Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

Literature DB >> 7145715

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

Abstract

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Entities: Species

Mesh：

Substances：
RNA, Ribosomal

Year: 1982 PMID： 7145715 PMCID： PMC320948 DOI： 10.1093/nar/10.19.6037

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

8 in total

1. Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences.

Authors: M Kimura; T Ohta
Journal: Nat New Biol Date: 1973-06-13

2. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms.

Authors: M Sugiura; M Takanami
Journal: Proc Natl Acad Sci U S A Date: 1967-10 Impact factor: 11.205

3. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

Authors: H Hori; S Osawa
Journal: Proc Natl Acad Sci U S A Date: 1979-01 Impact factor: 11.205

4. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

Authors: H Hori; S Osawa; M Iwabuchi
Journal: Nucleic Acids Res Date: 1980-12-11 Impact factor: 16.971

5. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography.

Authors: M Sugiura; M Suzuki; E Ohtsuka; S Nishikawa; H Uemura; M Ikehara
Journal: FEBS Lett Date: 1979-01-01 Impact factor: 4.124

Review 6. Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors: V A Erdmann
Journal: Nucleic Acids Res Date: 1982-01-22 Impact factor: 16.971

7. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts.

Authors: F Takaiwa; M Sugiura
Journal: Gene Date: 1980-07 Impact factor: 3.688

8. The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

Authors: N Delihas; J Andersen; W Andresini; L Kaufman; H Lyman
Journal: Nucleic Acids Res Date: 1981-12-11 Impact factor: 16.971

8 in total

1. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

Authors: V A Erdmann; J Wolters; E Huysmans; R De Wachter
Journal: Nucleic Acids Res Date: 1985 Impact factor: 16.971

2. The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria.

Authors: H Van den Eynde; R De Baere; E De Roeck; Y Van de Peer; A Vandenberghe; P Willekens; R De Wachter
Journal: J Mol Evol Date: 1988 Impact factor: 2.395

8. The nucleotide sequences of 5S rRNAs from a multicellular green alga, Ulva pertusa, and two brown algae, Eisenia bicyclis and Sargassum fulvellum.

Authors: B L Lim; H Hori; S Osawa
Journal: Nucleic Acids Res Date: 1983-03-25 Impact factor: 16.971

8 in total

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

1. Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences.

2. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms.

3. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

4. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

5. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography.

Review 6. Collection of published 5S and 5.8S RNA sequences and their precursors.

7. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts.

8. The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

1. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

2. The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria.

3. Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria.

4. Collection of published 5S and 5.8S ribosomal RNA sequences.

5. Collection of published 5S and 5.8S ribosomal RNA sequences.

6. The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.

7. Isotopic relationships between saponifiable lipids and cellulose nitrate prepared from red, brown and green algae.

8. The nucleotide sequences of 5S rRNAs from a multicellular green alga, Ulva pertusa, and two brown algae, Eisenia bicyclis and Sargassum fulvellum.