| Literature DB >> 36225588 |
Lingfei Li1, Xiaoli Si2, Jie Ruan3, Zhumei Ni4, Xiaoqin Li4, Hongfei Sang1, Wenqing Xia1, Jinyu Huang5, Keqin Liu1, Shan Lu6, Lin Jiang1, Anwen Shao7,8, Congguo Yin1.
Abstract
Background: Intracranial atherosclerotic stenosis (ICAS) is a common cause of first and recurrent ischemic stroke worldwide. Circular RNAs (circRNA)s have been recently suggested as candidate biomarkers in diagnosing and prognosis of ischemic stroke. A few circRNAs even serve as therapeutic targets that improves neurological function after ischemic stroke. However, the roles of circRNAs in ICAS caused ischemic stroke (ICAS-stroke) have not been fully understood. Therefore, in this study, we attempted to find some clues by investigating the different expression profiles of circRNAs between patients diagnosed with ICAS-stroke and normal control (NC)s.Entities:
Keywords: atherosclerotic stroke; biomarker; circRNA-miRNA-mRNA network; circular RNA; intracranial atherosclerotic stenosis; therapeutic targets
Year: 2022 PMID: 36225588 PMCID: PMC9549117 DOI: 10.3389/fphar.2022.961866
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
List of primers for qPCR validation of the microarray results.
| Target RNA | Primer sequence (5–3′) |
|---|---|
| hsa_circ_0003574 | CCTCACAGAGATGGAGCGTA |
| hsa_circ_0003574 | TTCTCCGCTGCTTCCTTAAA |
| hsa_circ_0010509 | CCATCAACTGGTTGCCTTTT |
| hsa_circ_0010509 | CTGTCGGTGGTGTTGATGAG |
| hsa_circ_0026628 | GGAAGTGGAGGCAACATCAT |
| hsa_circ_0026628 | TGAGAGCTGGGAGTCAAGGT |
| hsa_circ_0074057 | TGCCATTTGTGTTTCAGCTC |
| hsa_circ_0074057 | TCGTGTGGCAGACAGAACTC |
| hsa_circ_0016993 | ATCAGTGGGCCTGAAACATC |
| hsa_circ_0016993 | GGGCCTTCTTTCTGATTTCC |
FIGURE 1Hsa_circ_0003574 was upregulated in patients with ICAS-stroke compared with NC. (A) The flowchart illustrates the two-stage approach involving two independent cohorts for discovery and validation. (B) Compared with NCs, the top 20 upregulated and 21 downregulated circRNAs in ICAS-stroke patients. HeatMap and hierarchical clustering of the circRNA expression profile of five ICAS-stroke patients and NCs. (C) Volcano plot of differentially expressed, with 171 downregulated circRNAs (blue points) and 73 upregulated circRNAs (red points). (D) Expression of selected circRNAs among ICAS-stroke patients and NCs. Significant difference among the expression levels is denoted as *p < 0.05.
Demographic characteristics of ICAS-stroke patients and NCs among the discovery cohort.
| Parameters | ICAS-stroke | NCs |
|---|---|---|
| Sex, male (no, %) | 4 (80.0) | 5 (100.0) |
| Age (years) | 59.40 ± 8.08 | 59.80 ± 10.21 |
| Smoking (no, %) | 2 (40.0) | 1 (20.0) |
| Hypertension (no, %) | 5 (100.0)* | 1 (20.0) |
| GLU (mmol/L) | 6.46 ± 2.31 | 5.04 ± 0.55 |
| SUA (mmol/L) | 294.20 ± 64.25 | 339.20 ± 106.27 |
| TC (mmol/L) | 3.72 ± 0.65 | 4.09 ± 0.39 |
| TG (mmol/L) | 1.26 ± 0.57 | 0.97 ± 0.31 |
| HDL (mmol/L) | 1.10 ± 0.10 | 1.12 ± 0.29 |
| LDL (mmol/L) | 2.03 ± 0.51 | 2.40 ± 0.34 |
| HCY (mmol/L) | 12.84 ± 2.33 | 16.28 ± 3.48 |
| GHB | 6.46 ± 1.46 | 5.60 ± 0.45 |
ICAS-stroke, ischemic stroke caused by intracranial atherosclerotic stenosis; SD, standard deviation; no, number; GLU, blood glucose; SUA, serum uric acid; TC, total cholesterol; TG, triglyceride; HDL, high-density lipoprotein; LDL, low-density lipoprotein; HCY, homocysteine; GHB, Glycosylated hemoglobin. The data were represented as mean ± standard deviation. *p < 0.05
Demographic characteristics of ICAS-stroke patients and NCs in the validation cohort.
| Parameters | ICAS-stroke ( | NCs ( |
|---|---|---|
| Sex, male (no, %) | 34 (69.4) | 20 (60.6) |
| Age (years) | 63.71 ± 11.90 | 61.45 ± 10.80 |
| Smoking (no, %) | 19 (38.8) | 9 (27.3) |
| Hypertension (no, %) | 41 (83.7)** | 18 (54.5) |
| GLU (mmol/L) | 5.83 ± 1.70** | 4.89 ± 0.99 |
| SUA (mmol/L) | 293.29 ± 85.86 | 335.45 ± 117.12 |
| TC (mmol/L) | 3.85 ± 1.24 | 4.17 ± 1.10 |
| TG (mmol/L) | 1.54 ± 0.86 | 1.65 ± 1.23 |
| HDL (mmol/L) | 1.04 ± 0.24 | 1.14 ± 0.38 |
| LDL (mmol/L) | 2.18 ± 0.83 | 2.17 ± 0.82 |
| HCY (mmol/L) | 16.32 ± 9.54** | 11.34 ± 2.42 |
| GHB | 6.06 ± 0.87*** | 5.52 ± 0.46 |
abrAbbreviationsICAS-stroke, ischemic stroke caused by intracranial atherosclerotic stenosis; SD, standard deviation; no, number; GLU, blood glucose; SUA, serum uric acid; TC, total cholesterol; TG, triglyceride; HDL, high-density lipoprotein; LDL, low-density lipoprotein; HCY, homocysteine; GHB, glycosylated hemoglobin. The data were represented as mean ± standard deviation. *p < 0.05, **p < 0.01
Selected circRNAs for qPCR validation, their microarray information, and the reason for validation.
| CircRNA |
| Fold change | Regulation | Genomic location | Function | Reason for validation |
|---|---|---|---|---|---|---|
| hsa_circ_0003574 | 0.004 | 3.45 | UP |
| A nuclear retention factor for β-catenin during wnt signaling ( | Wnt/β-catenin pathway plays pivotal role in atherosclerosis ( |
| hsa_circ_0010509 | 0.012 | 2.93 | UP | Enzyme that converts precursor big endothelin-1 to endothelin-1 ( | Polymorphisms of | |
| hsa_circ_0026628 | 0.025 | 2.52 | UP |
| Transcription factor activates or represses transcription in response to physiological and pathological stimuli ( |
|
| hsa_circ_0074057 | 0.009 | 0.85 | Down |
| transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells ( | Mechanoresponsive Smad5 enhances miR-487a processing to promote vascular endothelial proliferation ( |
| hsa_circ_0016993 | 0.026 | 0.85 | Down | protein pecanex-like protein 2 Homo sapiens ( | may play a role in tumorigenesis with high microsatellite instability ( | Not reported yet. |
FIGURE 2GO analysis. The histogram of GO enrichment analysis results affects the distribution of differential genes on GO terms enriched using cellular components and molecular function during the biological process.
FIGURE 3GO enrichment analysis results were presented through a scatter diagram. Rich factor depicts the number of differential genes located in the GO/the total number of genes in the GO. The more significant the Rich factor, the higher the GO enrichment degree.
FIGURE 4KEGG analysis. Bubble chart of the top 20 KEGG pathway analyses for target genes of the differentially expressed circRNAs.
FIGURE 5The constructed circRNA-miRNA-mRNA network. Hsa_circ_0003574 (brown nodes) was functionally associated with their targeted miRNAs in the network. Nodes with red color are microRNAs, and those with light-blue color are protein_coding RNAs. Edges with a T-shape arrow depict directed relationships. Edges without arrows depict undirected relationships (ceRNA relationship).