A microsatellite linkage map of Drosophila mojavensis.

BACKGROUND: Drosophila mojavensis has been a model system for genetic studies of ecological adaptation and speciation. However, despite its use for over half a century, no linkage map has been produced for this species or its close relatives.
RESULTS: We have developed and mapped 90 microsatellites in D. mojavensis, and we present a detailed recombinational linkage map of 34 of these microsatellites. A slight excess of repetitive sequence was observed on the X-chromosome relative to the autosomes, and the linkage groups have a greater recombinational length than the homologous D. melanogaster chromosome arms. We also confirmed the conservation of Muller's elements in 23 sequences between D. melanogaster and D. mojavensis.
CONCLUSIONS: The microsatellite primer sequences and localizations are presented here and made available to the public. This map will facilitate future quantitative trait locus mapping studies of phenotypes involved in adaptation or reproductive isolation using this species.

Background

Evolutionary biologists have struggled to determine the number and types of genetic changes that lead to speciation. Recent advances in molecular techniques facilitate a more thorough investigation into these issues. For example, by mapping quantitative trait loci (QTLs) affecting interesting traits, we can explore the genetic basis of phenotypic variation between two populations that may lead to reproductive isolation.

One hallmark species used in studies of speciation and ecological adaptation is the desert cactophilic Drosophila mojavensis. D. mojavensis belongs to the mulleri complex of the repleta species group within the subgenus Drosophila. Unlike many well-studied Drosophila, its ecological niche has been well documented, and extensive cytogenetic work has been done on it and its close relative, D. arizonae [see e.g., [1]]. With regard to speciation, D. mojavensis has been the subject of many genetic and phenotypic studies of mate choice [e.g., [2-5]], hybrid sterility and inviability [6,7], and variation in sperm and female sperm-storage organ length [8,9]. However, all of these studies have been forced to use a handful of either allozyme or morphological mutant markers. Microsatellites have been isolated from this species before [10], but they are unmapped and their sequences are not available.

Here, we present a microsatellite-based linkage map of the five major chromosomes of D. mojavensis using a new set of markers. We mapped 25 microsatellites to the X chromosome and 65 microsatellites spanning the four major autosomes. We also use our results to confirm the conservation of Muller's chromosome elements [11] across approximately 65 million years of evolutionary divergence between D. melanogaster and D. mojavensis [see [12]]. Muller [11] had suggested that chromosomal elements conserve their identities (ie, complement of genes) across all Drosophila species, and several subsequent studies have supported this idea [e.g., [13-15]], though only one study involving the repleta group [16].

Results and Discussion

Primers were successfully developed for a total of 116 markers. Of these, 26 did not distinguish between the two isofemale lines that were used for mapping and were therefore not pursued. We mapped 25 microsatellites onto the X-chromosome, 10 onto chromosome 2, 7 onto chromosome 3, 13 onto chromosome 4, and 10 onto chromosome 5. Twenty-five more microsatellites were confirmed to be autosomal but could not be mapped because of segregating polymorphism within our lines. Microsatellites were named based on their localizations, where the fifth character of the name was an X if X-linked, A if unmapped autosomal, or a number indicating a specific autosome. The distribution of microsatellites across the chromosomes suggests a possible excess of repetitive sequences on the X-chromosome (27.8% observed vs. 20% expected assuming all chromosomes are similar in size, chi-square test, p = 0.07; 27.8% observed vs. 18.7% expected assuming chromosomes are the same size as D. melanogaster homologous chromosome arms, chi-square test, p = 0.03).

Using two female-parent backcrosses, we constructed a recombinational map of the Drosophila mojavensis genome using 34 of our microsatellites: 13 on the X-chromosome, 7 on chromosome 2, 4 on chromosome 3, 7 on chromosome 4, and 3 on chromosome 5. Recombinational distances are presented in Figure 1. DMOJX040 was not placed in the figure because it was only 0.7 cM from DMOJX030. The recombinational lengths of the chromosomes generally exceed the homologous chromosome arms in D. melanogaster and some other Drosophila species. For example, the X-chromosome in D. mojavensis spanned 130.8 cM, while the X-chromosome in D. melanogaster spans only 73 cM. Even within the repleta species group, D. buzzatii has an X-chromosome that spans 109 cM [17] and D. hydei's X spans 116 cM [12]. Similarly, D. mojavensis chromosome 2 could only be assembled into three pieces that recombine freely from each other. This difference between species in recombinational length most likely indicates an overall greater recombination rate per megabase in D. mojavensis, but we cannot exclude dramatic differences in sequence lengths of the chromosome arms.

Figure 1

Linkage map of the five major chromosomes of Drosophila mojavensis. From left to right, are the X-chromosome, chromosome 2, chromosome 3, chromosome 4, and chromosome 5. Kosambi recombinational distances between markers are on the left of each chromosome, and the microsatellite names are on the right. A question mark appears between markers or groups when markers were assigned to the same chromosomes but freely recombined from each other.

We recombinationally mapped some markers in a second cross because of segregating variation within the lines. Figure 1 presents the most conservative map, where all markers were mapped against each other for any particular chromosome. However, we have some additional information about the linkage of other microsatellites. Specifically, we observed that DMOJ4200 is freely recombining from all the 4-chromosome markers between and including DMOJ4010 and DMOJ4060. Also, the following markers are freely recombining from each other on chromosome 5: DMOJ5100, DMOJ5200, DMOJ5300, and DMOJ5400.

To evaluate the conservation of Muller's elements across 65 million years, we used BLAST [18] to identify segments homologous to the sequences flanking the 65 microsatellites in D. mojavensis that were mapped to chromosome. We identified segments mapped to D. melanogaster chromosomes similar to 23 of the sequences isolated from D. mojavensis (see Table 1). The inferred homology of the arms are as follows (melanogaster:mojavensis): X:X, 2L:3, 2R:5, 3L:4, 3R:2 [19,20]. Based on the BLAST results, all 23 D. mojavensis sequences matched D. melanogaster sequences on the homologous chromosome arms. This observation strongly supports the conservation of Muller's elements between the subgenera Drosophila (D. mojavensis) and Sophophora (D. melanogaster).

Table 1

Ninety microsatellites mapped in Drosophila mojavensis. Microsatellites assigned to chromosome "A" were autosomal but could not be mapped to a particular autosome because of variation segregating within the lines used for mapping. We present the BLAST expect (E) value in the column after the microsatellite name only for the 23 microsatellites used in the Muller's chromosome element comparison.

Name	BLAST E-value	Chromosome	Size	Primers	Repeat motif	GenBank Accession
DMOJX010		X	132	attgtgttgcgccttagggcgtgataatttgttgatttgggtgcatgtc	(ca)11	AY578823
DMOJX020		X	142	ctctgccactcaacggaccctcttcagtgttgcctagggtatac	(ca)7	AY578824
DMOJX030		X	124	aagctatgcctagttgtcacttcccaaacggcatttcatataagaatctatctcac	(ag)9	AY578825
DMOJX040		X	147	aggcatgccttagtttgtgtcaccacacatattaagcattgtattacaatcgtccc	(ac)15	AY578826
DMOJX050		X	143	accaagcaaaagccaattgcaccaaagctttgccggcattagc	(ac)12	AY578827
DMOJX060		X	128	caattgtggagttgcgtttgcaccacgcatttctgattgaccatacac	(ac)12	AY578828
DMOJX070	1e-19	X	163	gccactcgttgttgtccctaatagttctttgctctatatgcgtgtg	(ca)4	AY578829
DMOJX080		X	202	ccactccacgttcgcttgaccacaatgtagagctccctttaatctcc	(ac)14	AY578830
DMOJX090		X	149	ccttcaactttgtcgctccagaccaatcaaagcgaacgtagctcaatg	(ca)9	AY578831
DMOJX100		X	160	tttgtatataaggcggaaaggcgggtctgtatataatttaataagttgttacgtaaaagaactcac	(gt)20	AY578832
DMOJX110	2e-09	X	98	cagtggcgctcaaaaggtctggggatgtatggggtctatgggtg	(ca)9	AY578833
DMOJX120		X	110	gcctgcatttgtgcatctgccaagtgtttgccaaagctgcag	(tg)13	AY578834
DMOJX130		X	130	tgggctacacttcagcaaacattctcatgtgcaaaggtagccaagc	(ca)11	AY578835
DMOJX500		X	100	caattattgcatagccacgccccgagcacttttccaatttttggc	(gt)11	AY578836
DMOJX501		X	136	ctcgagcgaattttcctattggatttcccaacgagccatttcctcacg	(ca)6	AY578837
DMOJX502		X	107	attaaagtgcattaaatgacacagccacctctgccttcacgtgtgc	(ca)10	AY578838
DMOJX503		X	136	gcgaagaattgcaaatacccttgtagaagcaaatatacacaacatacacatgtgc	(gt)10	AY578839
DMOJX504		X	126	catcaatctctagaatgcctcacgcgagtgactcactttaaagcgagctc	(gt)8	AY578840
DMOJX505	0.004	X	128	tcgcttgtttccgtttagtaaccgtacgcgtatgcgtatgcatgc	(ac)10	AY578841
DMOJX506	2e-15	X	149	actgcctacactgctctgtctcacaggctttacacatggccaaataac	(tc)16	AY578842
DMOJX507		X	166	ttttctttgcatcggcttagttgccacatatggaaatgcagcacgaac	(tc)15	AY578843
DMOJX508	4e-43	X	248	aagcagcctagctgaacagttgcattgggaagagctgatgtatagacg	(ac)12	AY578844
DMOJX509		X	157	agctgattaacgaagcagatttcgtgttccattcatgaaccactcacacatc	(ga)18	AY578845
DMOJX510		X	169	atttggctgctgcgagacggatttgtgccactgtgcaatgg	(ag)18	AY578846
DMOJX511		X	177	gcttcagtgagcctcaaatgaaactgcagctggcatgggtataag	(ct)16	AY578847
DMOJ2010		2	157	acgagtttgccatgaactggattgaaagccgaaacttgtattcatttggc	(ac)14	AY578848
DMOJ2020		2	153	attgacttagcgtgtgagcgtgcgctgtctcatttacataggtcgg	(gt)7	AY578849
DMOJ2030		2	199	tgacgcgccaatcagttgacgattcaaggtgtcatatctatatgtgtgtagg	(gt)16	AY578850
DMOJ2100	4e-05	2	187	ggcgctcccttaatcacagatacagcatgtgtctgcttgctgt	(ag)17	AY578851
DMOJ2200	3e-21	2	148	gtcgctccatagagttctacaagtttgcgcctccaagtaattcacgaagc	(gt)9	AY578852
DMOJ2210		2	139	cccagcaagtgtactctactcaagtgctgcatcaataaagaaggcaaac	(ca)8	AY578853
DMOJ2220	0.002	2	136	gttggctttggctattggactgagtgtgcaatgtgactggcaactg	(gt)6	AY578854
DMOJ2300	1e-05	2	114	aattgacagcactccgtggcgttcagcgccggccttac	(ca)12	AY578855
DMOJ2301		2	158	ctcttagcggcaggtgtcaagaatcttatcgaaaatatgcaacacgatgg	(caa)11	AY578856
DMOJ2302	8e-17	2	193	ctctcgctgtttctcttgtctcttatacaactgatttaccgctcgctatacag	(ac)9	AY578857
DMOJ3010	4e-05	3	218	gcccgccggagttcaatagatgtgtatggccagtgctacattt	(ct)8	AY578858
DMOJ3020	4e-23	3	94	acgtggattacgaacacgagctttggccaatttgagcaactgc	(ca)14	AY578859
DMOJ3030		3	91	cctagtttctttggccaccctaccgcagtgaaacgcatggaaac	(ca)11	AY578860
DMOJ3040		3	94	gtcaggtgtcagcagcagcgcctcaacagcacctactgag	(ac)12	AY578861
DMOJ3100		3	87	ctgatttgtcaccacagggactcgctaatcgaagcacacacatgtattcag	(ca)10	AY578862
DMOJ3101	7e-25	3	150	aacggcggcatccgttgactgtcatcgcacaaatgatttgta	(gt)12	AY578863
DMOJ3102		3	210	ctctctgtagcaaaaggcttttgtaacctgctgtgtgcagcacgaac	(ca)11	AY578864
DMOJ4010		4	90	agccagtgcaatgccagcgcctggaccttgtgggc	(ca)16	AY578865
DMOJ4020		4	121	cagcagctgccttatgtcagcaataaatcgcagcagccaggac	(ac)10	AY578866
DMOJ4030	7e-05	4	137	gtagttgttgtaggcacgcatacaaatgagaatgagaactggaacggg	(ca)10	AY578867
DMOJ4040	1e-07	4	161	gcaacatgtgctccactcgttcttttcccacacttcttgcagcag	(ca)11	AY578868
DMOJ4050		4	196	atcgcatagaaagacactcatacgcctggaggcaagggaagtttcg	(ca)9	AY578869
DMOJ4060		4	211	cgagactcgctgataagtaaagccgattgtaattttggccgtgcgc	(ac)41	AY578870
DMOJ4100		4	126	cgcagacatatttgtctcccagcttcgtagccaagacaaactcacaac	(ga)11	AY578871
DMOJ4200	3e-10	4	120	gcttcaagccttgtgatttgttgcaagaagaacaagcgcattatgcaaa	(ct)24	AY578872
DMOJ4300		4	165	ggaaagaataccaacgcctatggcgtccgcagacagccagc	(ca)12	AY578873
DMOJ4301		4	133	acatttggctgttacctggcacccaatgccagtgagtttctctctc	(ca)12	AY578874
DMOJ4302	2e-42	4	218	gtgtgtgcgtggatgtgttttacgacagcactgaacagattatagataagcc	(ag)18	AY578875
DMOJ4303		4	174	cacggcaacacttgcagttaccccattgctcatagcccgtttacc	(ag)23	AY578876
DMOJ4304		4	171	ggcacattgccacaagtgtactctgtgccggaaatcgtcaac	(ga)20	AY578877
DMOJ5010	6e-04	5	117	ggcatagggaccgcagcgtaaatattcgccaaacacctacatgc	(ac)8	AY578878
DMOJ5020	4e-06	5	144	ctacaggtatgaagaacctgaacccacaacagcctacacgcactc	(gt)11	AY578879
DMOJ5100	8e-18	5	156	agacaacttgactgttgctcgctgacactgattggtcgctgtg	(gt)8	AY578880
DMOJ5200	2e-26	5	154	tcgcacaactggcgcatgatttttacagcacgcttaacaagaattttcac	(ca)13	AY578881
DMOJ5300		5	97	gtggtggacatcaaccagcctgagccaactttgagcataaattagcc	(ca)9	AY578882
DMOJ5400	5e-08	5	109	cttggatttcagctcagtcgctccgccacaatcagtcataggtcc	(gt)10	AY578883
DMOJ5500		5	121	ggaagcgtcgactgcataccgtgttgaaacgtatgtgtttgtgcc	(ca)10	AY578884
DMOJ5501	1e-04	5	99	cgtgccacgtaaactcttgccgaaggcaattcaattagttttgagagttatccc	(ac)9	AY578885
DMOJ5502		5	115	gcatattgacaaggacgagctgtctctgagtgcgtccattactttgtatc	(gt)12	AY578886
DMOJ5503		5	150	gtatacgacatgttggcactgccttgcaagctgggcgtaagc	(tg)10	AY578887
DMOJA500		A	185	gagactgtttgacgcccgctcgatagacatgagtttggtctagaaacc	(tg)8	AY578888
DMOJA501		A	140	tcagtagcctctgctacggccgaacggaaattatgaactagtcagcc	(tc)30	AY578889
DMOJA502		A	138	ctgaaagttctggcagcaagagtgtgtaatttagttgttagacgcgattgagag	(ct)14	AY578890
DMOJA503		A	153	taaggctctgtttcgtaactttgccctgtcaatgtgctaaacattgcaacc	(ca)9	AY578891
DMOJA504		A	222	aatcatctgccccctttccacggaaaatgatgctcaggcaggt	(ac)13	AY578892
DMOJA505		A	181	ccatagtgcgatgcacgcttcgccatagcccatagtagccaag	(tg)10	AY578893
DMOJA506		A	147	attaatgcaggccggaaagtcggctcgctctgcgtcgttatg	(gt)11	AY578894
DMOJA507		A	134	tcagccgggatgttaactaacttgatgcttaccagagcgaatggc	(ac)12	AY578895
DMOJA508		A	196	ctctgcgacatgtagactacgcgataaagttgaacttttactaccgatgcattc	(tg)10	AY578896
DMOJA509		A	186	gctgagaaacaaatttcgcatgcctgttgttgtcctttaacgaacgttcc	(tg)18	AY578897
DMOJA510		A	105	cacacagccagacttgacgttaggcttttgattttgtcatagccattgctaaac	(tg)12	AY578898
DMOJA511		A	162	cttttctggctattacgagagcagcaaaacataatgtaattgagctgacaaagcaac	(tg)30	AY578899
DMOJA512		A	120	gatgagaaataggcgttgctgtccgcatatgatgaaggctgagagctc	(ca)11	AY578900
DMOJA513		A	120	gctcagctaacagaaacacccagccgtagctgcagcatct	(tg)13	AY578901
DMOJA514		A	125	atggcgcaactcggtcggcagcacatttggctgctg	(gt)12	AY578902
DMOJA515		A	203	gaccgaacagcgcagcccacaaacctacataaacaccgcagtc	(ac)11	AY578903
DMOJA516		A	163	ggctgtaccaagcacacactccgctcgtgtcgtcgtcttc	(ca)13	AY578904
DMOJA517		A	87	gaaaacagctgcaaacccgtaaaggctctcttaagcgctcaactatatagac	(ca)15	AY578905
DMOJA518		A	118	gtatgtatgggcatacagcgggcttggttctatgatatgatgacgtgtct	(ca)7	AY578906
DMOJA519		A	182	atgaataggaatccagccagcgagcgctttgcgtgcctac	(ca)14	AY578907
DMOJA520		A	164	tttcggcgcaaggtcgtcttagcttctttaccggcatcatgc	(gt)8	AY578908
DMOJA521		A	96	ttttgtttaggttttgcgcctaaccttttccataatttgtgcgtgtgcc	(ac)9	AY578909
DMOJA522		A	122	cctttcgagtgcctccacaacgtcccactacatattgctacagctg	(ca)11	AY578910
DMOJA523		A	147	gcgtaagcacagttggactctctgtctgcggagttttatgctgtaa	(ct)23	AY578911
DMOJA524		A	135	tcgagagagattcgatcgagagccctgtttgcattatgtgggtgtc	(ac)12	AY578912

Conclusions

We have developed and mapped a panel of 90 variable microsatellites for genetic studies in a model system for ecological genetics and speciation: Drosophila mojavensis. Thirty-four of these microsatellites have been placed onto a detailed linkage map of this species. We also confirmed that Muller's chromosome elements were conserved between D. melanogaster and D. mojavensis, species separated by 65 million years of independent evolution, in 23 of 65 sequences tested. Given the long-term interest in this species for studies of adaptation and speciation, the construction of a linkage map and presentation of variable microsatellite sequences will facilitate future work in this area.

Methods

Isolation of microsatellite sequences

We used a modification of Hamilton et al's [21] enrichment technique to increase the proportion of microsatellites in the genomic DNA insert library prior to cloning [see also [22]]. This procedure uses a subtractive hybridization, in which streptavidin-coated magnetic beads and biotinylated oligonucleotide repeats retain single-stranded genomic DNA fragments containing repeat sequences.

Genomic DNA was isolated from approximately 30 D. mojavensis individuals from a mixture of strains using the Puregene™ DNA Isolation Kit (Gentra Systems). Except where indicated, we used reagent concentrations and reaction conditions suggested by Hamilton et al [21]. The enrichment procedure was repeated seven times. For each enrichment, one of the following enzymes was used with NheI to digest Drosophila mojavensis genomic DNA: Sau3AI, BfucI, RsaI, AluI, or HpyCH4III. Linker sequences were ligated to the digested DNA to provide a PCR priming site. We then hybridized the digested, linker-ligated DNA to a biotinylated oligonucleotide repeat motif, either (CA)15 or (AG)15, and recovered the microsatellite-enriched DNA. The DNA was amplified via PCR, and fragments between 300 and 800 bp were recovered from an agarose gel for cloning. We then used the Invitrogen TOPO-TA cloning kit to clone the DNA into plasmids and transform into E. coli. We omitted the chemiluminescent screen and used pUC19 primers to amplify D. mojavensis DNA inserts directly from colonies. Each 50 μl reaction volume contained 50 mM Tris-HCl (pH 8.3), 20 mM KCl, 1.5 mM MgCl2, 0.2 mM each dNTP, 0.5 μM pUC forward and reverse primers, and 1.0 unit Taq polymerase (AmpliTaq, Perkin Elmer). DNA was added by touching a sterile toothpick to a colony and swirling the toothpick into the reaction mix. We used the following thermal profile: 95°C for 5 min; 30 cycles of 94°C for 60 s; 55°C for 30 s, 55°C for 30 s, 72°C for 30 s; rapid thermal ramp to 40°C. PCR products were sequenced with an ABIPrism® Big Dye™ Terminator Cycle Sequencing Ready Reaction Kit, and products were visualized on ABI sequencers in the LSU Museum of Natural Science, Pennington Biomedical Research Center, or the Department of Biological Sciences' genomics facility.

Fly stocks

Several inbred lines of D. mojavensis were tested to determine the most suitable lines for constructing a microsatellite map based on microsatellite allelic differences between strains, bearing the same chromosomal arrangements, and lack of segregating microsatellite alleles. In the end, we selected the lines A993 (Rancho El Diamante, Sonora) and A924 (St. Rosa Mtns., AZ), obtained from Dr. William J. Etges. These lines were further brother-sister mated for 9–12 generations to ensure thorough inbreeding and a reduction of segregating alleles.

Microsatellite assay conditions

We designed two primers for each microsatellite-bearing sequence, one bearing an M13(-29) tail. A 10 μL PCR reaction was then performed using 0.5 μM of each primer, 1.0 μL of dNTPs, 1.0 μL of 10X PCR buffer (100 mM Tris pH 8.3, 500 mM KCl, 15 mM MgCl2), 0.4 μL of IRDye (LiCor), 1U Taq DNA polymerase, and 0.5 μL from a single fly DNA preparation (Puregene). We sometimes added 1.0 μL of 10 mM MgCl2 to the reaction or more polymerase to optimize the results of the PCR. A touchdown PCR cycle was performed [23], and amplifications were visualized on acrylamide gels on our LiCor DNA analyzer.

Assignment to linkage groups

Virgin females and males of the A993 and A924 lines were crossed and offspring reared. DNA was isolated from the parents and progeny using the Puregene™ DNA Isolation Kit (Gentra Systems). We determined if markers differentiating the lines were X-linked or autosomal by comparing the F1 males to the F1 females and parent strains. For X-linked markers, males consistently bore one allele while females consistently bore two. Autosomal markers were further tested using 20 progeny of a male-parent backcross. Because there is no recombination in Drosophila males, the offspring all inherited a nonrecombinant chromosome from one of the original lines. By comparing genotypes across the male-parent backcross progeny, markers were assigned to linkage groups. We also used the NCBI Basic Local Alignment Search Tool [BLAST: [18]] to identify putatively homologous sequences in D. melanogaster. Sequences bearing an expect (E) value below 0.01 were scored, as E-values are nearly identical to probability (p) values in that range.

Recombinational mapping within linkage groups

Virgin F1 females (progeny of the cross described in "Assigning to linkage groups") were backcrossed to males of one of the pure lines (A924). To ascertain the recombinational distances between the markers on each chromosome, we genotyped the parents and 200 progeny with each marker previously assigned to a linkage group. Recombinational distances were estimated in Kosambi centiMorgans using Mapmaker [24].

Authors' contributions

RS maintained all fly cultures and performed all reactions and analyses involved in the recombinational mapping of microsatellites. SDS and MAFN produced the microsatellite genomic libraries, sequenced the clones, and designed the primers. All authors contributed to the preparation of this manuscript.