Kinetic analysis of triple-helix formation by pyrimidine oligodeoxynucleotides and duplex DNA.

The kinetics of triple-helix formation by the pyrimidine oligonucleotide d(CTTTCCTTCTTCTTTCCC) (TFO) and the homopurine.homopyrimidine (R.Y) duplex, whose purine strand is d(TGAAAAAGAAAGGAAGAAAGGG), (D), was studied using ultraviolet absorbance decay measurements, in 50 mM Tris/acetate, pH 6, 50 mM NaCl, 10 mM MgCl2. The decay curves were obtained by a static method, measuring as a function of time the hypochromicity at 270 nm produced by D and TFO after mixing under conditions favorable for triplex formation. This approach allowed direct measurement of triplex formation as it proceeded. The kinetic experiments were carried out at temperatures below the tm of the triplex, i.e. at 17-33 degrees C, and at two different D:TFO ratios, 1:1 and 1:10. When D and TFO were mixed in equimolar amounts, 1.7 microM each, the kinetics of triplex formation were characterized by half-decay times, t1/2, of 150-390 s. By contrast, when TFO was in tenfold excess [14 (mumol TFO).l-1] over D [1.4 (mumol D).l-1], the kinetics were faster and the t1/2 decreased to 19-26 s. Different rate equations have been used to describe the kinetics of triplex formation under these two different conditions. Both sets of experiments provided second-order rate constants, k1, of approximately 10(3) l.(mol TFO)-1.s-1 which showed a slight decrease with temperature. The rate of triplex formation appeared to be about three order of magnitude slower than the rate of duplex recombination, whose rate constant is in the order of 10(6) l.(mol oligomer)-1.s-1 [Craig, M. E., Crother, D. M. & Doty, P. (1971) J. Mol. Biol. 62, 383-401; Pörschke, D. & Eigen, M. (1971) J. Mol. Biol. 62, 361-381; Nelson, J. W. & Tinoco, I, Jr (1982) Biochemistry 21, 5289-5295]. The apparent activation energy associated with the rate constants of triplex formation was small and negative (E1 = -26 +/- 15 kJ/mol). The first-order rate constants of triplex dissociation, k-1, strongly dependent on temperature and were in the range 10(-7) s-1 (at 20 degrees C) to 10(-5) s-1 (at 33 degrees C), with an apparent activation energy that was large and positive (E-1 = 355 +/- 33 kJ/mol). The rate of triplex formation also showed a significant dependence on the ionic strength (I) of the buffer solution. A decrease of I from 130 M to 57 M resulted in a sixfold decrease of the association constant, from 2.16 x 10(3) to 0.36 x 10(3) l.(mol TFO)-1.s-1, at 22.5 degrees C.(ABSTRACT TRUNCATED AT 400 WORDS)