Toyoaki Maruta1, Kotaro Hidaka1, Satoshi Kouroki1, Tomohiro Koshida1, Mio Kurogi1, Yohko Kage2, Seiya Mizuno3, Tetsuro Shirasaka1, Toshihiko Yanagita4, Satoru Takahashi3, Ryu Takeya2, Isao Tsuneyoshi1. 1. Department of Anesthesiology, Faculty of Medicine, University of Miyazaki, Miyazaki, Miyazaki, Japan. 2. Department of Pharmacology, Faculty of Medicine, University of Miyazaki, Miyazaki, Miyazaki, Japan. 3. Laboratory Animal Resource Center in Transborder Medical Research Center, Faculty of Medicine, University of Tsukuba, Tsukuba, Ibaraki, Japan. 4. Department of Clinical Pharmacology, School of Nursing, Faculty of Medicine, University of Miyazaki, Miyazaki, Miyazaki, Japan.
Abstract
In small and large spinal dorsal root ganglion neurons, subtypes of voltage-gated sodium channels, such as NaV1.7, NaV1.8, and NaV1.9 are expressed with characteristically localized and may play different roles in pain transmission and intractable pain development. Selective stimulation of each specific subtype in vivo may elucidate its role of each subtype in pain. So far, this has been difficult with current technology. However, Optogenetics, a recently developed technique, has enabled selective activation or inhibition of specific neural circulation in vivo. Moreover, optogenetics had even been used to selectively excite NaV1.8-expressing dorsal root ganglion neurons to induce nocifensive behavior. In recent years, genetic modification technologies such as CRISPR/Cas9 have advanced, and various knock-in mice can be easily generated using such technology. We aimed to investigate the effects of selective optogenetic activation of NaV1.7-expressing afferents on mouse behavior. We used CRISPR/Cas9-mediated homologous recombination to generate bicistronic NaV1.7-iCre knock-in mice, which express iCre recombinase under the endogenous NaV1.7 gene promoter without disrupting NaV1.7. The Cre-driver mice were crossed with channelrhodopsin-2 (ChR2) Cre-reporter Ai32 mice to obtain NaV1.7iCre/+;Ai32/+, NaV1.7iCre/iCre;Ai32/+, NaV1.7iCre/+;Ai32/Ai32, and NaV1.7iCre/iCre;Ai32/Ai32 mice. Compared with wild-type mice behavior, no differences were observed in the behaviors associated with mechanical and thermal stimuli exhibited by mice of the aforementioned genotypes, indicating that the endogenous NaV1.7 gene was not affected by the targeted insertion of iCre. Blue light irradiation to the hind paw induced paw withdrawal by mice of all genotypes in a light power-dependent manner. The threshold and incidence of paw withdrawal and aversive behavior in a blue-lit room were dependent on ChR2 expression level; the strongest response was observed in NaV1.7iCre/iCre;Ai32/Ai32 mice. Thus, we developed a non-invasive pain model in which peripheral nociceptors were optically activated in free-moving transgenic NaV1.7-ChR2 mice.
In small and large spinal dorsal root ganglion neurons, subtypes of voltage-gated sodium channels, such as NaV1.7, NaV1.8, and NaV1.9 are expressed with characteristically localized and may play different roles in pain transmission and intractable pain development. Selective stimulation of each specific subtype in vivo may elucidate its role of each subtype in pain. So far, this has been difficult with current technology. However, Optogenetics, a recently developed technique, has enabled selective activation or inhibition of specific neural circulation in vivo. Moreover, optogenetics had even been used to selectively excite NaV1.8-expressing dorsal root ganglion neurons to induce nocifensive behavior. In recent years, genetic modification technologies such as CRISPR/Cas9 have advanced, and various knock-in mice can be easily generated using such technology. We aimed to investigate the effects of selective optogenetic activation of NaV1.7-expressing afferents on mouse behavior. We used CRISPR/Cas9-mediated homologous recombination to generate bicistronic NaV1.7-iCre knock-in mice, which express iCre recombinase under the endogenous NaV1.7 gene promoter without disrupting NaV1.7. The Cre-driver mice were crossed with channelrhodopsin-2 (ChR2) Cre-reporter Ai32 mice to obtain NaV1.7iCre/+;Ai32/+, NaV1.7iCre/iCre;Ai32/+, NaV1.7iCre/+;Ai32/Ai32, and NaV1.7iCre/iCre;Ai32/Ai32 mice. Compared with wild-type mice behavior, no differences were observed in the behaviors associated with mechanical and thermal stimuli exhibited by mice of the aforementioned genotypes, indicating that the endogenous NaV1.7 gene was not affected by the targeted insertion of iCre. Blue light irradiation to the hind paw induced paw withdrawal by mice of all genotypes in a light power-dependent manner. The threshold and incidence of paw withdrawal and aversive behavior in a blue-lit room were dependent on ChR2 expression level; the strongest response was observed in NaV1.7iCre/iCre;Ai32/Ai32 mice. Thus, we developed a non-invasive pain model in which peripheral nociceptors were optically activated in free-moving transgenic NaV1.7-ChR2 mice.
The sensation of pain results from the activation of a subset of sensory neurons known as nociceptors. Activation of unmyelinated (C-fiber) and myelinated (Aδ-fiber) nociceptive afferent fibers indicates potential tissue damage, which is reflected in the high thresholds of nociceptors for mechanical, thermal, and chemical stimuli, which induce neurotransmissions via ion channels, neurotransmitters, and intracellular signaling [1, 2]. These conditions change considerably in neuropathic pain states. Understanding the changes that occur in neuropathic pain is vital for identifying new therapeutic targets and developing novel analgesics [2]. However, since mechanical, thermal, and chemical stimuli activate both targeted and off-target neurons, effectively controlling the activation of specific types of neurons is a major challenge.Optogenetics is a recently developed and popular tool used in several areas of neuroscience research [3]. This technique utilizes light-sensitive ion channels (opsins) to modulate the activity of specific neuron subsets. Several types of opsins are currently used, with new ones being continuously developed and optimized. This technique, which enables selective activation or inhibition of neural circulation in vivo, can be used to provide a better understanding of complex pain pathways [4-7].Channelrhodopsins are a subfamily of retinylidene proteins (rhodopsins) that function as light–gated ion channels. They are nonspecific cation channels that conduct H+, Na+, K+, and Ca2+ ions. Channelrhodopsin-1 (ChR1) and Channelrhodopsin-2 (ChR2) from the model organism Chlamydomonas reinhardtii were the first discovered channelrhodopsins. Recently, various ChR2 transgenic animal models have been generated, which play important roles in revealing the mechanisms of neural activity and mapping neural circuits [8].Different subtypes of voltage-gated sodium channels, including NaV1.7, NaV1.8, and NaV1.9, exhibit characteristic localization in neurons of the small and large spinal dorsal root ganglion (DRG) and may play different roles in pain transmission and neuropathic pain development [9,10]. If a specific subtype of voltage-gated sodium channels could be selectively stimulated in a living body, it might be possible to evaluate its specific role in pain. However, this has been difficult with current technology. Optogenetics enables selective activation or inhibition of neural circulation in vivo. The first voltage-dependent Na+ channel to be targeted in pain studies using ChR2 transgenic animals was NaV1.8 [11, 12]. However, transgenic mice wherein other Na+ channels are targeted have not been produced. Currently, genetic modification technologies such as CRISPR/Cas9 have advanced, and various knock-in mice can be easily generated. The present study aimed to examine mouse nocifensive behavior as a result of selective optogenetic activation of NaV1.7–expressing afferents. This study helps elucidate the role of NaV1.7 in pain neurotransmission and might provide valuable insights into the development of neuropathic pain and the design of effective therapeutics in the future.
Results
Development of original NaV1.7–iCre (NaV1.7iCre/+) knock-in mice
The founder generation (F0) of bicistronic NaV1.7–iCre (NaV1.7iCre/+) knock-in mice was created using the CRISPR/Cas9 system (Fig 1A), with s assistance from the platform of Advanced Animal Model Support (AdAMS). The sequence 5′-gaaagcaggaaatagagctt-3′ containing the termination codon of Scn9a was selected as the target for the single guide RNA (sgRNA) and inserted into the pX330-mC plasmid, which carried both sgRNA and Cas9-mC expression units [13]. A P2A-iCre-rabbit globin polyadenylation sequence was present between the 5′- and 3′- homology arms of the donor DNA, piCre-Scn9a. P2A is a 2A self-cleaving peptide that helps generate polyproteins by preventing the ribosome from creating a peptide bond (ribosome skipping). The genomic region from 1,656 to 1 bp upstream of the termination codon was isolated in the 5′-homology arm, whereas the genomic region from the termination codon to 2,054 bp downstream of the termination codon was isolated in the 3′-homology arm of Scn9a. These DNA vectors were isolated using the FastGene Plasmid Mini Kit (Nippon Genetics, Tokyo, Japan) and filtered through a Millex-GV® filter (0.22 μm; Merck Millipore, Darmstadt, Germany).
Fig 1
Schematic diagram of the Scn9a knock-in allele (a) and PCR for genotyping founder mice (b). (a)The last exon of Scn9a is illustrated. The P2A-iCre sequence was inserted immediately after the stop codon of Scn9a. (b) The detection of the insert upstream of the 5′- and 3′-homology arm and the random integration of pX330-mC and piCre-Scn9a. Six founder mice were determined to carry the designed knock-in mutation. M, marker; P, positive control; N, negative control.
Schematic diagram of the Scn9a knock-in allele (a) and PCR for genotyping founder mice (b). (a)The last exon of Scn9a is illustrated. The P2A-iCre sequence was inserted immediately after the stop codon of Scn9a. (b) The detection of the insert upstream of the 5′- and 3′-homology arm and the random integration of pX330-mC and piCre-Scn9a. Six founder mice were determined to carry the designed knock-in mutation. M, marker; P, positive control; N, negative control.Pregnant mare serum gonadotropin (5 IU) and human chorionic gonadotropin (5 IU) were intraperitoneally injected into female C57BL/6J mice at 48-h intervals. Subsequently, they mated with male C57BL/6J mice. Afterwards., we obtained the zygotes from the oviducts of the mated females and microinjected a mixture of pX330-mC (circular, 5 ng/μL, each) and piCre-Scn9a (circular, 10 ng/μL) into the zygotes. Subsequently, the surviving zygotes were transferred into the oviducts of pseudopregnant ICR strain females mice of the ICR strain, and newborns were obtained. To confirm the presence of the knock-in mutation, we purified the genomic DNA isolated from a tail tissue sample was purified using a PI-200 DNA automatic isolation system (Kurabo Industries Ltd., Osaka, Japan) according to the manufacturer’s instructions. Genomic PCR was performed using a KOD Fx kit (TOYOBO, Osaka, Japan). The insert upstream of the 5′ homology arm was detected using the following primers: Scn9a screening 5Fw (5′- TGATGGCCATAAAAATCAAAGGATGGTA-3′) and iCre-5-Rv68 (5′- AGATCCATCTCTCCACCAGCTTGGTAAC -3′). The insert upstream of the 3′-homology arm was detected using the following primers: iCre-3-Fw68 (5′- GAGGATGTGAGGGACTACCTCCTGTACC -3′) and Scn9a screening 3Rv (5′- GGATGTTTTGTGTGGCTCACCATTAAGT-3′). Six founder mice were determined to carry the designed knock-in mutation. Additionally, we performed PCR to detect random integration of pX330-mC and piCre-Scn9a with a primer that detected the ampicillin resistance gene (Amp detection-F: 5′-ttgccgggaagctagagtaa-3′, and Amp detection-R: 5′-tttgccttcctgtttttgct-3′). No founder mice was determined to carry the random integration allele. Fig 1B shows the results of genomic PCR.
Development of NaV1.7-ChR2 mice genotypes
Fig 2A shows the mating patterns of mice adopted the following four genotypes of NaV1.7-ChR2 mice: NaV1.7iCre/+;Ai32/+, NaV1.7iCre/iCre;Ai32/+, NaV1.7iCre/+;Ai32/Ai32, and NaV1.7iCre/iCre;Ai32/Ai32. We created NaV1.7iCre/+;Ai32/+ mice by crossing homozygous NaV1.7–iCre (NaV1.7iCre/iCre) mice with homozygous Ai32 mice carrying the ChR2(H134R)-EYFP gene in their Gt(ROSA)26Sor locus [14]. The gene was separated from its CAG promoter using a loxP-flanked transcriptional STOP cassette, allowing its expression in a Cre-dependent manner. Thereafter, NaV1.7iCre/+;Ai32/+, NaV1.7iCre/iCre;Ai32/+, NaV1.7iCre/+;Ai32/Ai32, and NaV1.7iCre/iCre;Ai32/Ai32 mice were created by crossing NaV1.7iCre/+;Ai32/+ mice with each other.
Fig 2
Establishment of different lines of transgenic mice (a) and distribution of ChR2-EYFP channels in DRG (b). (a) NaV1.7iCre/+;Ai32/+ mice were created by crossing homozygous NaV1.7–iCre mice with heterozygous Ai32 mice. Subsequently, NaV1.7iCre/+;Ai32/+, NaV1.7iCre/iCre;Ai32/+, NaV1.7iCre/+;Ai32/Ai32, and NaV1.7iCre/iCre;Ai32/Ai32 mice were created by crossing NaV1.7iCre/+;Ai32/+ mice with each other. The four genotypes of mice used in the study are highlighted in yellow. (b) A typical immunohistochemical image showing of ChR2-EYFP in the DRG, the dorsal horn of spinal cord, and glabrous skin of NaV1.7iCre/+;Ai32/+ mouse was shown. Green and red fluorescence indicates ChR2-EYFP and NaV1.7, respectively. ChR2–EYFP were expressed on NaV1.7-expressing DRG neurons. Green fluorescence (ChR2–EYFP expression) can be observed in the dorsal horn. ChR2–EYFP is localized in free nerve endings in the lower and upper dermis of glabrous skin.
Establishment of different lines of transgenic mice (a) and distribution of ChR2-EYFP channels in DRG (b). (a) NaV1.7iCre/+;Ai32/+ mice were created by crossing homozygous NaV1.7–iCre mice with heterozygous Ai32 mice. Subsequently, NaV1.7iCre/+;Ai32/+, NaV1.7iCre/iCre;Ai32/+, NaV1.7iCre/+;Ai32/Ai32, and NaV1.7iCre/iCre;Ai32/Ai32 mice were created by crossing NaV1.7iCre/+;Ai32/+ mice with each other. The four genotypes of mice used in the study are highlighted in yellow. (b) A typical immunohistochemical image showing of ChR2-EYFP in the DRG, the dorsal horn of spinal cord, and glabrous skin of NaV1.7iCre/+;Ai32/+ mouse was shown. Green and red fluorescence indicates ChR2-EYFP and NaV1.7, respectively. ChR2–EYFP were expressed on NaV1.7-expressing DRG neurons. Green fluorescence (ChR2–EYFP expression) can be observed in the dorsal horn. ChR2–EYFP is localized in free nerve endings in the lower and upper dermis of glabrous skin.Fig 2B shows a typical immunohistochemical image showing NaV1.7 and ChR2-EYFP in the DRG of NaV1.7iCre/+;Ai32/+ mouse. EYFP fluorescence was observed in NaV1.7-expressing DRG neurons. EYFP fluorescence was also observed in the dorsal horn of the spinal cord and was faded in the deep and superficial layers of the glabrous skin bordering the dermal–epidermal junction.
Normal nocifensive behavior associated with mechanical and thermal stimuli was exhibited by the four genotypes
We examined the behavior associated with mechanical and thermal stimuli exhibited by four genotypes of NaV1.7-ChR2 mice. As shown in Fig 3A and 3B, compared with the behavior of wild-type (WT) mice, no differences were observed in the behavior associated with mechanical and thermal stimuli exhibited by the mice of the four genotypes.
Fig 3
Paw withdrawal test (von Frey test) (a) and plantar test (b). (a) The von Frey test was performed with the wild type (WT) and mice of the four genotypes. The hind paw withdrawal data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain are as follows: WT (B6J), 4.4 ± 0.7 g; NaV1.7iCre/+;Ai32/+, 4.8 ± 0.4 g; NaV1.7iCre/iCre;Ai32/+, 4.5 ± 0.8 g; NaV1.7iCre/+;Ai32/Ai32, 4.0 ± 1.2 g; and NaV1.7iCre/iCre;Ai32/Ai32, 4.3 ± 0.7 g. (b) The plantar test was performed with the WT and mice of the four genotypes. The data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain were as follows: WT (B6J), 5.7 ± 0.8 s; NaV1.7iCre/+;Ai32/+, 5.5 ± 1.2 s; NaV1.7iCre/iCre;Ai32/+, 6.6 ± 1.7 s; NaV1.7iCre/+;Ai32/Ai32, 6.6 ± 2.2 s; and NaV1.7iCre/iCre;Ai32/Ai32, 6.3 ± 1.2 s.
Paw withdrawal test (von Frey test) (a) and plantar test (b). (a) The von Frey test was performed with the wild type (WT) and mice of the four genotypes. The hind paw withdrawal data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain are as follows: WT (B6J), 4.4 ± 0.7 g; NaV1.7iCre/+;Ai32/+, 4.8 ± 0.4 g; NaV1.7iCre/iCre;Ai32/+, 4.5 ± 0.8 g; NaV1.7iCre/+;Ai32/Ai32, 4.0 ± 1.2 g; and NaV1.7iCre/iCre;Ai32/Ai32, 4.3 ± 0.7 g. (b) The plantar test was performed with the WT and mice of the four genotypes. The data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain were as follows: WT (B6J), 5.7 ± 0.8 s; NaV1.7iCre/+;Ai32/+, 5.5 ± 1.2 s; NaV1.7iCre/iCre;Ai32/+, 6.6 ± 1.7 s; NaV1.7iCre/+;Ai32/Ai32, 6.6 ± 2.2 s; and NaV1.7iCre/iCre;Ai32/Ai32, 6.3 ± 1.2 s.
Differences among the four genotypes in behavior associated with optogenetic stimulation
We performed two types of behavioral tests using optogenetics. Fig 4 shows a schematic representation of the blue LED light irradiation hind paw withdrawal test. The mice of the four genotypes showed a light power-dependent increase in withdrawal percentage and sensitivity to blue light in the following order: NaV1.7iCre/+;Ai32/+ < NaV1.7iCre/iCre;Ai32/+ < NaV1.7iCre/+;Ai32/Ai32 < NaV1.7iCre/iCre;Ai32/Ai32. To rule out a ChR2-independent effect of strong illumination on the animal behavior, we performed a yellow LED light irradiation hind paw withdrawal test on NaV1.7iCre/+;Ai32/+ mice to rule out a ChR2-independent effect of strong illumination on the animal behaviour. Irradiation with yellow light irradiation (5 mW) did not induce hind paw withdrawal behavior.
Fig 4
Light irradiation hind paw withdrawal test.
(a) Experimental schematic. (b) The blue light irradiation hind paw withdrawal test was performed in wild-type (WT) and mice of the four genotypes. The data were analyzed using one-way ANOVA followed by Bonferroni post-hoc analysis. All results are calculated as mean ± SD of 10 or more animals. *P < 0.001, compared with WT mice. †P = 0.03 and #P = 0.02, compared with WT mice.
Light irradiation hind paw withdrawal test.
(a) Experimental schematic. (b) The blue light irradiation hind paw withdrawal test was performed in wild-type (WT) and mice of the four genotypes. The data were analyzed using one-way ANOVA followed by Bonferroni post-hoc analysis. All results are calculated as mean ± SD of 10 or more animals. *P < 0.001, compared with WT mice. †P = 0.03 and #P = 0.02, compared with WT mice.Fig 5 shows a schematic representation of the optogenetic place aversion (OPA) test. The time spent in the room with the blue LED floor was shorter for mice of all four genotypes than that for WT mice. The duration of stay in the room by mice decreased as follows: NaV1.7iCre/+;Ai32/+ = NaV1.7iCre/iCre;Ai32/+ > NaV1.7iCre/+;Ai32/Ai32 = NaV1.7iCre/iCre;Ai32/Ai32.
Fig 5
OPA test.
(a) Experimental schematic. (b) The OPA test was performed with the wild-type (WT) and mice of the four genotypes. The data were analyzed using one–way ANOVA followed by Bonferroni post-hoc analysis. All results are calculated as mean ± SD of 10 or more animals. *P < 0.001, compared with WT mice.
OPA test.
(a) Experimental schematic. (b) The OPA test was performed with the wild-type (WT) and mice of the four genotypes. The data were analyzed using one–way ANOVA followed by Bonferroni post-hoc analysis. All results are calculated as mean ± SD of 10 or more animals. *P < 0.001, compared with WT mice.
Expression of ChR2 in DRG of mice of the four genotypes
Fig 6 shows ChR2 expression in the DRG of mice of the four genotypes as measured using reverse transcription-polymerase chain reaction (RT–PCR). The expression of ChR2 in mice of the four genotypes increased in the following order: NaV1.7iCre/+;Ai32/+ ≤ NaV1.7iCre/iCre;Ai32/+ < NaV1.7iCre/+;Ai32/Ai32 = NaV1.7iCre/iCre;Ai32/Ai32. S2 Fig shows the typical immunohistochemical image showing ChR2-EYFP expression in the DRG of mice of the four genotypes. A higher number of EYFP-positive DRG neurons were observed in NaV1.7iCre/+;Ai32/Ai32 and NaV1.7iCre/iCre;Ai32/Ai32 mice than that in NaV1.7iCre/+;Ai32/+ mice.
Fig 6
RT-PCR for ChR2 expression in DRG.
ChR2 expression in DRG neurons as measured by RT-PCR. β–Actin was used as a positive control to confirm successful protein extraction and equal loading of samples. All data are calculated as mean ± SD of 5 animals. *P < 0.001, compared with NaV1.7iCre/+;Ai32/+ mice. †P = 0.007 and #P = 0.006, compared with NaV1.7iCre/iCre;Ai32/+ mice.
RT-PCR for ChR2 expression in DRG.
ChR2 expression in DRG neurons as measured by RT-PCR. β–Actin was used as a positive control to confirm successful protein extraction and equal loading of samples. All data are calculated as mean ± SD of 5 animals. *P < 0.001, compared with NaV1.7iCre/+;Ai32/+ mice. †P = 0.007 and #P = 0.006, compared with NaV1.7iCre/iCre;Ai32/+ mice.
Discussion
We used CRISPR/Cas9-mediated homologous recombination to generate bicistronic NaV1.7–iCre knock-in mice expressing iCre recombinase under the control of the endogenous NaV1.7 gene promoter without disrupting endogenous NaV1.7. Furthermore, using the Cre-loxP system, we crossed homozygous NaV1.7–iCre (NaV1.7iCre/ iCre) mice with homozygous Ai32 mice and generated a transgenic NaV1.7–ChR2 mouse line (NaV1.7iCre/ +;Ai32/+) in which ChR2 was selectively targeted in NaV1.7-expressing sensory neurons. Thus, the NaV1.7–iCre transgenic mouse line used in our study could have ChR2 channels delivered to peripheral nociceptors, allowing them to take advantage of the strong CAG promoter driving their conditional expression. This study also demonstrated that the genotype with a higher expression of ChR2 in the DRG showed a greater nocifensive response associated with blue light.The first attempts to apply optogenetics to explore the underlying mechanisms of pain targeted Mas-related G-protein-coupled receptor D (Mrgprd) expressed in nonpeptidergic nociceptive C-fibers and transient receptor potential vanilloid-1 (TRPV1) expressed in peptidergic nociceptive C-fibers [15-18]. Transdermal optogenetic activation of TRPV1-expressing peripheral nociceptors induces nociceptive behaviors, including paw withdrawal and paw licking in mice, as well as conditioned place aversion, whereas the activation of Mrgprd-expressing neurons induces paw withdrawal and paw lifting, but not aversion [18].The next target after Mrgprd and TRPV1 was NaV1.8, a voltage-dependent Na+ channel. Using the Cre-loxP strategy, Daou et al. crossed homozygous NaV1.8–Cre mice with heterozygous Ai32 mice and generated a transgenic mouse line in which ChR2 was selectively targeted in NaV1.8-expressing sensory neurons. In this line, ChR2 was expressed in the cell bodies as well as the fibers that reach the skin and the superficial layers of the spinal cord. Paw withdrawal was induced by blue light illumination of the hind paw skin of free-moving mice, thus demonstrating that they were the first transgenic mice to sense light as pain [11]. Furthermore, extended exposure of the hind paw to blue light (30 min under anesthesia) induced long-term behavioral sensitization to mechanical and thermal stimuli, and a 10-min exposure induced c-Fos expression in dorsal horn neurons ipsilateral to the stimulated hind paw [11]. Thus, the ability to evoke nocifensive behaviors with light alone provides a novel method of stimulation that is non-invasive, does not require mechanical interruption of the skin, and can be repeated without tissue injury. However, because NaV1.8 currents are produced by NaV1.8–Cre heterozygotes but not by NaV1.8–Cre homozygotes, it is likely that the knock-in of the Cre gene affects the NaV1.8 gene [19]. Thus, NaV1.8–Cre homozygotes may have different pain responses to mechanical or thermal stimuli. The NaV1.7–iCre mice in our study showed no difference in nocifensive response compared with that in WT mice, regardless of them being heterozygotes or homozygotes (S1 Fig). This is an advantage when NaV1.7–iCre homozygotes are required to be included in experiments, as in this study.As well as NaV1.8, NaV1.7 is also expressed in the peripheral nerve and play important roles in the development of inflammatory and neuropathic pain [9, 10]. Global NaV1.7-null mutant mice die shortly after birth, whereas the NaV1.8-null mutation is not lethal [20-22]. In NaV1.8–Cre mice crossed with floxed NaV1.7 mice, which are knockout mice specifically lacking the nociceptor NaV1.7, acute inflammatory pain responses evoked by various stimuli (e.g., carrageenan, Freund’s adjuvant, or formalin) are reduced or abolished [22]. NaV1.7 is the first voltage-dependent Na+ channel to be identified with an altered functional mutation in humans [10]. Gain-of-function mutations in Scn9a, which encodes NaV1.7, lead to severe neuropathic pain, whereas loss-of-function mutations in this gene lead to an indifference to pain. In the epidermis and spinal cord dorsal horn, NaV1.7 is thought to enhance subthreshold stimuli, making it easier for neurons to reach the threshold for firing [23]. Thus, NaV1.7 acts as an amplifier of the receptor potential in nociceptive neurons and plays a critical role in inherited erythromelalgia and paroxysmal extreme pain disorder, as it causes gain-of-function mutations that enable the channel to open with small depolarizations. Conversely, congenital insensitivity to pain is a loss-of-function mutation in NaV1.7. NaV1.7-deficient patients have no cognitive or cardiac function impairment; hence, analgesic therapies targeting NaV1.7 have been investigated using these Scn9a mutations to generate global Scn9a knockout mice or rats [24]. Furthermore, animal studies have shown that NaV1.7 expression and function are increased in models of diabetic neuropathy, chronic constrictive injury, and chemotherapy-induced peripheral neuropathy [25]. These findings suggest that the pathophysiological mechanisms underlying these pain conditions can be understood by examining the profile of nociceptive behaviors related to NaV1.7 and further comparing it to those associated with NaV1.8 and NaV1.9, which have also been implicated in chronic pain [21, 26]. With the development of genetic recombination technology, it will be easier to create animal models targeting these channels and thus, gain a deeper understanding of the role of these channels in various pain conditions. The present study showed that genotypes with high ChR2 expression (i.e. NaV1.7iCre/+;Ai32/Ai32 and NaV1.7iCre/iCre;Ai32/Ai32 mice) have a stronger nociceptive response to blue light because ChR2 expression is enhanced even in DRG neurons with low NaV1.7 expression. However, since NaV1.7 is widely expressed in various DRG neurons at varying expression levels, the enhanced expression of ChR2 did not seem to reflect such localization of NaV1.7. Therefore, it is suggested that when comparing NaV1.7 to NaV1.8 or NaV1.9, Cre and Ai32 should be compared in hetero phenotypes (i.e., NaV1.7iCre/+;Ai32/+ vs. NaV1.8iCre/+;Ai32/+ vs. NaV1.9iCre/+;Ai32/+).In conclusion, we generated bicistronic NaV1.7–iCre knock-in mice and developed a non-invasive pain model in which peripheral nociceptors were optically activated in free-moving transgenic NaV1.7–ChR2 mice. An optogenetic approach to investigate the individual role of Na+ channel subtypes in pain transduction might provide a better understanding of neuropathic pain development and help in designing effective therapeutics in the future.
Methods
Animals
WT C57BL/6J mice, commonly known as B6J mice, and Ai32 mice (C57BL/6 background) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). All the mice were individually housed in a temperature and humidity-controlled environment with a 12-h light-dark cycle and were permitted free access to food and water. This study was conducted in strict accordance with the guidelines for the Proper Conduct of Animal Experiments (Science Council of Japan) and approved by the Experimental Animal Care and Use Committee of the University of Miyazaki (Permit Number: 2018–536). Male mice over 2 months of age were used in the experiments. All efforts were made to minimize the number of animals used and their suffering. Mice in each group were randomly selected, and the experimenter was blinded to the mouse genotype.
von Frey test to determine mechanical sensitivity
Mechanical sensitivity was examined by determining the paw withdrawal threshold using an electronic von Frey esthesiometer (IITC Life Science Inc., Woodland Hills, CA, USA) fitted with a polypropylene tip. Each adult mouse was placed in a 10 cm × 10 cm suspended chamber with a metallic mesh floor. After acclimation of mice for 30 min, the polypropylene tip was applied perpendicularly to the plantar surface of the right and left hind paws with sufficient force for 3–4 s. Brisk withdrawal or paw flinching was considered a positive response. The pain threshold was calculated as the mean of three measurements.
Plantar test to determine thermal sensitivity
Thermal sensitivity was examined by measuring paw withdrawal latency in response to noxious thermal stimuli using plantar test (Hargreaves method) units (Ugo Basile SRL, Gemonio VA, Italy). Each mouse was placed on clear glass in an enclosure, and paw withdrawal latency was measured. After a 30-min acclimation period, the heat-emitting projector lamp of the thermal test apparatus was activated, and the beam was directed to the plantar surface of the hind paw. Using a built-in digital timer, the paw withdrawal latency was recorded. The average withdrawal time over five consecutive trials was calculated. A cutoff value of 30 s was used to avoid possible tissue damage.
Light irradiation test to determine paw withdrawal latency
Mice were habituated for 1 h in transparent cubicles (10 cm × 6.5 cm × 6.5 cm) set atop a 5-mm-thick glass floor and separated from each other by opaque dividers. Acute nocifensive behaviors were elicited light from using a pulsing LED light (465 nm blue light and 595 nm yellow light at 10 Hz; Doric Lenses Inc., Quebec, Canada) set at different intensities and aimed at the plantar surface of the hind paw. The light intensity was determined using a light power meter (LPM-100TM; Bioresearch Center Inc., Aichi, Japan). Since the power meter measures light intensity in units of milliwatts (mW), the light density in units of mW/mm2 was calculated by dividing the light intensity by the illuminated area in square millimeters (48 mm2). The mice underwent a total of five trials of 1 s each, with 5-s intervals between the trials. The percentage of trials during which hind paw withdrawal or paw licking occurred was recorded.
OPA test
This test was performed using an OPA system (Bioresearch Center Inc., Nagoya, Japan) [27]. We used a two-chamber system with an entrance connecting each chamber of 20 cm × 24 cm size. The floor of each chamber, one green (530 nm) and the other blue (470 nm), was illuminated with a 20 × 24 array of light-emitting diodes (LEDs). The chambers were uniformly illuminated (10 mW) to prevent the test being affected by the preference mice have for dark environments. After the mice were habituated to the chambers for 10 min with the LEDs turned off, each mouse was allowed to move freely between the two chambers for 10 min with the LEDs turned on. The location of each mouse was recorded using a video camera and analyzed using the BIOBSERVE Viewer 2 software. Next, the lights were switched on, and the position was recorded for 10 min. The percentage of time spent by each mouse in the blue- and green-floored chamber during the 10-min observational period was determined.
RT-PCR
Mice were euthanized using sevoflurane exposure. Next, DRG of each mice genotype were obtained and immediately dissected for further analysis. Briefly, the collected DRG were homogenized, and total cellular RNA was isolated by acid guanidinium thiocyanate-phenol-chloroform extraction using TRIzol™ reagent (Total RNA Isolation Reagent; Invitrogen, Carlsbad, CA, USA). The quality and quantity of the extracted total cellular RNA were assessed by determining the ratio of the optical densities at 260 and 280 nm. The RT reaction was performed using a first-strand cDNA synthesis kit (SuperScript™ II Reverse Transcriptase, Invitrogen) according to the manufacturer’s instructions. We performed PCR amplification using the EmeraldAmp® MAX PCR Master Mix (TAKARA Bio Inc., Shiga, Japan), 1 μL of cDNA template, and 0.4 μM of both forward and reverse primers in a 20-μL reaction mixture. The target cDNA was amplified according to the PCR protocol consisting of a denaturation step (10 min at 95°C), followed by 27 cycles (10 s at 98°C, 30 s at 55°C, and 60 s at 72°C) for β-actin or 34 cycles (10 s at 98°C, 30 s at 55°C, and 60 s at 72°C) for ChR2, and a final extension step (90 s at 72°C). PCR was performed in a thermal cycler (Veriti™ Thermal Cycler; Thermo Fisher Scientific, Waltham, MA, USA). The PCR products were run on a 2% agarose gel. Subsequently, the bands were visualized using a luminoimage analyzer LAS-4000 (Fujifilm, Tokyo, Japan). We used the following specific primers obtained from Macrogen Global Headquarters (Seoul, Korea); ChR2-Forward: 5′-caatgttactgtgccggatg-3′, ChR2-Reverse: 5′-atttcaatggcgcacacata-3′, β-actin-Forward: 5′-cgtaaagacctctatgccaaca-3′, β-actin-Reverse: 5′-cggactcatcgtactcctgct-3′ [28].
Immunohistochemistry
The mice were anesthetized with sevoflurane. Next, they were intracardially perfused with 50 mL of perfusion buffer, followed by 100 mL of 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) (pH 7.4) at room temperature for 30 min. DRG were dissected and post-fixed in 4% PFA for 2 h at 4°C, cryoprotected in 30% sucrose in PBS, and incubated overnight at 4°C. Sections of 14-μm thickness were cut from the freeze-fixed DRG with the temperature maintained at –20°C using a cryostat (Leica Biosystems, Nussloch, Germany). For NaV1.7 staining, sections of DRG were incubated in 0.1% Triton X-100 and 5% goat serum in PBS at room temperature for 4 h, followed by incubation with anti-NaV1.7 polyclonal antibody (rabbit anti-rat, 1:250; catalog #ASC-008, Alomone Labs, Jerusalem, Israel) at 4°C with overnight agitation. Subsequently, the sections were washed thrice with PBS, following by incubation with goat anti-mouse IgG (H+L) (Alexa Fluor™ 594, 1:500; catalog #ab150120, Abcam, Cambridge, MA, UK) for 1 h at room temperature. S Samples of spinal cord and hindpaw glabrous skin were placed directly on slides and sliced into 30-μm thick sections. These sections were washed, air-dried, and mounted with a coverslip using an antifade mounting medium. The fluorescence of the transgenic ChR2–EYFP on DRG, Spinal cord, and glabrous skin was sufficient to be visualized without immunostaining. The prepared slides were stored at 4°C until further examination. The morphology of the different tissues was analyzed using a BZ-9000 fluorescence microscope (Keyence, Osaka, Japan). Images were processed using ImageJ software (NIH, Bethesda, MD, USA) to optimize brightness and contrast [29].
Statistical analysis
Each behavioral experiment was evaluated n ≥ 10 animals. For the behavioral experiments and RT-PCR, data were analyzed using one-way analysis of variance (ANOVA) followed by Bonferroni post-hoc analysis. The results are presented as mean ± SD. Statistical significance was set at P < 0.05. The statistical software JMP Pro 15 (SAS Institute, Inc., Cary, NC, USA) for Macintosh was used.
von Frey test and plantar test of NaV1.7iCre/iCre and NaV1.7iCre/+.
The von Frey test (a) and plantar test (b) were performed with wild-type (WT), NaV1.7iCre/iCre, and NaV1.7iCre/+ mice. The data were analyzed using one-way ANOVA. All results are calculated as mean ± SD of 10 or more animals. Individual results for each strain are (a) WT (B6J): 4.4 ± 0.7 g, NaV1.7iCre/iCre: 4.9 ± 0.8 g, and NaV1.7iCre/+: 4.9 ± 0.6 g, (b) WT (B6J): 5.7 ± 0.8 s, NaV1.7iCre/iCre: 5.5 ± 1.1 s, and NaV1.7iCre/+: 6.0 ± 1.8 s.(PPTX)Click here for additional data file.
Distribution of ChR2-EYFP channels in DRG.
The green fluorescent signal represents the direct fluorescence of ChR2-EYFP. (a) 20× and (b) 40×.(PPTX)Click here for additional data file.
The original unadjusted and uncropped images of PCR presented in Fig 6A.
(PDF)Click here for additional data file.18 Jul 2022
PONE-D-22-16820
Selective optogenetic activation of NaV1.7-expressing afferents in NaV1.7-ChR2 mice induces nocifensive behavior without affecting responses to mechanical and thermal stimuli
PLOS ONE
Dear Dr. MARUTA,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.==============================
The reviewers are convinced of the usefulness of the novel tool you developed, however they asked for better characterization of both the mouse line (integration specificity, locus characterization, expression faithfulness, etc. ) and depth of behavior characterization. Please address all concerns of reviewers in your revised manuscript.
==============================Please submit your revised manuscript by Sep 01 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Tudor C. Badea, M.D., M.A., Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: Partly********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: I Don't KnowReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: NoReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this study, the authors generated a new Nav-1.7-iCre knocking mice using CRISPR and crossed it to Ai32 reporter mice to have ChR2 expressed in Cre+ mouse DRG neurons. The authors then conducted VFH, thermal reflex, and peripheral light induced spontaneous behaviors and chamber preference assays. Overall, it's a new mouse line that is worth to be published, so the field is aware of the line and experimental results. However, there are major issues that the authors will need to fix during revision.1) the manuscript title is misleading (or wrong). The mechanical and thermal tests (no deficits) have nothing to do with ontogenetic activation of Nav-1.7-Cre+ neurons. These are baseline behaviors. Thus, the title must be changed.2) There is little data showing characterizing of the new Nav1.7-Cre line. The illustration showing the genomic structure, but no PCR or sequencing validating insert as anticipated. There is no co-staining of reporter (GFP) with endogenous Nav1.7 (or double in situ) or other common DRG neuron markers, CGRP, IB4, NF200. For the DRG section images, only GFP, and there is no quantification!!!3) For peripheral light triggered paw withdrawal reflex, how do the authors know that it indicates pain response? Fos immunostaining with spinal cord sections after blue light stimuli would help to strengthen this point.Other suggestion is to combine figures. Each current figure contains only one panel.In addition to the experiments/data, the writing is also problematic. The description of generating Nav1.7 mouse line should be a main result section (the first part), which was put in the method instead. The results part overall is too short and over simplified. On the other hand, the discussion is lengthy and some parts (like Mrgd-ChR2 mice) are even irrelevant. The entire manuscript will need to be re-written.Reviewer #2: The authors generated and characterized four genotypes of mice expressing ChR2 in Nav1.7-expressing primary afferent neurons. The four different genotypes show no difference compared to wild type animals in acute pain behaviour when exposed to von Frey filament stimulation and plantar test. However, the authors demonstrated nocifensive behaviour of these animals when stimulated with blue light, in a light intensity-dependent manner. The knock-in animals also displayed conditioned place aversion to blue light, as they spent less time in a room with a blue LED-illuminated floor, compared to a green LED-illuminated one. This work described a novel and valuable animal model to investigate further the role of the TTX-sensitive voltage-gated sodium channel Nav1.7 in a variety of pathological pain states. The experiments are clearly described and the conclusions are in line with the experimental results. This reviewer has only a few reservations concerning the general presentation of the experimental results and particularly the characterization of ChR-EYFP in DRG sections as presented in Fig. 6.1. As a general observation, the Results section is extremely succinct, and the overall description of the data lacks quantitative detail. A more in-depth presentation of the actual results is warranted. For example, the authors limit their description of the nocifensive behaviour elicited by blue light to paw withdrawal (in Fig.3) and they do not discuss other manifestations which are generally associated with pain behaviour (paw licking, jumping, vocalization, etc…). Moreover, an important control is missing from the data shown in Fig.3: the experimenters should have used light of a different frequency (yellow light, at 590 nm, for example) at the highest light intensity used in the experiment, to rule out a ChR-independent effect of strong illumination on the animal behaviour. Finally, the light intensity used in the experiments illustrated in Fig.3 should be provided in mW/mm2, not in mW.2. There is no attempt to quantify and characterise in more detail the expression of ChR-EYFP in DRG cell bodies in the sections illustrated in Fig.6. More information should be provided in terms of what percentage of neurons present YFP fluorescence, what is their average size, etc… It would also be of interest to dissect the expression of ChR-EYFP in peptidergic versus non-peptidergic neurons, using an anti-CGRP and/or an anti-P2X3 antibody, for instance.3. It would be of interest to investigate and confirm the trafficking of ChR to peripheral and central endings of Nav1.7-expressing peripheral nociceptors, by monitoring YFP fluorescence in skin and spinal cord sections.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No**********[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.31 Aug 2022Dear Dr. Tudor C. Badea,Thank you for giving me the opportunity to submit a revised draft of my manuscript titled “Selective optogenetic activation of NaV1.7–expressing afferents in NaV1.7-ChR2 mice induces nocifensive behavior without affecting responses to mechanical and thermal stimuli” to PLOS ONE (Manuscript ID: PONE-D-22-16820). We appreciate the time and effort that you and the reviewers have dedicated to providing your valuable feedback on our manuscript. We are grateful to the reviewers for their insightful comments on my paper.We have extensively revised our paper to reflect most of the suggestions provided by the reviewers. We have highlighted the changes within the manuscript in red font. Here is a point-by-point response to the reviewers’ comments and concerns.Reviewer #11) the manuscript title is misleading (or wrong). The mechanical and thermal tests (no deficits) have nothing to do with ontogenetic activation of NaV1.7-Cre+ neurons. These are baseline behaviors. Thus, the title must be changed.Response: The transgenic mice used in our study have a knock-in of the iCre recombinase gene downstream of Scn9a in the NaV1.7 gene. Therefore, we were concerned about the normal expression and functioning of NaV1.7. As mentioned in the discussion section (Page 24, lines 263-270), NaV1.8 currents were not observed in previously generated NaV1.8-Cre homozygote mice. Therefore, the nociceptive response to mechanical and thermal stimuli was likely attenuated. To address this concern, we wanted to demonstrate that the nociceptive response to mechanical and thermal stimuli, which involves functioning of the NaV1.7, is at least normal. Therefore, we included the phrase “without affecting responses to mechanical and thermal stimuli” in the manuscript title.2) There is little data showing characterizing of the new NaV1.7-Cre line. The illustration showing the genomic structure, but no PCR or sequencing validating insert as anticipated. There is no co-staining of reporter (GFP) with endogenous NaV1.7 (or double in situ) or other common DRG neuron markers, CGRP, IB4, NF200. For the DRG section images, only GFP, and there is no quantification!!!Response: We omitted the quantification of ChR2 in the immunostaining of DRG because we used PCR to assess the expression of ChR2 in the DRG of each phenotype. Immunostaining images of “Distribution of ChR2-EYFP channels in DRG” for mice of the four genotypes has been provided as supplementary information (S2 Fig). In addition, we added a figure showing NaV1.7 and ChR2-EYFP in the DRG of NaV1.7iCre/+;Ai32/+ mouse (Fig 2b). We revised the text in the manuscript accordingly (Page 14: lines 147-151).“Fig 2b shows a typical immunohistochemical image showing NaV1.7 and ChR2-EYFP in the DRG of NaV1.7iCre/+;Ai32/+ mouse. EYFP fluorescence was observed in NaV1.7-expressing DRG neurons. EYFP fluorescence was also observed in the dorsal horn of the spinal cord and was faded in the deep and superficial layers of the glabrous skin bordering the dermal– epidermal junction.”Although staining of common DRG neuron markers was not performed in this study, we intend to perform such experimentation in the future.3) For peripheral light triggered paw withdrawal reflex, how do the authors know that it indicates pain response? Fos immunostaining with spinal cord sections after blue light stimuli would help to strengthen this point.Response: We assessed nocifensive behavior and did not focus on proving whether the mice strictly felt pain. We believe that the transgenic mice developed in this study is a mouse model for pain; however, we have differentiated between “nocifensive” and “painful” as much as possible.Examining the changes in Fos expression induced by short-term light irradiation would be difficult. For instance, Daou et al. demonstrated the ipsilateral c-Fos expression in neurons of laminae I–III of the dorsal horn after 10 min suprathreshold blue-light stimulation of the left hindpaw of NaV1.8 – ChR2+ mice (J. Neurosci. 2013; 33: 18631–18640). Currently, we are investigating the persistence of nociceptive behavior after prolonged light exposure and considering the examination of changes in pain-related molecule expressions in the spinal cord and DRG.4) Other suggestion is to combine figures. Each current figure contains only one panel.Response: The number of figures has been reduced to six in total, because the old Fig. 1 and 2 were combined into new Fig. 3 and the old Fig. 6 was changed to S2 Fig.5) In addition to the experiments/data, the writing is also problematic. The description of generating NaV1.7 mouse line should be a main result section (the first part), which was put in the method instead. The results part overall is too short and over simplified. On the other hand, the discussion is lengthy and some parts (like Mrgd-ChR2 mice) are even irrelevant. The entire manuscript will need to be re-written.Response: The sections "Development of original NaV1.7–iCre (NaV1.7iCre/+) knock-in mice" and "Generation of the four genotypes of NaV1.7-ChR2 mice" were moved to the Results section (Pages 9-12, lines 92-128) from the Methods section.To address the issue of a lengthy discussion, the discussion regarding Mrgprd-ChR2 and TRPV1-ChR2 mice in the discussion section has been shortened (Pages 22-23, lines 243-250).Reviewer #21) As a general observation, the Results section is extremely succinct, and the overall description of the data lacks quantitative detail. A more in-depth presentation of the actual results is warranted. For example, the authors limit their description of the nocifensive results is warranted. For example, the authors limit their description of the nocifensive behaviour elicited by blue light to paw withdrawal (in Fig.3) and they do not discuss other manifestations which are generally associated with pain behaviour (paw licking, jumping, vocalization, etc...). Moreover, an important control is missing from the data shown in Fig.3: the experimenters should have used light of a different frequency (yellow light, at 590 nm, for example) at the highest light intensity used in the experiment, to rule out a ChR-independent effect of strong illumination on the animal behaviour. Finally, the light intensity used in the experiments illustrated in Fig.3 should be provided in mW/mm2, not in mW.Response: We did not assess other nociceptive responses separately in detail in this study. We did not observe jumping and vocalization by mice, which are generally associated with nocifensive behavior, during experimentation. Paw licking was occasionally observed and was considered a positive nocifensive behavior, as was paw withdrawal. Therefore, the method text was revised as follows.Page 32, Lines 354-355: “The percentage of trials during which hind paw withdrawal or paw licking occurred was recorded.”Indeed, this comment by reviewer #2 made us realize the importance of eliminating the ChR2-independent effects of strong illumination on animal behavior. Unfortunately, phenotypes other than NaV1.7iCre/+;Ai32/+ mice are not maintained due to breeding space issues. Consequently, an extended amount of time would be required to obtain a suitable number of these mice phenotypes other than NaV1.7iCre/+;Ai32/+ for this control experiment. Hence, as a control experiment, we exposed the NaV1.7iCre/+;Ai32/+ mice to yellow light. This was reflected in the manuscript by adding the following sentences in the Results section.Pages 17-18, Lines 191-195: “To rule out a ChR2-independent effect of strong illumination on the animal behavior, we performed a yellow LED light irradiation hind paw withdrawal test on NaV1.7iCre/+;Ai32/+ mice. Irradiation with yellow light irradiation (5 mW) did not induce hind paw withdrawal behavior.”.The light power meter that we used (LPM-100™; Bioresearch Center Inc., Aichi, Japan) displays light intensity in units of “mW”; to convert it to “mW/mm2”, we divided the light intensity by the area of illumination (48 mm2). Accordingly, the added the following sections to the methods section.Page 31, Lines 351-353: “Since the power meter measures light intensity in milliwatts (mW), the light density in mW/mm2 was calculated by dividing the light intensity by the illuminated area in square millimeters (48 mm2).”2) There is no attempt to quantify and characterise in more detail the expression of ChR-EYFP in DRG cell bodies in the sections illustrated in Fig.6. More information should be provided in terms of what percentage of neurons present YFP fluorescence, what is their average size, etc... It would also be of interest to dissect the expression of ChR-EYFP in peptidergic versus non-peptidergic neurons, using an anti-CGRP and/or an anti-P2X3 antibody, for instance.Response: We omitted the quantification of ChR2 in the immunostaining of DRG because we used PCR to assess the expression of ChR2 in DRG of each phenotype. Immunostaining images of “Distribution of ChR2-EYFP channels in DRG” for mice of the four genotypes has been provided as supplementary information (S2 Fig). As reviewer #2 pointed out, it would be interesting to characterize ChR2 expression using anti-CGRP and anti-P2X3 antibodies. Currently, we are developing mice targeting NaV1.8 and NaV1.9 as well as NaV1.7-ChR2 mice and will report on this subject in our next study.3) It would be of interest to investigate and confirm the trafficking of ChR to peripheral and central endings of NaV1.7-expressing peripheral nociceptors, by monitoring YFP fluorescence in skin and spinal cord sections.Response: We monitored the EYFP fluorescence in the dorsal horn spinal cord and hindpaw glabrous skin (Fig. 2b). Page 14, lines 149-151: “EYFP fluorescence was also observed in the dorsal horn of the spinal cord and was faded in the deep and superficial layers of the glabrous skin bordering the dermal– epidermal junction.”Submitted filename: Response to Reviewers.docxClick here for additional data file.22 Sep 2022Selective optogenetic activation of NaV1.7-expressing afferents in NaV1.7-ChR2 mice induces nocifensive behavior without affecting responses to mechanical and thermal stimuliPONE-D-22-16820R1Dear Dr. MARUTA,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Tudor C. Badea, M.D., M.A., Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #2: All comments have been addressed********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2: Yes********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2: Yes********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #2: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #2: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: The authors have responded in a satisfying manner to this reviewer's queries. The paper can be published in the revised form.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: No**********27 Sep 2022PONE-D-22-16820R1Selective optogenetic activation of NaV1.7–expressing afferents in NaV1.7-ChR2 mice induces nocifensive behavior without affecting responses to mechanical and thermal stimuliDear Dr. Maruta:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Tudor C. BadeaAcademic EditorPLOS ONE
Authors: Shrivats Mohan Iyer; Kate L Montgomery; Chris Towne; Soo Yeun Lee; Charu Ramakrishnan; Karl Deisseroth; Scott L Delp Journal: Nat Biotechnol Date: 2014-02-16 Impact factor: 54.908