Literature DB >> 6171775

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8.

I Kumagai, M Digweed, V A Erdmann, K Watanabe, T Oshima.   

Abstract

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Entities:  

Mesh：

Substances：

Year:  1981        PMID： 6171775      PMCID： PMC327506          DOI： 10.1093/nar/9.19.5159

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  14 in total

1.  A micromethod for base analysis of 32P-labeled oligoribonulcleotides.

Authors:  G Volckaert; W Fiers
Journal:  Anal Biochem       Date:  1977-11       Impact factor: 3.365

2.  Rapid print-readout technique for sequencing of RNA's containing modified nucleotides.

Authors:  R C Gupta; K Randerath
Journal:  Nucleic Acids Res       Date:  1979-08-10       Impact factor: 16.971

3.  Structure and function of 5S RNA: the role of the 3' terminus in 5S RNA function.

Authors:  V A Erdmann; H G Doberer
Journal:  Mol Gen Genet       Date:  1972

4.  Thermal stability of ribosomes and RNA from Thermus aquaticus.

Authors:  J G Zeikus; M W Taylor; T D Brock
Journal:  Biochim Biophys Acta       Date:  1970-04-15

5.  5S RNA secondary structure.

Authors:  G E Fox; C R Woese
Journal:  Nature       Date:  1975-08-07       Impact factor: 49.962

6.  3'-terminal labelling of RNA with T4 RNA ligase.

Authors:  T E England; O C Uhlenbeck
Journal:  Nature       Date:  1978-10-12       Impact factor: 49.962

7.  The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Authors:  H Hori; S Osawa; K Murao; H Ishikura
Journal:  Nucleic Acids Res       Date:  1980-11-25       Impact factor: 16.971

Review 8.  Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors:  V A Erdmann
Journal:  Nucleic Acids Res       Date:  1981-01-10       Impact factor: 16.971

9.  Nucleotide sequence of Thermus aquaticus ribosomal 5 S ribonucleic acid. Sequence homologies in thermophilic organisms.

Authors:  R N Nazar; A T Matheson
Journal:  J Biol Chem       Date:  1977-06-25       Impact factor: 5.157

10.  An enhanced thermostability in thermophilic 5-S ribonucleic acids under physiological salt conditions.

Authors:  R N Nazar; G D Sprott; A T Matheson; N T Van
Journal:  Biochim Biophys Acta       Date:  1978-11-21
View more
  9 in total

1.  Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

Authors:  V A Erdmann; J Wolters; E Huysmans; R De Wachter
Journal:  Nucleic Acids Res       Date:  1985       Impact factor: 16.971

Review 2.  Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors:  V A Erdmann
Journal:  Nucleic Acids Res       Date:  1982-01-22       Impact factor: 16.971

3.  The number of ribosomal RNA genes in Thermus thermophilus HB8.

Authors:  N Ulbrich; I Kumagai; V A Erdmann
Journal:  Nucleic Acids Res       Date:  1984-02-24       Impact factor: 16.971

4.  Collection of published 5S and 5.8S ribosomal RNA sequences.

Authors:  V A Erdmann; J Wolters; E Huysmans; A Vandenberghe; R De Wachter
Journal:  Nucleic Acids Res       Date:  1984       Impact factor: 16.971

5.  Nucleotide sequence and thermal property of 5S rRNA from the elder aphid. Acyrthosiphon magnoliae.

Authors:  Y Kawata; H Ishikawa
Journal:  Nucleic Acids Res       Date:  1982-03-25       Impact factor: 16.971

6.  Consensus structure and evolution of 5S rRNA.

Authors:  H Küntzel; B Piechulla; U Hahn
Journal:  Nucleic Acids Res       Date:  1983-02-11       Impact factor: 16.971

7.  Collection of published 5S and 5.8S ribosomal RNA sequences.

Authors:  V A Erdmann; E Huysmans; A Vandenberghe; R De Wachter
Journal:  Nucleic Acids Res       Date:  1983-01-11       Impact factor: 16.971

8.  Generalized structures of the 5S ribosomal RNAs.

Authors:  N Delihas; J Andersen
Journal:  Nucleic Acids Res       Date:  1982-11-25       Impact factor: 16.971

9.  Terminal heterogeneity and corrections of the nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8.

Authors:  H Komiya; M Kawakami; S Takemura; I Kumagai; V A Erdmann
Journal:  Nucleic Acids Res       Date:  1983-02-25       Impact factor: 16.971
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.