| Literature DB >> 8429007 |
Abstract
The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.Entities:
Mesh:
Substances:
Year: 1993 PMID: 8429007
Source DB: PubMed Journal: J Biol Chem ISSN: 0021-9258 Impact factor: 5.157