Literature DB >> 7201130

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

F Takaiwa, M Kusuda, M Sugiura.   

Abstract

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

Entities:  

Mesh：

Substances：

Year:  1982        PMID： 7201130      PMCID： PMC320607          DOI： 10.1093/nar/10.7.2257

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  14 in total

1.  New rapid gel sequencing method for RNA.

Authors:  A Simoncsits; G G Brownlee; R S Brown; J R Rubin; H Guilley
Journal:  Nature       Date:  1977-10-27       Impact factor: 49.962

2.  Direct chemical method for sequencing RNA.

Authors:  D A Peattie
Journal:  Proc Natl Acad Sci U S A       Date:  1979-04       Impact factor: 11.205

3.  The synthesis and origin of chloroplast low-molecular-weight ribosomal ribonucleic acid in spinach.

Authors:  M R Hartley
Journal:  Eur J Biochem       Date:  1979-05-15

4.  Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms.

Authors:  M Sugiura; M Takanami
Journal:  Proc Natl Acad Sci U S A       Date:  1967-10       Impact factor: 11.205

5.  4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

Authors:  C M Bowman; T A Dyer
Journal:  Biochem J       Date:  1979-12-01       Impact factor: 3.857

6.  Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography.

Authors:  M Sugiura; M Suzuki; E Ohtsuka; S Nishikawa; H Uemura; M Ikehara
Journal:  FEBS Lett       Date:  1979-01-01       Impact factor: 4.124

7.  Anatomy of the chloroplast ribosomal DNA of Chlamydomonas reinhardii.

Authors:  J D Rochaix; P Malnoe
Journal:  Cell       Date:  1978-10       Impact factor: 41.582

8.  Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

Authors:  P R Whitfeld; C J Leaver; W Bottomley; B Atchison
Journal:  Biochem J       Date:  1978-12-01       Impact factor: 3.857

9.  Isolation of Euglena gracilis chloroplast 5S ribosomal RNA and mapping the 5S rRNA gene on chloroplast DNA.

Authors:  P W Gray; R B Hallick
Journal:  Biochemistry       Date:  1979-05-01       Impact factor: 3.162

10.  Mapping adenines, guanines, and pyrimidines in RNA.

Authors:  H Donis-Keller; A M Maxam; W Gilbert
Journal:  Nucleic Acids Res       Date:  1977-08       Impact factor: 16.971
View more
  9 in total

1.  Primary and secondary structures of chloroplast 4.5S rRNAs from two ferns, Marsilia quadrifolia and Osmunda regalis.

Authors:  Y F Melekhovets; A V Troitsky
Journal:  Nucleic Acids Res       Date:  1990-09-25       Impact factor: 16.971

2.  Isolation, characterization, phosphorylation and site of synthesis of Spinacia chloroplast ribosomal proteins.

Authors:  M Posno; M van Noort; R Débise; G S Groot
Journal:  Curr Genet       Date:  1984-02       Impact factor: 3.886

3.  An intron in the 23S rRNA gene of the Chlorella chloroplasts: complete nucleotide sequence of the 23S rRNA gene.

Authors:  T Yamada; M Shimaji
Journal:  Curr Genet       Date:  1987       Impact factor: 3.886

Review 4.  Chloroplast ribosomes and protein synthesis.

Authors:  E H Harris; J E Boynton; N W Gillham
Journal:  Microbiol Rev       Date:  1994-12

5.  The nucleotide sequence of the 4.5S and 5S rRNA genes and flanking regions from Spirodela oligorhiza chloroplasts.

Authors:  R J Keus; D J Roovers; A F Dekker; G S Groot
Journal:  Nucleic Acids Res       Date:  1983-05-25       Impact factor: 16.971

6.  The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Authors:  F Takaiwa; M Sugiura
Journal:  Nucleic Acids Res       Date:  1982-09-11       Impact factor: 16.971

7.  Sequence and evolution of the regions between thr rrn operons in the chloroplast genome of Euglena gracilis bacillaris.

Authors:  M R El-Gewely; R B Helling; J G Dibbits
Journal:  Mol Gen Genet       Date:  1984

8.  Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

Authors:  I Kumagai; M Bartsch; A R Subramanian; V A Erdmann
Journal:  Nucleic Acids Res       Date:  1983-02-25       Impact factor: 16.971

9.  Next-Generation Genome Sequencing of Sedum plumbizincicola Sheds Light on the Structural Evolution of Plastid rRNA Operon and Phylogenetic Implications within Saxifragales.

Authors:  Hengwu Ding; Ran Zhu; Jinxiu Dong; Lan Jiang; Juhua Zeng; Qingyu Huang; Huan Liu; Wenzhong Xu; Longhua Wu; Xianzhao Kan
Journal:  Plants (Basel)       Date:  2019-09-29
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.