A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.