Literature DB >> 36267307

miR-18a-5p and ATM Expression in Esophageal Squamous Cell Carcinoma and Their Correlations with Clinicopathological Features.

Jinyou Qi1, Wei Fan1.   

Abstract

Objective: To investigate miR-18a-5p and ataxia telangiectasia muted (ATM) expression in esophageal squamous cell carcinoma (ESCC) and their correlations with clinicopathological features.
Methods: The subjects of this study were 62 ESCC patients (research group, RG) and 57 healthy controls (control group, CG) presented to our hospital between July 2019 and April 2020. Peripheral blood (PB) miR-18a-5p and ATM levels in these participants were quantified via qRT-PCR, and the correlations of the two genes with ESCC patients' clinicopathological characteristics were investigated. In addition, a two-year follow-up was performed on ESCC patients to understand their survival, so as to further determine the prognostic utility of miR-18a-5p and ATM in ESCC. Factors influencing patient outcomes were identified by COX analysis.
Results: PB miR-18a-5p expression was higher in RG compared with CG, while ATM was lower, suggesting an inverse connection between the two genes in ESCC (P < 0.001). miR-18a-5p and ATM levels were determined to be strongly linked to TNM stage, differentiation degree, and lymph node metastasis in ESCC patients (P < 0.001 and P = 0.007). The patients who succumbed to the disease exhibited higher miR-18a-5p and lower ATM than the survival (P < 0.05). ROC analysis suggested favorable evaluation effects of miR-18a-5p and ATM on the occurrence and prognostic death of ESCC (P < 0.001). Further, these two genes were identified by the COX analysis to be factors independently affecting the prognosis of ESCC.
Conclusion: miR-18a-5p is highly expressed in ESCC, and ATM is underexpressed, both of which are closely linked to the pathological process of ESCC and have a good evaluation effect on the occurrence and prognosis of ESCC, which may become a breakthrough in future diagnosis and treatment of ESCC.
Copyright © 2022 Jinyou Qi and Wei Fan.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36267307      PMCID: PMC9578886          DOI: 10.1155/2022/5260608

Source DB:  PubMed          Journal:  Comput Math Methods Med        ISSN: 1748-670X            Impact factor:   2.809


1. Introduction

Esophageal cancer (EC) is a malignancy derived from esophageal epithelium with a very high prevalence worldwide, threatening the life safety of patients [1]. According to statistics, EC ranks sixth in the incidence of all malignant tumors and about fourth in the mortality rate [2]. More than 3 million new EC cases have been diagnosed globally every year as a consequence of changes in people's eating habits in recent years. It is estimated that by 2030, EC will also become a malignancy with the incidence second only to gastric and lung cancers, which will bring greater burden and pressure to clinical practice [3]. Esophageal squamous cell carcinoma (ESCC), the most common type of EC, accounts for more than 60% of all EC cases [4]. At present, there are a variety of treatment methods including surgery, radiotherapy, chemotherapy, and esophageal stent placement. Patients with early ESCC can be cured by radical surgery, but many patients are in the middle and late stage when they go to hospital, so they lose the chance of radical surgery [5]. Clinically, it is believed that a thorough understanding of the pathogenesis of ESCC is the key to finding a breakthrough in its diagnosis and treatment, but no significant breakthrough and progress has been made yet. The etiology of ESCC is relatively complex, which is clinically believed to be related to nitrosamines, long-term smoking and drinking, unhealthy eating habits, etc. [6]. In recent years, more attention has been paid to the molecular pathogenesis of ESCC. Among them, RNA substances represented by microRNAs have been proved by more and more studies to be closely linked to the carcinogenesis and development of tumors [7-9]. microRNAs are a class of about 22-nucleotide length long noncoding single-stranded RNA molecules encoded by endogenous genes, which participate in posttranscriptional gene expression regulation in animals and plants, thereby affecting the development of diseases [10]. Because of this, microRNAs are being hailed as the key to future cancer treatments. In ESCC, multiple microRNAs have been found to play important roles. For example, miR-126 promotes ESCC progression through inhibiting autophagy, and miR-4306 inhibits ESCC cell proliferation via SIX3 [11, 12]. As an important member of microRNA family, miR-18a-5p takes part in the progression of various cancers, such as head and neck squamous cell carcinoma, endometrial cancer, and hepatocellular carcinoma [13-15]. We found through previous studies that miR-18a-5p presented aberrant expression in the tumor microenvironment of ESCC as early as 2013, while subsequent related studies were rare. Up to now, only Zhao et al. have preliminarily analyzed the role played by miR-18a-5p in ESCC [16]. Ataxia-telangiectasia mutated (ATM) is the product of the gene mutated in the human genetic disorder ataxia-telangiectasia (A-T). ATM is a 370 kDa protein that belongs to the phosphatidylinositol 3-kinases superfamily [17]. It has been reported that ATM is a risk factor for breast cancer [18]. Furthermore, during data collection, ataxia telangiectasia mutated (ATM), as one of the potential downstream target proteins of miR-18a-5p, was found to be closely related to the radiosensitivity of ESCC, but its specific clinical expression in ESCC remains elusive. It has been nearly 10 years since the study of miR-18a-5p in ESCC by Zhu et al. [19]. In order to further clarify the clinical implications of miR-18a-5p and ATM in ESCC and provide more accurate reference and guidance for clinical practice, this study analyzes the expression of miR-18a-5p and ATM in ESCC and their correlation to prognosis of ESCC patients.

2. Materials and Methods

2.1. Patient Data

A prospective nonrandomized controlled trial was conducted on 62 ESCC patients (research group, RG) and 57 healthy controls (control group, CG) who visited our hospital between July 2019 and April 2020. This study was approved by Ethical committee of Huai'an Tumor Hospital and strictly followed the Helsinki Declaration, and all research subjects were informed and signed the informed consent form.

2.2. Eligibility Criteria

RG: patients were included based on the following criteria: patients enrolled all presented clinical symptoms that were in line with the EC Diagnostic Guide [20] and received follow-up treatment in our hospital after conformed diagnosis of ESCC through pathological biopsy, with complete medical records, high degree of cooperation with the medical staff, and no chemoradiotherapy. Cases were excluded if they had other tumors, organ dysfunction, mental illness, infectious diseases, cardio-cerebrovascular diseases, physical disabilities, long-term bedridden, or antitumor therapy or live vaccine was administered within 4 weeks before study enrollment. Hospital referrals and loss to follow-ups were also excluded. CG: healthy controls who underwent physical examinations in our hospital with normal examination results and no major medical history were included.

2.3. Sample Collection

Fasting venous blood specimens were collected from RG and CG in the early morning. After leaving the specimens at room temperature for 30 min and centrifuged (1500 r/min) for 10 min, the serum was obtained and refrigerated at -80°C until analysis.

2.4. Real-Time Quantitative Fluorescence- (qRT-) PCR

TRIzol (Invitrogen, TRIzol™ LS Reagent, USA) extracted total RNA from serum, and after verifying the purity, the total RNA was reverse transcribed into cDNA according to the PrimeScriptTM RT reagent Kit (TaKaRa, Japan) instructions, for amplification reaction (TB Green® Fast qPCR Mix, TaKaRa, Japan). The design and construction of primer sequences were entrusted to Hunan Pulazete Biotech (as shown in Table 1). Reaction conditions (40 cycles) were 95°C, 5 min; 95°C, 15 s; 60°C, 34 s. 2- calculated the relative expression of miR-18a-5p and ATM normalized against U6 and β-actin, respectively.
Table 1

Primer sequences.

F (5′-3′)R (5′-3′)
miR-18a-5pACGTAAGGTGCATCTAGTGCAGATAGTGCAGGGTCCGAGGT
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
ATMGTTGCCAAGGTAGCTCAGTCTCTGGCTCCCCTATACTTCTGTAG
β-ActinGCGAGCACAGAGCCTCGCCTTCATCATCCATGGTGAGCTGGCGG

2.5. Follow-Up

ESCC patients were followed up for 2 years via hospital review. The follow-up interval was no more than 2 months, and the end event was death. The 2-year survival of ESCC patients was calculated, and the survival curve was drawn.

2.6. Outcome Measures

miR-18a-5p and ATM expression in ESCC, their correlations with ESCC patients' clinicopathological features, and their diagnostic and prognostic significance in ESCC were discussed.

2.7. Statistics and Methods

Data analysis was made by SPSS24.0 software, and the analysis results with P < 0.05 were considered statistically significant. A Chi-square test was utilized for comparisons of count data (denoted by %). Measurement data are recorded in the form of (), and independent sample t test was used for comparisons between groups. ROC analyzed diagnostic value and Pearson correlation coefficients were responsible for correlation analyses. The Kaplan-Meier method and Log-rank test were adopted to calculate and compare patient survival, respectively. The prognostic factors were analyzed by COX.

3. Results

3.1. Comparison of Clinical Baseline Data

Age, BMI, sex composition, smoking and drinking habits, and other baseline data differed insignificantly between RG and CG (P > 0.05, Table 2), indicating that the two groups are comparable.
Table 2

Comparison of clinical baseline data.

BMI (kg/m2)AgeSex male/femaleSmoking yes/noDrinking yes/noExercise habits yes/noFamily history of disease yes/no
Research group (n = 62)24.44 ± 4.1963.37 ± 4.9539/2334/2830/3216/468/54
Control group (n = 57)25.08 ± 4.5164.61 ± 6.3533/2430/2730/2718/395/52
t (χ2)0.8001.1810.3120.0580.2140.4850.521
P 0.4250.2400.5770.8090.6440.4860.471

3.2. Comparison miR-18a-5p and ATM Expression

The peripheral blood (PB) miR-18a-5p expression in RG was (3.04 ± 0.46) and that of CG was (2.40 ± 0.58); the intergroup comparison revealed higher miR-18a-5p expression in RG compared with CG (P < 0.05, Figure 1(a)). In terms of PB ATM mRNA expression, it was (2.11 ± 0.42) in RG and (2.60 ± 0.58) in CG; the data revealed lower ATM expression in RG as compared to CG (P < 0.05, Figure 1(b)). According to the Pearson correlation coefficient, miR-18a-5p and ATM were negatively correlated in PB of patients in RG (r = −0.6801, P < 0.001, Figure 1(c)).
Figure 1

Comparison miR-18a-5p and ATM expression. (a) Comparison of expression levels of miR-18a-5p. (b) Comparison of expression levels of ATM mRNA. (c) Correlation between the expression levels of miR-18a-5p and ATM. Note: ∗P < 0.05.

3.3. Diagnostic Effects of miR-18a-5p and ATM on ESCC

ROC analysis showed that the sensitivity and specificity of PB miR-18a-5p for the diagnosis of ESCC were 80.65% and 71.93%, respectively, when PB miR-18a-5p detected by PCR was >2.63 (AUC = 0.8015, 95%CI = 0.7203 − 0.8827, P < 0.001, Figure 2(a)). And when PB ATM mRNA determined by PCR was <2.26, the sensitivity and specificity for diagnosing ESCC were 67.14% and 70.18%, respectively (AUC = 0.7480, 95%CI = 0.6597 − 0.8363, P < 0.001, Figure 2(b)).
Figure 2

Diagnostic effects of miR-18a-5p and ATM on ESCC. (a) ROC analysis of the diagnostic value of miR-18a-5p for ESCC. (b) ROC analysis of the diagnostic value of ATM for ESCC.

3.4. Correlations of miR-18a-5p and ATM with Clinicopathological Features of ESCC

miR-18a-5p and ATM levels differed insignificantly among patients with different ages, BMI values, sexes, smoking and drinking habits, exercise habits, and family history of disease (with/without) (P > 0.05). However, in patients with TNM stage III-IV, low differentiation, and lymph node metastasis, miR-18a-5p was increased while ATM was decreased (P < 0.001 and P = 0.007, Table 3). Thus, miR-18a-5p and ATM are closely related to TNM stage, differentiation degree, and lymph node metastasis of ESCC.
Table 3

Correlations of miR-18a-5p and ATM with clinicopathological features of ESCC.

n miR-18a-5p F/PATM mRNA F/P
BMI (kg/m2)1.027/0.3091.719/0.091
 <25322.98 ± 0.462.20 ± 0.44
 ≥25303.10 ± 0.462.02 ± 0.38
Age1.297/0.2000.094/0.925
 <64303.11 ± 0.452.11 ± 0.39
 ≥64322.96 ± 0.462.12 ± 0.44
Sex0.411/0.6821.002/0.320
 Male393.02 ± 0.482.16 ± 0.41
 Female233.07 ± 0.432.05 ± 0.43
Smoking0.677/0.5010.093/0.927
 Yes343.07 ± 0.412.12 ± 0.39
 No282.99 ± 0.522.11 ± 0.46
Drinking0.419/0.6770.647/0.520
 Yes303.06 ± 0.492.09 ± 0.41
 No323.01 ± 0.452.16 ± 0.44
Exercise habits0.521/0.6041.162/0.250
 Yes163.09 ± 0.372.01 ± 0.33
 No463.02 ± 0.492.15 ± 0.44
Family history of disease0.113/0.9110.313/0.755
 Yes83.02 ± 0.362.07 ± 0.35
 No543.04 ± 0.482.12 ± 0.43
TNM staging4.768/<0.0013.755/<0.001
 I-II422.87 ± 0.422.24 ± 0.43
 III-IV203.38 ± 0.331.85 ± 0.25
Lymph node metastasis4.795/<0.0013.792/<0.001
 Yes452.89 ± 0.432.23 ± 0.43
 No173.43 ± 0.281.82 ± 0.18
Degree of differentiation3.303/0.0022.803/0.007
 Medium/high differentiation482.94 ± 0.452.19 ± 0.43
 Low differentiation143.37 ± 0.341.85 ± 0.26

Note: age and BMI are bounded by the median.

3.5. Correlations of miR-18a-5p and ATM with Prognosis of ESCC

The 2-year overall mortality in RG was 29.03%, with 18 deaths during the follow-up. And compared with the surviving patients, miR-18a-5p was higher in the dead (P < 0.05, Figure 3(a)), and ATM was lower (P < 0.05, Figure 3(b)).
Figure 3

Correlations of miR-18a-5p and ATM with prognosis of ESCC. (a) Comparison of miR-18a-5p expression between the dead patients and the survival. (b) Comparison of ATM expression between the dead patients and the survival. Note: ∗P < 0.05.

3.6. Value of miR-18a-5p and ATM in Evaluating the Prognosis of ESCC

Similarly, ROC analysis showed that when PB miR-18a-5p was >3.13 after treatment, the sensitivity and specificity for predicting the 2-year mortality of patients were 77.78% and 70.45%, respectively (AUC = 0.8150, 95%CI = 0.7047 − 0.9253, P < 0.001, Figure 4(a)). And the sensitivity and specificity of ATM for predicting the 2-year mortality of ESCC patients were 66.67% and 79.55%, respectively, when PB ATM < 1.87 (AUC = 0.7292, 95%CI = 0.5886 − 0.8698, P < 0.001, Figure 4(b)). Then, taking the cut-off value as the boundary, we divided patients into high (miR − 18a − 5p > 3.13, n = 27)/low miR-18a-5p expression groups (miR − 18a − 5p ≤ 3.13, n = 35) and high (ATM ≥ 1.87, n = 41)/low ATM expression groups (ATM < 1.87, n = 21). Observing the prognostic survival curve, we found that the prognostic mortality of high miR-18a-5p expression group was significantly higher compared with the low expression group (P < 0.001, Figure 4(c)), while that of the ATM high expression group was lower compared with the low expression group (P < 0.001, Figure 4(d)).
Figure 4

Value of miR-18a-5p and ATM in evaluating the prognosis of ESCC. (a) ROC analysis of the diagnostic value of miR-18a-5p for prognostic death in ESCC. (b) ROC analysis of the diagnostic value of ATM for prognostic death in ESCC. (c) The 2-year survival curve of high/low miR-18a-5p expression groups. (d) The 2-year survival curve of high/low ATM expression groups.

3.7. COX Analysis of Prognosis of ESCC

Through COX analysis of prognostic dead and surviving patients, we found that TNM stage, degree of differentiation, lymph node metastasis, miR-18a-5p, and ATM were all independent factors affecting ESCC patients' outcomes (P < 0.001, Table 4).
Table 4

COX analysis of prognosis of ESCC.

Univariate analysisMultivariate analysis
OR95% CI P OR95% CI P
BMI (kg/m2)1.3420.142-2.6640.224
Age1.5621.114-2.2410.0090.1640.084-2.8410.641
Sex0.6720.411-1.9420.094
Smoking0.8410.424-12.6140.642
Drinking1.4120.642-3.8100.516
Exercise habits0.4620.264-5.8400.733
Family history of disease1.6140.712-2.6620.0181.1240.841-5.6230.094
TNM staging1.3420.642-2.811<0.0011.6220.841-2.613<0.001
Lymph node metastasis1.8401.064-3.662<0.0011.2840.806-3.064<0.001
Degree of differentiation1.1940.722-1.942<0.0011.3840.762-3.773<0.001
miR-18a-5p1.4260.792-3.627<0.0011.2810.762-2.813<0.001
ATM0.7460.224-1.620<0.0010.8610.554-1.637<0.001

4. Discussion

In recent years, the morbidity and mortality of ESCC are getting higher and higher, which deserves sufficient attention from clinicians and patients [21]. In clinical practice, radical surgery can achieve ideal results for early ESCC. However, because of its high early concealment, no special clinical symptoms, and high limitations of early clinical screening conditions, most patients have developed to the middle and late stage when they are diagnosed [22]. For advanced ESCC, combined chemoradiotherapy is usually required to shrink the tumor lesions [23]. However, the prognosis of patients with advanced ESCC is not ideal due to multiple factors such as deep tumor infiltration, chemotherapy resistance, and toxic side effects [24]. This is also the main limitation of clinical diagnosis. Therefore, two feasible ways to reduce the threat of ESCC are proposed in clinical practice, namely, improving the early detection rate of ESCC and optimizing its treatment effect [25]. In recent years, microRNAs have been continuously proved to be a key to future tumor diagnosis and treatment, with great clinical research value [26-28]. Among them, miR-18a-5p has been confirmed to interfere with the onset and progression of liver and colorectal cancers [15, 29], while ATM is closely related to lung and breast carcinomas [30, 31]. Although some studies have preliminarily shown the expression of the two genes in ESCC, they were reported too long ago with great limitations and low clinical reference value [19, 32]. Therefore, by analyzing miR-18a-5p and ATM expression in ESCC patients, this study has huge clinical implications for the future clinical diagnosis, treatment, and follow-up research of ESCC. Our experimental results determined highly expressed miR-18a-5p and underexpressed ATM in ESCC, which was also consistent with the results of previous studies [31, 33] about that miR-18a-5p is upregulated in ESCC and ATM is downregulated in breast invasive carcinoma, further supporting our experimental results. Furthermore, ROC analysis showed relatively excellent effects of the two in the diagnosis of ESCC, which preliminarily indicates that they have the potential to become evaluation markers of ESCC. At present, the detection of tumor markers (CEA, CA125, etc.) remains the major method for the early diagnosis of ESCC and other tumors in clinic, which has the disadvantage of low diagnostic specificity [34]. However, some evidence has also indicated abnormally increased tumor markers caused by inflammatory lesions [35], further reducing the evaluation value of tumor markers for ESCC. And although imaging examination can accurately evaluate the development of ESCC, this method is limited by its high examination conditions that are not conducive to large-scale clinical screening [36]. The analysis of miR-18a-5p and ATM, on the other hand, could make up for the lack of diagnostic specificity of tumor markers and allow for a large-scale clinical screening through the detection of blood samples, which may be of great significance for improving the early diagnosis rate of ESCC in the future. Besides, we determined a close connection between miR-18a-5p, ATM, and clinicopathological features of ESCC, such as TNM stage, lymph node metastasis, and differentiation degree, which verified our above viewpoint and showed that miR-18a-5p and ATM were closely related to ESCC. Finally, through prognostic follow-up, we observed elevated miR-18a-5p and reduced ATM in patients with prognostic death, with excellent evaluation results for the prognosis of ESCC patients, indicating their important evaluation value for the development of ESCC. And through the prognostic survival curve, we could see that the increase of miR-18a-5p and the decrease of ATM after treatment both predict an increased risk of prognostic death of patients, which was further verified by the subsequent COX analysis of the prognosis of patients, demonstrating the close relationship between miR-18a-5p, ATM, and the development of ESCC. TNM staging and lymph node metastasis, as the basis for the pathological development of tumor diseases, can naturally be expected to be related to the prognosis of ESCC [37, 38], so this article will not go into details. The above results also suggested that miR-18a-5p and ATM may also be potential therapeutic targets for ESCC. In the future, targeted therapy by inhibiting miR-18a-5p or activating ATM may provide a more reliable guarantee for the prognosis of patients. Of course, more experiments are needed to confirm this. However, in the study of Wu et al. [39], we find that miR-18a-5p is lowly expressed in doxorubicin-resistant human leukemia strain K562/ADR, which is different from our findings. This also suggests that miR-18a-5p may play different biological effects in different diseases, so we need to analyze the specific mechanism of miR-18a-5p and ATM in ESCC as soon as possible. Limited by the experimental conditions and small number of cases included, the ROC analysis results need to be further confirmed by expanding the sample size. Furthermore, we need to carefully group the patients according to their illness degree, so as to confirm the role of miR-18a-5p and ATM in evaluating early ESCC. Moreover, the subjects of this study should be followed up for a longer time to evaluate the long-term prognostic effect of miR-18a-5p and ATM on ESCC. Bearing in mind the above shortcomings, we will conduct a more in-depth and comprehensive experimental analysis on the role of miR-18a-5p and ATM in ESCC, so as to provide more reliable reference opinions for clinical practice.

5. Conclusion

miR-18a-5p is highly expressed in ESCC, and ATM is underexpressed, both of which are closely linked to the pathological process of ESCC and have a good evaluation effect on the occurrence and prognosis of ESCC, which may become a breakthrough in future diagnosis and treatment of ESCC.
  39 in total

1.  In Silico-Analysis of the Multi-Omics Data Identified the Ataxia Telangiectasia Mutated Gene as a Potential Biomarker of Breast Invasive Carcinoma.

Authors:  Uzma Karamat; Samina Ejaz; Yasir Hameed
Journal:  Genet Test Mol Biomarkers       Date:  2021-04

Review 2.  An overview of microRNAs: Biology, functions, therapeutics, and analysis methods.

Authors:  Kioomars Saliminejad; Hamid Reza Khorram Khorshid; Shahrzad Soleymani Fard; Seyed Hamidollah Ghaffari
Journal:  J Cell Physiol       Date:  2018-11-23       Impact factor: 6.384

Review 3.  ATM: the product of the gene mutated in ataxia-telangiectasia.

Authors:  M F Lavin
Journal:  Int J Biochem Cell Biol       Date:  1999-07       Impact factor: 5.085

4.  Expression of miR-18a-5p, miR-144-3p, and miR-663b in colorectal cancer and their association with cholesterol homeostasis.

Authors:  Bhoomika Sharma; Vinay Randhawa; Kim Vaiphei; Vikas Gupta; Divya Dahiya; Navneet Agnihotri
Journal:  J Steroid Biochem Mol Biol       Date:  2021-01-16       Impact factor: 4.292

Review 5.  Statins as Potential Therapeutics for Esophageal Cancer.

Authors:  Ali Fatehi Hassanabad; Jonathan V S Wong
Journal:  J Gastrointest Cancer       Date:  2021-05-31

6.  Diagnostic and prognostic value of CEA, CA19-9, AFP and CA125 for early gastric cancer.

Authors:  Fan Feng; Yangzi Tian; Guanghui Xu; Zhen Liu; Shushang Liu; Gaozan Zheng; Man Guo; Xiao Lian; Daiming Fan; Hongwei Zhang
Journal:  BMC Cancer       Date:  2017-11-09       Impact factor: 4.430

7.  Association of Tumor Protein p53 and Ataxia-Telangiectasia Mutated Comutation With Response to Immune Checkpoint Inhibitors and Mortality in Patients With Non-Small Cell Lung Cancer.

Authors:  Yu Chen; Gang Chen; Jin Li; Ying-Ying Huang; Yi Li; Jing Lin; Li-Zhu Chen; Jian-Ping Lu; Yu-Qi Wang; Chang-Xi Wang; Leong Kin Pan; Xue-Feng Xia; Xin Yi; Chuan-Ben Chen; Xiong-Wei Zheng; Zeng-Qing Guo; Jian-Ji Pan
Journal:  JAMA Netw Open       Date:  2019-09-04

8.  Is the tumour microenvironment a critical prognostic factor in early-stage colorectal cancer?

Authors:  G Nyamundanda; E Fontana; A Sadanandam
Journal:  Ann Oncol       Date:  2019-10-01       Impact factor: 32.976

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.