Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.