Literature DB >> 15054081

Antigenicity analysis of different regions of the severe acute respiratory syndrome coronavirus nucleocapsid protein.

Zeliang Chen1, Decui Pei, Lingxiao Jiang, Yajun Song, Jin Wang, Hongxia Wang, Dongsheng Zhou, Junhui Zhai, Zongmin Du, Bei Li, Maofeng Qiu, Yanping Han, Zhaobiao Guo, Ruifu Yang.   

Abstract

BACKGROUND: The widespread threat of severe acute respiratory syndrome (SARS) to human health has made urgent the development of fast and accurate analytical methods for its early diagnosis and a safe and efficient antiviral vaccine for preventive use. For this purpose, we investigated the antigenicity of different regions of the SARS coronavirus (SARS-CoV) nucleocapsid (N) protein.
METHODS: The cDNA for full-length N protein and its various regions from the SARS-CoV was cloned and expressed in Escherichia coli. After purification, all of the protein fragments were printed on glass slides to fabricate a protein microarray and then probed with the sera from SARS patients to determine the reactivity of these protein fragments.
RESULTS: The full-length protein and two other fragments reacted with all 52 sera tested. Four important regions with possible epitopes were identified and named as EP1 (amino acids 51-71), EP2 (134-208), EP3 (249-273), and EP4 (349-422), respectively. EP2 and EP4 possessed linear epitopes, whereas EP1 and EP2 were able to form conformational epitopes that could react with most (>80%) of the tested sera. EP3 and EP4 also formed conformational epitopes, and antibodies against these epitopes existed in all 52 of the sera tested.
CONCLUSION: The N protein is a highly immunogenic protein of the SARS-CoV. Conformational epitopes are important for this protein, and antigenicity of the COOH terminus is higher than that of the NH(2) terminus. The N protein is a potential diagnostic antigen and vaccine candidate for SARS-CoV.

Entities:  

Mesh:

Substances:

Year:  2004        PMID: 15054081      PMCID: PMC7108132          DOI: 10.1373/clinchem.2004.031096

Source DB:  PubMed          Journal:  Clin Chem        ISSN: 0009-9147            Impact factor:   8.327


The outbreak in Guangdong Province of China of atypical pneumonia, termed “severe acute respiratory syndrome” (SARS)1 by the WHO, spread rapidly to many countries during 2003. Thousands of people were infected, and hundreds of them died from this disease (1)(2)(3)(4)(5). Our institute was one of the groups that pioneered the isolation and identification of a novel coronavirus (CoV) as the causal agent (6). CoVs are members of an enveloped virus family that replicate in the cytoplasm of their animal host cells. They have a single-stranded plus-sense RNA genome ∼30 kb in length with a 5′-cap structure and a 3′-polyadenylated tail (7)(8). The open reading frame at the 5′ end of the viral genome encodes several nonstructural proteins responsible for replicating the viral genome as well as for generating nested transcripts (9)(10). The 3′ end encodes four structural proteins: spike glycoprotein (S protein), membrane protein (M protein), envelope glycoprotein (E protein), and nucleocapsid protein (N protein). The N protein is a major protein, and its primary function is to form ribonucleoprotein complexes during virion assembling; it has also been proposed to be a multifunctional protein with potential roles in replication, transcription, and translation (8)(9)(11). For the SARS-CoV, the N protein is encoded by an open reading frame located at the 3′ end of the viral genome, and its presence in the virion has been confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (5)(12). SARS is a new disease to humans, and many aspects of this disease are still unknown, posing a considerable threat to public health. Therefore, accurate diagnosis and efficient vaccines are vital for controlling this disease. The N protein is a relatively conservative and highly immunogenic protein and could be used as a diagnostic antigen and vaccine candidate (13). Shi et al. (14) used an N- protein-based ELISA to analyze its antibodies in patient sera and found that antibodies appeared 6 days after the onset of illness. However, the locations of the antigenicity determinants were still unknown. Wang et al. (15) analyzed the antigenicity of the N protein by use of synthetic peptides. They identified three highly immunogenic epitopes but found it difficult to identify the conformational epitopes by use of synthetic peptides. Protein fragments seem to be a useful tool for the analysis of conformational epitopes. In the present study, the cDNA for the full-length N protein and its various regions was cloned and expressed in Escherichia coli, and the proteins were purified and used to fabricate microarrays that were probed with sera from SARS patients. Four regions important for antigenicity were proposed after detailed interpretation of the results.

Materials and Methods

collection of sera from sars patients

The sera used in this study were collected from the 301 Hospital of the People’s Liberation Army (PLA), 302 Hospital of PLA, 309 Hospital of PLA, Chaoyang Hospital, Ditan Hospital, and Youan Hospital during the SARS outbreak in Beijing from April to June 2003. A total of 625 sera were screened by SARS-CoV lysate-based ELISA to determine the IgG titer against the SARS-CoV, and 52 of these sera, with IgG readouts ranging from 0.30 to 1.10, were used for immunoblotting and protein microarray assays. Eight sera from healthy people without antibodies to the SARS-CoV were used as negative controls.

sequence analysis and primer design

The sequence of the gene encoding N protein from the SARS-CoV (strain BJ01) was retrieved from GenBank (accession no. AY278488) and analyzed for putative epitopes with the DNASTAR software package (DNASTAR, Inc.; http://www.dnastar.com/). On the basis of the predicted epitope locations, 33 primers were designed and synthesized to amplify the fragments spanning these epitopes (Table 1 ). The designed primers were synthesized by SUNBIO Tech Company.
Table 1.

Oligonucleotides designed and used in this study.

Name1Position,2 5′ endPrimer sequence,3 5′–3′
NA-F152 AGCTGGATCCTTTGGTGGACCCACAG
NA-F291 AGCTGGATCCGGAGGACGCAATGG
NA-F3160 AGCTGGATCCTTCACAGCTCTCAC
NA-F4214 AGCTGGATCCGGCGTTCCAATC
NA-F5403 AGCTGGATCCGCAACTGAGGGAGC
NA-F6538 AGCTGGATCCGGCAGTCAAGCCTC
NA-F7667 AGCTGGATCCTTGCTGCTAGACAG
NA-F8745 AGCTGGATCCAAGAAATCTGCTGC
NA-F9817 AGCTGGATCCCAAGCATTTGGGAG
NA-F10874 AGCTGGATCCCTAATCAGACAAGG
NA-F111006 AGCTGGATCCGGAGCCATTAAATTG
NA-F121058 AGCTGGATCCTGCTGAACAAGCAC
NA-R13141 GCATGTCGACTGGGTAAACCTTGG
NA-R14207 GCATGTCGACCTCGAGGGAATC
NA-R15327 GCATGTCGACACCATCTGGGGCTG
NA-R16468 GCATGTCGACCAGCATTGTTATTAG
NA-R17624 GCATGTCGACCAGGAGAATTTCCCCTAC
NA-R18753 GCATGTCGACCAGATTTCTTAGTGACAG
NA-R19810 GCATGTCGACCGTTGTACTGTTTTGTGG
NA-R20864 GCATGTCGACCCCCGAAATTTCCTTGG
NA-R221047 GCATGTCGACTGTCTTTGAATTGTGGATC
NA-R231146 GCATGTCGACAAGGCTGAGCTTCATCAG
NA-R241185 GCATGTCGACGAAGAGTCACAGTGGGCTG
NO-F1 AGCTGGATCCATGTCTGATAATGG
NO-F1151 AGCTGGATCCGCGTCTTGGTTCACAG
NO-F2397 AGCTGGATCCTGGGTTGCAACTGAG
NO-F3661 AGCTGGATCCGCGCTATTGCTGCTAG
NO-F4949 AGCTGGATCCGGAATGTCACGCATTG
NO-R1402 AGCTGTCGACAACCCATACGATGC
NO-R2654 AGCTGTCGACAGTTTCACCACCTCC
NO-R3933 AGCTGTCGACACTTGGAGCAAATTG
NO-R1266 AGCTGTCGACTTATGCCTGAGTTG

F, forward primer; R, reverse primer.

Location of the first base at the 5′ end of the primer on the nucleocapsid gene.

The underlined sequences are the restriction site and protection nucleotides.

Oligonucleotides designed and used in this study. F, forward primer; R, reverse primer. Location of the first base at the 5′ end of the primer on the nucleocapsid gene. The underlined sequences are the restriction site and protection nucleotides.

cloning, production, and purification of full-length n protein and fragments

The SARS-CoV (BJ01) was cultured in Vero E6 cells at 37 °C for 48 h; the medium from the infected cells was then collected for RNA extraction by the QIAamp viral RNA Mini Kit (QIAGEN, Inc.). From the RNA template, single-stranded cDNA was synthesized with use of the primer NO-R (Table 1 ) and the SuperScript cDNA system (Invitrogen). The full-length N gene was amplified from the cDNA templates with the primer pair NO-F and NO-R. The PCR products were purified with Montage PCR reagent sets (Millipore Corporation), digested with BamHI and SalI (Promega Corporation), and ligated into similarly digested plasmid pET-32a (Novagen). The ligation products were transformed in BL21 (DE3; Novagen Inc.), and the recombinant clones were identified by PCR and confirmed by sequencing. Various fragments spanning different putative epitopes (Table 2 ) were amplified from the recombinant clone with the full-length N protein gene by different primer combinations and cloned into pET-32a as described above. To produce the target proteins, the recombinant clones were cultured at 37 °C to A600 = 0.6 and then induced with isopropyl β-d-thiogalactoside (Sigma). The proteins were then purified by use of Ni-NTA agarose (Qiagen) according to the manufacturer’s instructions.
Table 2.

Detailed information for the fragments.

Fragment namePrimer combination1Start position, amino acid numberStop position, amino acid numberFragment length, amino acids
F14NO-F + NA-R1416969
F15NO-F + NA-R151109109
N1NO-F + NO-R11134134
F17NO-F + NA-R171208208
N2NO-F + NO-R21218218
N3NO-F + NO-R31311311
N4NO-F + NO-R1422422
N114NA-F1 + NA-R14186952
N214NA-F2 + NA-R143110979
N215NA-F2 + NA-R1531134104
N5NO-F1 + NO-R15113484
N6NO-F1 + NO-R251218168
N7NO-F1 + NO-R351311261
N8NO-F1 + NO-R51422372
N315NA-F3 + NA-R155410956
N416NA-F4 + NA-R167215685
N417NA-F4 + NA-R1772208137
N9NO-F2 + NO-R213321886
N10NO-F2 + NO-R3133311179
N11NO-F2 + NO-R133422290
N517NA-F5 + NA-R1713520874
N12NO-F3 + NO-R322131191
N13NO-F3 + NO-R221422202
N822NA-F8 + NA-R22249349101
N823NA-F8 + NA-R23249382134
N824NA-F8 + NA-R24249395147
N922NA-F9 + NA-R2227334977
N923NA-F9 + NA-R23273382110
N924NA-F9 + NA-R24273395123
N1022NA-F10 + NA-R2229234958
N1023NA-F10 + NA-R2329238291
N1024NA-F10 + NA-R24292395104
N14NO-F4 + NO-R317422106

Primer combinations used to amplify the corresponding RNA.

Detailed information for the fragments. Primer combinations used to amplify the corresponding RNA.

immunoblotting analysis of the proteins

For immunoblotting analysis, the proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. The membranes were blocked in Tris-buffered saline-Triton (150 mmol/L NaCl; 50 mmol/L bis-Tris, pH 7.5; 0.5 mL/L Triton X-100) containing nonfat milk (10 mL/L) for 2 h at room temperature and then incubated with pooled patient sera (1:200 dilution) for 2 h. After three washes in Tris-buffered saline-Triton, the membranes were incubated with horseradish peroxidase-conjugated goat anti-human IgG (Santa Cruz Biotechnology) for 2 h and then washed with Tris-buffered saline-Triton three more times. The membranes were developed with diaminobenzidine substrate for ∼5 min, and the reaction was stopped by the addition of water.

protein microarray analysis

The purified proteins were dissolved at different concentrations (400, 100, 25.5, and 0.5 mg/L) in phosphate-buffered saline (PBS; pH 7.5) containing 400 mL/L glycerol and printed in triplicate on silylated glass slides (CEL Associates, Inc.) by use of the GSI Flexys arrayer (Genomic Solutions). Goat anti-human IgG and human IgG were printed as positive controls, and cell lysates of E. coli BL21 (transformed with pET-32a) and PBS (containing 400 mL/L glycerol) were printed as negative controls (see Fig. S1 in the Data Supplement that accompanies the online version of this article at http://www.clinchem.org/content/vol50/issue6/). Printed slides were stored at 4 °C and used within 2 weeks after being printed. To eliminate antibodies against E. coli in the sera, all of the sera were incubated with lysates of E. coli BL21 carrying pET-32a before microarray analysis. For microarray probing, the slides were first blocked with 30 mL/L nonfat milk in PBS for 1 h and then incubated with diluted sera (1:200) for another 1 h at room temperature. The incubated slides were washed three times with PBS containing 1 mL/L Tween-20 and once with PBS and then incubated for another 2 h with the fluorescently labeled secondary antibody (goat anti-human IgG) generated by use of a Cy5 antibody labeling reagent set (Amersham Biosciences). The resulting slides were washed with PBS-Tween twice and PBS once, followed by a 2-min ethanol rinse. After being dried with hot air, the slides were scanned with the GenePix Personal 4100A Scanner (Axon Instruments). Each analysis was repeated at least once. The scanned images were processed, and the generated data were further analyzed by the GenePix Pro 4.0 software (Axon Instruments) and Microsoft Excel software. The fluorescence signal of each spot was calculated as the median fluorescence intensity (FI) minus the median local background intensity. Spots with bad signals were rejected, and those with signal values <1 were set as 1 to reflect a spot signal close to 0 (see Table S1 in the online Data Supplement). The mean human IgG signal from all of the slides was used to calibrate the signals of other spots. The spot signals for each protein fragment in the replicated hybridizations were then averaged and ready for further analysis. The normalized datasets were logarithmically transformed (base 2) and clustered by CLUSTER (16) and viewed by TREEVIEW (http://genome-www4.stanford.edu/MicroArrayy/SMDyrestech.html). To determine the positive serum number of each protein fragment, the cutoff value of each fragment was calculated as the mean value plus 3 SD of the FI from the negative controls. For further analysis of the epitope locations and antigenicities of different regions, pooled sera (10 of the 52 tested sera) were mixed with excessive amount of specific fragments to eliminate the corresponding antibodies and then probed with protein microarrays.

validation of microarray analysis by elisa

To further validate the results of the microarray analysis, fragment-specific ELISAs were used. Briefly, 96-well plates were coated overnight with the purified proteins at 4 °C. After the plates were blocked, sera from SARS patients were added for incubation at room temperature for 1 h; the plates were then washed with PBS-Tween. The results were visualized by horseradish peroxidase-conjugated goat anti-human IgG and tetramethylbenzidine.

Results

production and purification of n protein and its fragments

On the basis of the predicted epitopes, 33 primers were designed and synthesized and used to amplify fragments spanning these epitopes (Table 1 ). The cDNA for a total of 33 fragments of the N protein was cloned and expressed (Table 2 ). The positions of these fragments on the N protein are depicted in Fig. 1 , and the details of these fragments are listed in Table 2 . After optimization of the expression and purification conditions, all of the proteins produced in either soluble form or as inclusion bodies were successfully purified as single bands on sodium dodecyl sulfate–polyacrylamide gel electrophoresis for microarray analysis.
Figure 1.

Positions of the fragments on the SARS-CoV N protein.

The line with scales at the top represents the full-length N protein (N4), with the numbers indicating amino acid positions. The other lines represent the fragments, and the numbers on both ends of each fragment indicate the starting and ending amino acid positions. The fragment name is above the line; the numbers in parentheses indicate the percentages of sera positive for each fragment by protein microarray analysis. The four important epitope regions (EP1–EP4) are located at amino acids 51–71, 134–208, 249–273, and 349–422, respectively, as indicated by the thick lines.

Positions of the fragments on the SARS-CoV N protein. The line with scales at the top represents the full-length N protein (N4), with the numbers indicating amino acid positions. The other lines represent the fragments, and the numbers on both ends of each fragment indicate the starting and ending amino acid positions. The fragment name is above the line; the numbers in parentheses indicate the percentages of sera positive for each fragment by protein microarray analysis. The four important epitope regions (EP1EP4) are located at amino acids 51–71, 134–208, 249–273, and 349–422, respectively, as indicated by the thick lines. To locate the linear epitopes in N protein and its fragments, the proteins produced were analyzed with pooled sera (15 of the 52). The results (data not shown) indicated that most of the proteins could react with pooled sera. Fragments that did not react with pooled sera were N114, N214, N215, N315, N416, N822, N922, N1022, F14, F15, N12, and N5, indicating that there were no linear epitopes on these fragments. When equal quantities of proteins were analyzed by immunoblotting, fragments N4, N8, N824, N11, and N13 appeared to have higher reactivities, and fragments N417, N517, N9, and N10 appeared to have lower reactivities, as indicated by the amount of gray that developed on the immunoblot.

correlation between captured IgG and fi

To explore the correlation between the FI and the IgG quantities captured by the printed antigens, human IgG in increasing concentrations was printed on slides to act as an internal standard for calibration. As the results showed, there was a good correlation (r2 = 0.9987) between FI and IgG concentration (Fig. 2A ), indicating that the FI can reflect the amount of IgG captured by the printed antigens. Because each pin was estimated to transfer a 40-pL sample, the calibration curve of FI to the amount of IgG could be calculated (Fig. 2B ). This curve could be used to estimate the amounts of antibodies captured by antigens on the microarray. In general, fragments with higher reactivities captured more antibodies. For example, fragment N4 captured ∼9.65 pg of IgG, three times the amount captured by F17 (see Fig. S2 in the online Data Supplement). The correlation between the FI and printed antigen concentration was lower than that of the printed human IgG (data not shown). However, the correlation was good for certain fragments that could react with most (>80%) of the tested sera (e.g., r2 = 0.9823 for N4).
Figure 2.

Correlation between FI and captured IgG.

(A), correlation between FI and concentration of printed IgG. Human IgG was printed in increasing concentrations and probed with Cy5-labeled goat anti-human IgG. The FI was plotted as a function of the concentration of printed human IgG to generate a dose–response curve, and a good correlation coefficient (close to 1) was obtained. (B), correlation between FI and amount of printed human IgG.

Correlation between FI and captured IgG. (A), correlation between FI and concentration of printed IgG. Human IgG was printed in increasing concentrations and probed with Cy5-labeled goat anti-human IgG. The FI was plotted as a function of the concentration of printed human IgG to generate a dose–response curve, and a good correlation coefficient (close to 1) was obtained. (B), correlation between FI and amount of printed human IgG.

validation of protein microarray analysis

Fragments with different reactivities in microarray assays were selected and analyzed by fragment-specific ELISAs. The absorbance values in ELISA were used for regression analysis against the FI in microarray analysis. The results showed that there was good correlation between IgG absorbance and FI, particularly for fragments that could react with most (>80%) of the sera (data not shown). Fragments with poor reactivity in microarray analysis had a lower correlation coefficient (e.g., r2 = 0.8583 for N1), whereas for those that could react with 100% (52 of 52) of the sera, the correlation was high (e.g., r2 = 0.9993 for N4).

profile of the antigenicity of n protein fragments

The normalized fluorescence values were logarithmically transformed (base 2) and clustered by CLUSTER and graphed by TREEVIEW (Fig. 3 ). Most of the fragments were clustered into four main groups, among which the fragments in group A had the highest reactivity (>80%), fragments in group B reacted with 40–60% of the tested sera, fragments in group C had lower reactivity (0–40%), and group D included only F17, which also reacted with most (86%) of the sera. N13 (amino acids 221–422) and N2 (1–218) were approximately the same length but reacted with 100% and 86% of the sera, respectively (Fig. 1 ), inferring that there were important antigen determinants at both termini of the N protein but that the antigenicity at the COOH terminus was higher than that at the NH2 terminus. In addition, as predicted by DNASTAR software, there were more putative epitopes located at the COOH terminus of the N protein (17).
Figure 3.

Reactivities of all of fragments printed at the concentration of 400 mg/L.

The fluorescence values were normalized and logarithmically transformed (base 2); the cutoff value 8 was subtracted from each result. The values were then clustered by CLUSTER software and viewed with TREEVIEW software. Black squares represent positive values, white squares indicate negative values, and gray squares indicate intermediate degrees of FI.

Reactivities of all of fragments printed at the concentration of 400 mg/L. The fluorescence values were normalized and logarithmically transformed (base 2); the cutoff value 8 was subtracted from each result. The values were then clustered by CLUSTER software and viewed with TREEVIEW software. Black squares represent positive values, white squares indicate negative values, and gray squares indicate intermediate degrees of FI.

regions spanning amino acids 1–50 and 218–311 are not important for the exposure of epitopes

Fragments N7 (amino acids 51–311) and N3 (1–311) reacted with the same percentage of serum percentile (88%), indicating that the 50 amino acids at the NH2 terminus of N3 were not important for the exposure of epitopes. The results for N6 (amino acids 51–218) and N8 (51–422), which were formed by the deletion of these 50 amino acids from N2 (amino acids 1–218) and N4 (1–422), respectively (Fig. 1 ), also supported this conclusion. Despite a longer peptide, N3 reacted with the same number of sera as N2, suggesting that the region spanning amino acids 218–311 was not important for antigenicity.

regions spanning amino acids 50–70 and 138–208 have important epitopes

Fragment F17 (amino acids 1–208) had positive reactions with 86% (45 of 52) of the tested sera, but fragment N1 (1–134) reacted with only 8% (4 of 52) of the tested sera, indicating that the region spanning amino acids 135–208 contains important antigenic determinants. Fragment N417 (amino acids 72–208) reacted with 62% (32 if 52) of the sera, which was lower than the reactivity of fragment F17, demonstrating that the first 70 amino acids might include epitopes that increase the reactivity of F17. Because the first 50 amino acids (amino acids 1–50) were not important for antigenicity, the epitopes were likely located at the region of amino acids 50–70.

regions spanning amino acids 249–273 and 349–422 contain important epitopes

Fragments N822 (amino acids 249–349), N823 (249–382), and N824 (249–395) reacted with 0 (0%), 47 (90%), and 50 (96%) of the 52 sera, inferring that there are antigen determinants in the region of amino acids 349–395. Fragment N923 (amino acids 273–382), which was formed by deletion of 25 amino acids (249–273) from the NH2 terminus of N823, did not react with any of the tested sera, suggesting that this 25-amino acid region is very important. N14 (amino acids 317–422), which was formed by deletion of 26 amino acids at the NH2 terminus and an elongation of 28 amino acids (396–422) at the COOH terminus of N1024, reacted with 25 (48%) of the sera, which further confirmed the important role of this 28-amino acid region in the antigenicity of N14.

four important regions identified and their relationships

From the analysis above, four regions containing important epitopes were identified in the N protein in this study: EP1 (amino acids 51–71), EP2 (134–208), EP3 (249–273), and EP4 (349–422). Fragments that contained only EP1 had lower or no reactivities; for example, F14 and N1 reacted with only 0% and 8% of the tested sera, respectively (Fig. 1 ). Fragments that contained only EP2 (i.e., N9 and N517) reacted with ∼40% of the sera. Fragment N2, which spanned both EP1 and EP2, could react with most of the sera (46 of 52; 88%), which indicated a cooperative relationship between EP1 and EP2. Fragment N9 (amino acids 133–218) was reactive in both the immunoblotting and microarray analyses, indicating that EP2 contains both conformational and linear epitopes. Fragments that contained only EP4 reacted with approximately one-half of the tested sera, and those that contained only EP3 had no reactivity. Fragments that spanned both of them, however, reacted with 100% (52 of 52) of the tested sera, suggesting that there might be some relationship between EP3 and EP4 for the formation of conformational epitopes. Fragments N922, N923, and N924, which contained only EP4, had no reactivity in protein chip analysis; however, N923 and N924 could react with pooled sera in immunoblotting analysis, indicating that EP4 contains only linear epitopes. Fragments N822, N12, and N922 had no reactivity in both analyses, implying that EP3 could not form epitopes alone.

not all epitopes identified in the n protein are exposed in the full-length protein

To further analyze the antibodies against different regions of the N protein, we pooled sera, mixed them with excessive amounts of specific fragments, and then probed the sera with protein microarrays. When mixed with the full-length protein, the pooled sera still reacted with fragments N13 and N824, indicating that in the full-length protein, not all of the identified epitopes are exposed (Table 3 ). Fragment N13 reacted with the serum to which N824 had been added and vice versa; we thus could infer that they exposed different epitopes.
Table 3.

Results for pooled sera mixed with the specific fragments.

Fragment1No fragment addedFragments mixed with the sera before reaction2
N11N13N2N4N3N6N8N824
F17+++
N417++
N517+++
N823++++++
N824+++++++
N2+++
N3+++
N4+++++++
N6+++
N7+++
N8+++++++
N9+++
N10+++
N11++++++
N12+
N13++++++++

Fragments that can react with pooled sera before the sera were mixed with excessive amounts of specific fragments.

Excessive amounts of specific fragments were mixed with the pooled sera. The sera were then probed with microarray. +, positive reaction; −, negative reaction.

Results for pooled sera mixed with the specific fragments. Fragments that can react with pooled sera before the sera were mixed with excessive amounts of specific fragments. Excessive amounts of specific fragments were mixed with the pooled sera. The sera were then probed with microarray. +, positive reaction; −, negative reaction.

Discussion

In recent years, protein microarray technology has become a particularly powerful tool for high-throughput gene function analysis (18)(19). Although there are still challenges in protein microarray technology, major advances have been achieved in this field (20)(21)(22). In the present study, fragments of the N protein of the SARS-CoV were purified and printed on glass slides and probed with patient sera to analyze their reactivity. The proteins printed on the slides retained their conformations and were recognized by the relevant antibodies in complex solutions. In the present study, we analyzed the antigenicity of different regions of the SARS-CoV N protein and identified four important regions (EP1 to EP4). Wang et al. (15) analyzed epitopes of the N protein, using synthetic peptides, and found that N66 and N371–N404 were important epitopes. Notably, peptides N371 and N385, located at the COOH terminus of the N protein, inhibited the binding of antibodies to the SARS-CoV lysate and bound to antibodies in >94% of the tested sera. N385 had the highest affinity for forming peptide–antibody complexes with SARS serum. In the present study, EP2 (amino acids 51–71), which overlaps with N66, was found to be important for antigenicity. In our microarray analyses, the regions located at the COOH terminus were found to be more important than those at the NH2 terminus, which further confirmed the results of a previous study. Wang et al. (17) found that epitopes located at amino acids 161–182 and 471–390 were highly immunogenic, which was also consistent with our results. As indicated in this report, EP4 (amino acids 349–422) carried linear epitopes that gave negative results in microarray analyses but were positive in immunoblotting. A total of four important regions were identified in the N protein, and fragments containing only one of these regions had no or low reactivity, whereas those spanning two or more of these regions had high reactivity. Thus, structural requirements seem to be important for antigenicity of the N protein because a cooperative action is required between these regions. This also showed the important role of conformational epitopes in the antigenicity of the N protein, which could not be obtained by synthetic peptides. Shi et al. (14) used a N-protein-based antigen-capturing ELISA to analyze antibodies to this protein. They found that anti-N-protein antibodies could be detected in 68.4% of probable SARS patients 6–10 days after illness and in 89.6% of the patients 11–61 days after illness, indicating the high immunogenicity of the N protein and early appearance of its antibodies. The antibodies against the N protein were produced in all SARS patients and appeared in early stages of this disease, which implies the possible use of this protein for early and accurate diagnosis of this disease. There are three important domains in the N protein, the second of which is a RNA-binding domain (23)(24). In the genome of the murine hepatitis virus, the RNA-binding domain is located at amino acids 175–231 (25). Sequence analysis indicates that the RNA-binding domain of the SARS-CoV N protein is at amino acids 178–205 (26). Wang et al.(15) found that N177 (amino acids 177–198) was highly immunogenic, and in the present study, EP2 overlaps this region, indicating that this region is important both in its RNA-binding function and its immunogenicity. Motif scanning of the SARS-CoV predicted a bipartite nuclear localization signal located at amino acids 373–390, suggesting that the N protein may play some special role in the pathogenicity of this new CoV (27). In this region, important epitopes (N371 and N385) were identified (15). These predicted functional sites overlap important epitopes, implying the possibility of using of this protein as a vaccine candidate.

In conclusion, in the present study, protein microarray technology was used to analyze the antigenicity of the N protein for the first time. By use of comprehensive microarray analyses, we identified four important regions of the SARS-CoV N protein and confirmed that the COOH terminus has higher immunogenicity than the NH2 terminus. We also demonstrated that the N protein of SARS-CoV is highly immunogenic and could be used as diagnostic antigen. The fragments that reacted to all of the tested sera in this study are being used as antigens to immunize animals to prepare antibodies to investigate their possible use as vaccine candidates. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  25 in total

Review 1.  Advances in protein microarray technology for protein expression and interaction profiling.

Authors:  B B Haab
Journal:  Curr Opin Drug Discov Devel       Date:  2001-01

2.  Characterization of the coronavirus M protein and nucleocapsid interaction in infected cells.

Authors:  K Narayanan; A Maeda; J Maeda; S Makino
Journal:  J Virol       Date:  2000-09       Impact factor: 5.103

3.  SARS in China. China's missed chance.

Authors:  Martin Enserink
Journal:  Science       Date:  2003-07-18       Impact factor: 47.728

4.  Identification of a novel coronavirus in patients with severe acute respiratory syndrome.

Authors:  Christian Drosten; Stephan Günther; Wolfgang Preiser; Sylvie van der Werf; Hans-Reinhard Brodt; Stephan Becker; Holger Rabenau; Marcus Panning; Larissa Kolesnikova; Ron A M Fouchier; Annemarie Berger; Ana-Maria Burguière; Jindrich Cinatl; Markus Eickmann; Nicolas Escriou; Klaus Grywna; Stefanie Kramme; Jean-Claude Manuguerra; Stefanie Müller; Volker Rickerts; Martin Stürmer; Simon Vieth; Hans-Dieter Klenk; Albert D M E Osterhaus; Herbert Schmitz; Hans Wilhelm Doerr
Journal:  N Engl J Med       Date:  2003-04-10       Impact factor: 91.245

Review 5.  Coronavirus: organization, replication and expression of genome.

Authors:  M M Lai
Journal:  Annu Rev Microbiol       Date:  1990       Impact factor: 15.500

6.  Genetic evidence for a structural interaction between the carboxy termini of the membrane and nucleocapsid proteins of mouse hepatitis virus.

Authors:  Lili Kuo; Paul S Masters
Journal:  J Virol       Date:  2002-05       Impact factor: 5.103

7.  Further identification and characterization of novel intermediate and mature cleavage products released from the ORF 1b region of the avian coronavirus infectious bronchitis virus 1a/1b polyprotein.

Authors:  H Y Xu; K P Lim; S Shen; D X Liu
Journal:  Virology       Date:  2001-09-30       Impact factor: 3.616

8.  A novel coronavirus associated with severe acute respiratory syndrome.

Authors:  Thomas G Ksiazek; Dean Erdman; Cynthia S Goldsmith; Sherif R Zaki; Teresa Peret; Shannon Emery; Suxiang Tong; Carlo Urbani; James A Comer; Wilina Lim; Pierre E Rollin; Scott F Dowell; Ai-Ee Ling; Charles D Humphrey; Wun-Ju Shieh; Jeannette Guarner; Christopher D Paddock; Paul Rota; Barry Fields; Joseph DeRisi; Jyh-Yuan Yang; Nancy Cox; James M Hughes; James W LeDuc; William J Bellini; Larry J Anderson
Journal:  N Engl J Med       Date:  2003-04-10       Impact factor: 91.245

9.  Novel coronavirus and severe acute respiratory syndrome.

Authors:  Ann R Falsey; Edward E Walsh
Journal:  Lancet       Date:  2003-04-19       Impact factor: 79.321

10.  Coronavirus translational regulation: leader affects mRNA efficiency.

Authors:  S M Tahara; T A Dietlin; C C Bergmann; G W Nelson; S Kyuwa; R P Anthony; S A Stohlman
Journal:  Virology       Date:  1994-08-01       Impact factor: 3.616

View more
  37 in total

1.  A double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge.

Authors:  Meagan Bolles; Damon Deming; Kristin Long; Sudhakar Agnihothram; Alan Whitmore; Martin Ferris; William Funkhouser; Lisa Gralinski; Allison Totura; Mark Heise; Ralph S Baric
Journal:  J Virol       Date:  2011-09-21       Impact factor: 5.103

2.  Serological characterization of guinea pigs infected with H3N2 human influenza or immunized with hemagglutinin protein.

Authors:  Ruth V Bushnell; John K Tobin; Jinxue Long; Stacey Schultz-Cherry; A Ray Chaudhuri; Peter L Nara; Gregory J Tobin
Journal:  Virol J       Date:  2010-08-24       Impact factor: 4.099

3.  Use of the COOH portion of the nucleocapsid protein in an antigen-capturing enzyme-linked immunosorbent assay for specific and sensitive detection of severe acute respiratory syndrome coronavirus.

Authors:  Maofeng Qiu; Jin Wang; Hongxia Wang; Zeliang Chen; Erhei Dai; Zhaobiao Guo; Xiaoyi Wang; Xin Pang; Baoxing Fan; Jie Wen; Jian Wang; Ruifu Yang
Journal:  Clin Diagn Lab Immunol       Date:  2005-03

4.  Protein microarray for profiling antibody responses to Yersinia pestis live vaccine.

Authors:  Bei Li; Lingxiao Jiang; Qifeng Song; Junxin Yang; Zeliang Chen; Zhaobiao Guo; Dongsheng Zhou; Zongmin Du; Yajun Song; Jin Wang; Hongxia Wang; Shouyi Yu; Jian Wang; Ruifu Yang
Journal:  Infect Immun       Date:  2005-06       Impact factor: 3.441

5.  Specific epitopes of the structural and hypothetical proteins elicit variable humoral responses in SARS patients.

Authors:  S C S Chow; C Y S Ho; T T Y Tam; C Wu; T Cheung; P K S Chan; M H L Ng; P K Hui; H K Ng; D M Y Au; A W I Lo
Journal:  J Clin Pathol       Date:  2006-02-03       Impact factor: 3.411

6.  Molecular and biological characterization of human monoclonal antibodies binding to the spike and nucleocapsid proteins of severe acute respiratory syndrome coronavirus.

Authors:  Edward N van den Brink; Jan Ter Meulen; Freek Cox; Mandy A C Jongeneelen; Alexandra Thijsse; Mark Throsby; Wilfred E Marissen; Pauline M L Rood; Alexander B H Bakker; Hans R Gelderblom; Byron E Martina; Albert D M E Osterhaus; Wolfgang Preiser; Hans Wilhelm Doerr; John de Kruif; Jaap Goudsmit
Journal:  J Virol       Date:  2005-02       Impact factor: 5.103

7.  B-cell responses in patients who have recovered from severe acute respiratory syndrome target a dominant site in the S2 domain of the surface spike glycoprotein.

Authors:  Xiaofen Zhong; Huanghao Yang; Zu-Feng Guo; Wan-Yee Fion Sin; Wei Chen; Junjie Xu; Ling Fu; Jie Wu; Chun-Kit Gannon Mak; Chak-Sum Samuel Cheng; Yanzhen Yang; Shuyong Cao; Tin-Yau Wong; Sik-To Lai; Yong Xie; Zhihong Guo
Journal:  J Virol       Date:  2005-03       Impact factor: 5.103

8.  Naturally occurring anti-Escherichia coli protein antibodies in the sera of healthy humans cause analytical interference in a recombinant nucleocapsid protein-based enzyme-linked immunosorbent assay for serodiagnosis of severe acute respiratory syndrome.

Authors:  Chi Wai Yip; Chung Chau Hon; Fanya Zeng; Ken Y C Chow; Kwok Hung Chan; Joseph S M Peiris; Frederick C C Leung
Journal:  Clin Vaccine Immunol       Date:  2006-11-15

9.  Interactions of SARS coronavirus nucleocapsid protein with the host cell proteasome subunit p42.

Authors:  Qin Wang; Chuan Li; Quanfu Zhang; Tao Wang; Jiandong Li; Wuxiang Guan; Jianshi Yu; Mifang Liang; Dexin Li
Journal:  Virol J       Date:  2010-05-17       Impact factor: 4.099

Review 10.  From functional genomics to functional immunomics: new challenges, old problems, big rewards.

Authors:  Ulisses M Braga-Neto; Ernesto T A Marques
Journal:  PLoS Comput Biol       Date:  2006-07-28       Impact factor: 4.475

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.