Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.