genomes contain almost 2000 copies of this sequence, which makes an average of one copy every 1,100 base pairs. The intergenic sequences from N. lactamica and N. cinerea were highly similar to the corresponding regions from the pathogenic species, including the numbers and positions of DUS (see Figure 3). In contrast, only one copy of the neisserial DUS was found in the N. subflava sequence and none was found among the N. sicca intergenic sequences. However, an altered variant where the second base is a thymine (5'-GTCGTCTGAA-3') was more prevalent in the latter species: N. subflava displayed as many as 10 copies of this altered DUS (see Figure 3; three of the altered DUS are located outside of the displayed sequences) and 6 copies was found in N. sicca. The occurrence of the neisserial and the altered DUS in the folP region of various Neisseria species is listed in the left part of Table 2.

Figure 3

Enlargement of the intergenic regions from Figure 1. I: region DM. II: region MF. III: region FU. IV: part of region TC. The order of the strains is as in Figure 1: a) Neisseria lactamica; b) Neisseria cinerea; c) N. meningitidis Z2491; d) N. meningitidis MC58; e) N. meningitidis 8013; f) N. gonorrhoeae; g) Neisseria subflava; h) Neisseria sicca. Numbers flanked by dotted arrows specify distances in base pairs between adjacent start- and stop codons. Triangles illustrate various DNA uptake signal sequences: ▷: GCCGTCTGAA; ▶: GTCGTCTGAA; : GCCGTTTGAA; : GCCGTCCGAA; : GCCGTATGAA; : ACCGTCTGAA; : ATCGTCTGAA. Triangles pointing towards each other illustrate inverted repeats. For the complete nucleotide sequences, see Additional file.

Table 2

Presence of DNA uptake signal sequences in human Neisseria species.

	Prevalence (density1) of DNA uptake signal sequences
	in intergenic parts of the folP region (Fig. 3)		in database sequences
Species	GCCGTCTGAA	GTCGTCTGAA	Sequence length	GCCGTCTGAA	GTCGTCTGAA	GCTGTCTGAA
N. meningitidis2	6	0	2,272,300	1935 (1,174)	165 (13,772)	47 (48,347)
N. gonorrhoeae	7	0	2,153,894	1965 (1,096)	118 (18,253)	31 (69,480)
N. lactamica	7	0	51,533	40 (1,288)	0	0
N. cinerea	8	0	12,158	15 (811)	3 (4,053)	4 (3,040)
N. subflava	1	7	13,523	16 (845)	1 (13,523)	0
N. sicca	0	6	3,114	3	0	1
N. mucosa	n.a	n.a	4,492	3	1	1
N. polysaccharea	n.a	n.a.	22,903	25 (916)	0	2 (11,452)
N. flavescens	n.a	n.a	4,844	8	0	0
N. perflava	n.a	n.a	1,392	2	0	0
N. elongata	n.a	n.a	7,064	8	1	0

1 Density as the average distance between two DUS. Density was only calculated when the (accumulated) sequences included more than 10,000 base pairs.

2 Strain MC58

To extend the analysis beyond the folP region, all sequences from human Neisseria species that were larger than 400 base pairs and deposited in the GenBank as of October 2005, were screened for both types of DUS described above. As a comparison, we also searched for another variant of DUS, where the third nucleotide was a thymine (5'-GCTGTCTGAA-3'). The results are summarized in the right part of Table 2. The altered DUS 5'-GTCGTCTGAA-3' was detected in the pathogenic Neisseria genomes and in sequences from N. cinerea, N. subflava, N. mucosa and N. elongata, but not as frequent as found around folP in N. subflava and N. sicca. Furthermore, all species also had several copies of the neisserial DUS, present at a much higher density than the altered variant. This indicates that the neisserial DUS is the prevalent one in all Neisseria species, and contradicts our finding from the folP region in N. subflava and N. sicca. When looking at this region in other species, several different variants of DUS can be identified (see Figure 3). For example, the region upstream of folP displays four variants of DUS: the neisserial DUS, the altered DUS and two other variants. The last column in Table 2 lists the prevalence of a DUS with an altered third base: this variant was also found in most Neisseria species. Obviously, the genomes of Neisseria species contain multiple variants of DUS, which seem to be scattered in variable densities throughout the genomes.

Transformation with DNA containing altered DUS

The transformation efficiency for DNA containing the neisserial DUS (5'-GCCGTCTGAA-3') and the altered DUS (5'-GTCGTCTGAA-3') was determined for N. meningitidis strain 952. Transformation frequencies were highest for DNA containing the neisserial DUS and around 50% lower for DNA with the altered DUS. However, the absolute transformation frequencies varied between experiments, so there was no statistically significant difference between the two DUS variants (see Table 3). DNA with a distorted DUS variant, where four bases had been replaced, scored significantly lower values, indicating that the DNA uptake was indeed sequence dependent, as expected in N. meningitidis. The conclusion from these experiments was therefore that a one-base-substitution in the DUS did not produce a significant reduction in transformation frequency in this laboratory setting.

Table 3

Transformation frequencies

Type of DUS	Average transformation frequency per 10,000 cells (mean ± SD)
neisserial DUS (GCCGTCTGAA)	56 ± 21
altered DUS (GTCGTCTAA)	27 ± 15
distorted DUS (CGACTCACAA)	4 ± 2

Discussion

The Neisseria species are believed to be non-clonal bacteria with a high degree of genetic transfer within and between different species [2,3,14-18]. Previous reports of transformation in N. meningitidis have suggested that different regions of the genome may have different recombination rates [19,20]. This work identified the region upstream of folP as particularly active in recombination events. The most obvious example is the insertion of a complete Correia element, upstream of folP in N. lactamica. Correia elements are small putative transposable elements, around 152 base pairs long with inverted repeats at the ends [12]. Hundreds of Correia copies are scattered around the genomes of pathogenic Neisseriae [13,21,22] and they have also been reported in N. lactamica [23]. We detected another copy of a Correia repeat in the N. subflava sequence, suggesting that these elements are ubiquitous in the Neisseria genus and possibly was introduced before the divergence into different species.

Another example of recombination events is the apparent inversion of a genomic segment in N. subflava, N. sicca and N. mucosa, with one breakpoint upstream of folP. A third recombination event in the same location is the deletion of aroX from some strains. This gene is obviously not essential since it is absent from the genome of N. meningitidis Z2491, but was nevertheless present in the majority of strains examined in this work. The sequences between folP and aroX from all these latter strains are highly similar and include two DUS downstream of aroX, arranged as an inverted pair followed by a stretch of thymidines. This arrangement is characteristic of transcription terminators and is a general configuration for DUS in meningococcal and gonococcal genomes [8,24]. The strains lacking aroX had retained this putative termination signal, although located between two divergently operating start codons and hence without function. Furthermore, all commensal strains examined in this work also had inverted repeated DUS between the start codons of folP and the upstream gene (tyrB or asmA). These observations support the proposed genetic rearrangements in these species: a deletion of aroX in N. lactamica, N. cinerea and some meningococcal strains, and an inversion of a genomic segment in N. subflava, N. mucosa and N. sicca.

The sequence differences and similarities detected in this work could divide the examined species into two groups, where the pathogenic species, N. lactamica and N. cinerea fall in one group and N. subflava, N. sicca and N. mucosa in a second group. This is in agreement with the classic taxonomy of Neisseria species based on ribosomal RNA hybridization [25,26] and phenotypic tests [27]. The inversion of the folP-tyrB genomic fragment and the accumulation of the altered DUS likely occurred in a common ancestor to N. subflava,N. sicca and N. mucosa. Similarly, the deletion of aroX probably occurred in a common ancestor to N. lactamica and N. cinerea, but after the separation of commensal species from pathogenic species. The removal of aroX created a novel intergenic sequence that was later transferred to a meningococcus, removing aroX also in this strain. The fact that all meningococcal strains we found lacking aroX were sulfonamide-resistant and had identical folP genes can be explained in three ways: either, the recipient was already sulfonamide-resistant at the time of transfer; the recipient acquired resistance after the transfer; or the donor was a sulfonamide-resistant commensal strain that transferred the resistant folP allele together with the upstream region to the meningococcus.

The DNA uptake signal sequence (DUS) is crucial for efficient transformation in pathogenic Neisseriae [7,8]. The tendency to preferentially take up DNA from closely related species was noted in early experiments with gonococci [28-31]. Further experiments established that this was due to the presence of an uptake signal sequence in the donor DNA, and this sequence was subsequently determined to be 5'GCCGTCTGAA-3' [7,8,32]. The meningococcal and gonococcal genomes contain close to 2,000 copies of this neisserial DUS, but they also contain several variants of this sequence with one or a few base substitutions. The altered variants of DUS are frequently located in pairs as perfect inverted repeats after open reading frames, just as the neisserial DUS. This could indicate that this arrangement is important for its function and therefore support the hypothesis of DUS as being transcription terminators [24]. The DUS variant with a thymine in second position was highly prevalent in the folP region of N. subflava and N. sicca, where it seemingly had replaced the neisserial DUS, and was also fairly abundant in pathogenic strains: 165 and 118 copies in N. meningitidis MC58 and N. gonorrhoeae FA1090, respectively. The results from our transformation experiments, albeit performed with synthetic PCR-products under conditions different from the natural habitat of these bacteria, indicated that this one-base difference in DUS only marginally reduced the transformation frequency. Perhaps this can explain why this particular variant of DUS seems so prevalent in neisserial genomes: this alteration may be well tolerated by the DNA uptake mechanism.

It is not clear why some naturally competent species have a sequence-specific DNA uptake mechanism. One explanation describes their presence as a mere consequence of a preferential uptake of specific sequences during natural transformation [33]: DNA uptake processes that favor a specific sequence automatically lead to an accumulation of this preferred sequence in the genome, because DNA containing this sequence is more likely to be integrated than other DNA. Another theory is that DUS may be beneficial for the bacterial population since it directs the DNA uptake to sequences from closely related bacteria that can be used for creation of genetic variability or for DNA repair. A recent study report a higher frequency of DUS in genome maintenance genes compared to genes of other function, thus supporting the DNA repair explanation [34]. If DUS evolved as a mechanism to obtain homologous DNA for repair purposes it would make sense that only closely related species shared the same DUS. This hypothesis could therefore justify why the neisserial DUS was found in N. lactamica and N. cinerea, whereas an altered version of DUS was detected in the more distantly related N. subflava and N. sicca. On the other hand, this distinction was only true for the folP region: when examining sequences from other regions the neisserial DUS dominated in all species. However, the sequences available for analysis from several of the commensal species, including N. subflava and N. sicca, are in short supply and not representative for the whole genomes. Obviously, analysis of more sequences from these commensals is required to address the distribution of various DUS within the genomes of commensal Neisseria species.

Conclusion

This work compared the sequence surrounding the folP gene in various Neisseria species. The results lead to a general differentiation of the examined species into two groups, where N. subflava, N. mucosa and N. sicca belonged to one group and N. cinerea, N. lactamica, N. meningitidis and N. gonorrhoeae to another group. The major differences between these two groups were an inversion of DNA with one breakpoint in the upstream region of folP, and a one base pair difference in the DNA uptake signal sequences present in this genomic region. The variability within the folP region may reflect the ongoing selection of different folP alleles by the selective pressure of sulfonamide drug use.

Methods

Neisseria strains

The Neisseria meningitidis clinical isolates used in this work were 418, 1014 [35], MO035 [36], 952, BT054, BT227, MO124 [37] and 3976 [38]. The commensal strains were Neisseria lactamica ATCC23970, Neisseria mucosa ATCC19696, Neisseria sicca ATCC9913, Neisseria subflava ATCC19243 and Neisseria cinerea ATCC14685. Bacteria were cultivated on Brain Heart Infusion agar plates (Difco Laboratories, USA) in 10% CO2.

Reagents

Oligonucleotides (listed in Table 1) were purchased from Thermo Hybaid, Germany. Restriction enzymes and other molecular biology reagents were purchased from Roche Diagnostics, Germany, if not otherwise stated. Ligation mixtures were transformed into One Shot® TOP10 Chemically Competent E. coli (Invitrogen™, The Netherlands). PCR products were purified from agarose gels using MinElute Gel Extraction Kit (QIAGEN, Germany) and cloned into pCR®2.1-TOPO® vector (Invitrogen™, The Netherlands) according to the manufacturer's instructions. Plasmids were purified using QIAprep Spin Miniprep (QIAGEN, Germany). DNA was sequenced on ABI PRISM 310 Genetic Analyzer (Applied Biosystems, USA) using DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences, Sweden).

Table 1

Oligonucleotides used as PCR primers.

name	sequence (reference)
cytup	5'-TAACGATACCGCTCACAAGGG-3'
dedAup	5'-GTCAAATCTTCGGGAATCGG-3'
NM10	[42]
NM11	CCGCCGCCACGCTGCCGTGT
NM7	TTGGCAGGCAGGACGGTTTG
NmAsmup	5'-CATATTTCAGACGGTATTTGTGG-3'
NmdusCrev	CCTTTTCAGACGGCATGAAGTATGTGAACC
Nmdusfwd	GTTTTTTATTTTGGGAGGAGTTC
NmdusTrev	CCTTTTCAGACGACATGAAGTATGTGAACC
NmdusXrev	CCTTTTGTGAGTGCATGAAGTATGTGAACC
Nsfcytokrom1	5'-TATCGCGCAAGGCTTCGATAC-3'
Nsfcytokrom2	5'-TAACGCCATGCCTGCAAAAG-3'
Nsfcytokrom3	5'-AGAAACCCTGCACAAACACG-3
Nsfcytokrom5	5'-AACGCCATGCCTGCAAAAG-3'
Nsfdownsense3	5'-CAGGTTTCCCGCTGTTGATCG-3'
Nsfmutasdown2	5'-TGCGCATCCAAAAAGGTCAG-3'
Nsfmutasdown3	5'-AAAGACGTGTTGGCGGAAGTG-3'
Nsfmutasdown4	5'-GGGAACGGTGGTACAGTGGAT-3'
Nsfmutasdown5	5'-CCATGCCGGTTTAAGGTTAAT-3'
Nsfmutasfwd6	TATTCCGACAACGGCATCAAATTC
Nsfmutasfwd7	5'-GTGAAGCTGAGCGATGAAATCGAG-3'
Nsfmutasrev5	5'-GTCGATTTTGGCTTCGATTTCC-3'
NsftyrBdown1	5'-GATTGAGCGTGGAACAAGTCCG-3'
NsftyrBdown2	5'-ATTCCGGCAGGATGTGCGTC-3'
NsftyrBfwd1	5'-ACCGGCGTGGATATGTCGG-3'
NsftyrBup	5'-GGTCGTTTTTGAAGGTTTCGAC-3'
Nsfupanti	5'-GTTTGGGCGTTTTGCGAATA-3'

Determination of Neisseria subflava sequence

PCR primers NM7 and NM11 were used to amplify 734 base pairs of folP from N. subflava ATCC19243. Flanking sequences were determined using a chromosome walking method [39]; Restriction enzyme digested chromosomal DNA (approximately 2 μg) was inserted into vector pUC19 with T4 DNA Ligase (New England Biolabs, Beverly, MA) at 16°C. The unknown sequence was then amplified with the ligation mixture as template and one vector-specific primer, directed towards the insert, and a sequence-specific primer, directed towards the unknown sequence. The polymerase chain reactions contained 0.2 units Taq Polymerase (Fermentas, Lithuania), 0.5 μM of each primer, 0.2 mM of each deoxynucleotide and 100 ng of DNA in a 20-μl reaction. PCR products were cloned and sequenced as described above. The chromosome walking was repeated stepwise in both directions until a 6808 base pair region of the chromosome had been sequenced. Nested PCR was performed in some of the steps to achieve specific products.

Determination of gene order

Primers binding within genes but directed towards non-coding regions were utilized to amplify intergenic sequences from chromosomal DNA from all Neisseria strains listed above using the Expand™ High Fidelity PCR System (Roche, Germany). Primers dedAup and Nsfmutasdown3 were used to amplify the region between dedA and manB; Nsfmutasrev5 and NM10 to amplify the region between manB and folP; Nsfupanti and NmAsmAup between folP and asmA; Nsfupanti and NsftyrBup between folP and tyrB; and NsftyrBdown2 and cytup between tyrB and cyt5. PCR products from N. lactamica, N. cinerea and N. sicca were cloned and sequenced as described above.

Transformation frequencies

The complete folP gene from the sulfonamide-resistant N. meningitidis strain MO035 was amplified from chromosomal DNA using the forward primer Nmdusfwd and one of three reverse primers. NmdusCrev was used to incorporate the meningococcal DUS in the PCR-product, NmdusTrev to incorporate the subflava variant of DUS and NmdusXrev to make a control DNA with equal length but with a disrupted DUS. PCR was performed with the Expand™ High Fidelity PCR System (Roche, Germany) according to the manufacturer's instructions and the products were purified with the MinElute PCR Purification kit (QIAGEN, Germany). The sulfonamide-susceptible N. meningitidis strain 952 was suspended to OD600 = 0.1 in a rich broth containing Brain-Heart-Infusion Blood-Agar Base (Difco Laboratories, USA), 10 mM MgCl2, 2× Kellogg's supplement and 0.042% NaHCO3 [40]. Exactly 1 μg of purified PCR-products was added to 200 μl bacterial suspension and the mixture was incubated at 37°C in 5% CO2 until OD600 = 0.3. The diluted transformation mixtures were incubated on ISA plates (Oxoid, England) with or without 0.25 mM sulfathiazole (Sigma-Aldrich, Sweden).

Sequence data analysis

The complete genome sequences from pathogenic Neisseria species were extracted from GenBank: AL157959 (strain Z2491), NC003112 (MC58) and AF00969 (FA1090). The 5 kb sequence from N. meningitidis strain 8013 was provided by Christophe Rusniok and Philippe Glaser at the Pasteur Institute, France. The following entries from commensal Neisseria species were extracted from GenBank: N. cinerea: AF158604, Z17308-Z17310, X64869, AJ223935, AJ223913-AJ223915, AJ223890-AJ223892, AY831725, AJ704731, AY360352, AF470674, AF319536, AF306836, AF139614, AF216744, AJ247236, AJ239300, AJ239299, AJ239287, AF121876, AF029360, U82861, U82845, AF85340, AJ223869-AJ223871, U57906, U57710, X59540; N. elongata: AF121870, DQ007933, AJ223877-AJ223882, AJ223921-AJ223926, AJ223898-AJ223903, AY821559, AY167422, AF542173, AJ247252-AJ247254, AJ239302, AJ239303, AJ239297, AJ239278, AF121870, L06171; N. flavescens: M26645, AY174058, Z22955, X64872, AJ223938, AJ704736, AJ79434, AJ704735, AJ704733, AJ239280, U82863, U82847, AF987677, Y09310, Y09311, U57907, U57711, L06168; N. lactamica: DQ015867, Y11818, Y11819, Y10876, Y10877, X54485, X64871, AJ288888-AJ288893, AJ223909, AJ223945-AJ223947, AJ223910, AJ223907, AJ223908, AJ223884-AJ223887, AJ223863-AJ223866, NC006968, AY857302-AY857306, AY532623-AY532628, AY532630, AY54849, AY654848, AJ704746-AJ704748, AJ704737, AY438701, Y134876, AF542177, AJ270921-AJ270932, AJ270918, AJ270906-AJ270908, AJ270902, AJ270900-AJ270904, AF470682, AF470683, AF470673, AY038932, AF319537, AJ270919, AJ270920, AF312972, AF216855, AF158603, AJ247241, AJ247242, AJ239313, AJ239305, AJ239296, AJ239283-AJ239286, U82843, U82858, AF085689, AJ001737-AJ001740, Y09308, U57709, Y57905, U59398, X74901, X65533, U06074; N. mucosa: AJ223875, X59635, X64873, AJ223937, AJ223919, AJ223896, AJ223875, AJ704738, AY462277, AJ247255-AJ247260, AJ239279, AJ239282, AF121872, U82860, U82848, L47156, U57908, U57901; N. perflava: AJ223920, AJ223906, AJ223897, AJ223883, AJ223876, AJ223862, AY837569, AF312973, AJ247246, AJ247247, AJ239295; N. polysaccharea: DQ007935, Y11814-Y11817, Y10878-Y10881, X59626, X64870, AJ223944, AJ223940-AJ223943, AJ704761, AJ704762, AJ704743, AJ704739-AJ704744, AY134878, AY072807-AY072809, AY099335, AF542178, AF216858, AJ239314, AJ239315, AJ239298, AJ239289, AJ011781, U82844, U82859, Y09309, U57708, U57904, L06167; N. sicca: DQ007936, X76285, AJ223916, AJ223872, AJ223893, AY857301, AJ704730, AF312974, AJ247248, AJ239292-AJ239294, Y09307; N. subflava: DQ007937, AJ288894, AJ223918, AJ223895, AJ223874, AY522860, AJ704745, AY134877, AF216745, AF240672, AF241526, AJ247249, AF470684, AF479577, AF479578, AJ239291. The search for DUS and Correia elements was performed using the DNA Pattern Find algorithm in the Sequence Manipulation Suite [41].

Authors' contributions

YQ participated in the planning of this study, performed all experimental work and drafted the manuscript. GS participated in the planning, coordinated the study, and assisted in writing the manuscript. Both authors have approved the final manuscript.

Additional File 1

Intergenic sequences from commensal . This document lists the nucleotide sequences from the commensal species that are schematically illustrated in Figure 3.

Click here for file