Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Literature DB >> 6815619

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Abstract

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.

Entities: Species

Mesh：

Substances：
RNA, Ribosomal

Year: 1982 PMID： 6815619 PMCID： PMC320878 DOI： 10.1093/nar/10.17.5369

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

12 in total

1. New rapid gel sequencing method for RNA.

Authors: A Simoncsits; G G Brownlee; R S Brown; J R Rubin; H Guilley
Journal: Nature Date: 1977-10-27 Impact factor: 49.962

2. Direct chemical method for sequencing RNA.

Authors: D A Peattie
Journal: Proc Natl Acad Sci U S A Date: 1979-04 Impact factor: 11.205

3. The nucleotide sequence of 5 S rRNA from the blue-green alga Anacystis nidulans.

Authors: M J Corry; P I Payne; T A Dyer
Journal: FEBS Lett Date: 1974-09-15 Impact factor: 4.124

4. Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences.

Authors: M Kimura; T Ohta
Journal: Nat New Biol Date: 1973-06-13

5. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms.

Authors: M Sugiura; M Takanami
Journal: Proc Natl Acad Sci U S A Date: 1967-10 Impact factor: 11.205

6. Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plants.

Authors: T A Dyer; C M Bowman
Journal: Biochem J Date: 1979-12-01 Impact factor: 3.857

7. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

Authors: H Hori; S Osawa
Journal: Proc Natl Acad Sci U S A Date: 1979-01 Impact factor: 11.205

8. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography.

Authors: M Sugiura; M Suzuki; E Ohtsuka; S Nishikawa; H Uemura; M Ikehara
Journal: FEBS Lett Date: 1979-01-01 Impact factor: 4.124

9. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts.

Authors: F Takaiwa; M Sugiura
Journal: Gene Date: 1980-07 Impact factor: 3.688

10. Mapping adenines, guanines, and pyrimidines in RNA.

Authors: H Donis-Keller; A M Maxam; W Gilbert
Journal: Nucleic Acids Res Date: 1977-08 Impact factor: 16.971

9 in total

1. Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

Authors: C C Somerville; S Jouannic; S Loiseaux-de Goër
Journal: J Mol Evol Date: 1992-03 Impact factor: 2.395

9. Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.

Authors: Y Yamano; K Ohyama; T Komano
Journal: Nucleic Acids Res Date: 1984-06-11 Impact factor: 16.971

9 in total

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

1. New rapid gel sequencing method for RNA.

2. Direct chemical method for sequencing RNA.

3. The nucleotide sequence of 5 S rRNA from the blue-green alga Anacystis nidulans.

4. Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences.

5. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms.

6. Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plants.

7. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

8. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography.

9. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts.

10. Mapping adenines, guanines, and pyrimidines in RNA.

1. Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

2. Nucleotide sequence of the 17S-25S spacer region from rice rDNA.

3. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

Review 4. Chloroplast ribosomes and protein synthesis.

5. The nucleotide sequence of the 4.5S and 5S rRNA genes and flanking regions from Spirodela oligorhiza chloroplasts.

6. Collection of published 5S and 5.8S ribosomal RNA sequences.

7. Collection of published 5S and 5.8S ribosomal RNA sequences.

8. The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

9. Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.