| Literature DB >> 566163 |
Abstract
The primary sequence of the principal spacer region in X. laevis oocyte 5S DNA has been determined. The spacer is AT-rich and comprises half or more of each repeating unit. The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T). The spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (A2) which is variable in length in different repeating units, flanked by regions (A1, A3, B1) which are relatively constant in length. The A2 region consists, on the average, of 5-6 tandem copies of the oligonucleotide CAAAGTTTGAGTTTT; variation in the redundancy of this oligonucleotide accounts for much of the repeat length variation in the genomic 5S DNA. Most copies of this oligonucleotide are identical, although several differing by 1 or 2 nucleotides have been detected in plasmid-cloned 5S DNA fragments. Regions A1 and A3 comprise a linear array of similar, but not identical, oligonucleotides; most repeating units contain very similar A1 and A3 sequences. Region B1 is a sequence of 49 nucleotides immediately adjacent to the 5' terminus of the 5S rRNA sequence. It is GC-rich, much less repetitive than the remainder of the spacer and contains several palindromes, but no regions of dyad symmetry. This sequence is identical in all six of the single cloned repeating units of 5S DNA analyzed.Entities:
Mesh:
Substances:
Year: 1978 PMID: 566163 DOI: 10.1016/0092-8674(78)90220-9
Source DB: PubMed Journal: Cell ISSN: 0092-8674 Impact factor: 41.582