Literature DB >> 36197885

A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) variants of concern.

Randi Jessen1, Line Nielsen1, Nicolai Balle Larsen1, Arieh Sierra Cohen1, Vithiagaran Gunalan2, Ellinor Marving2, Alonzo Alfaro-Núñez3, Charlotta Polacek2, Anders Fomsgaard2, Katja Spiess2.   

Abstract

Fast surveillance strategies are needed to control the spread of new emerging SARS-CoV-2 variants and gain time for evaluation of their pathogenic potential. This was essential for the Omicron variant (B.1.1.529) that replaced the Delta variant (B.1.617.2) and is currently the dominant SARS-CoV-2 variant circulating worldwide. RT-qPCR strategies complement whole genome sequencing, especially in resource lean countries, but mutations in the targeting primer and probe sequences of new emerging variants can lead to a failure of the existing RT-qPCRs. Here, we introduced an RT-qPCR platform for detecting the Delta- and the Omicron variant simultaneously using a degenerate probe targeting the key ΔH69/V70 mutation in the spike protein. By inclusion of the L452R mutation into the RT-qPCR platform, we could detect not only the Delta and the Omicron variants, but also the Omicron sub-lineages BA.1, BA.2 and BA.4/BA.5. The RT-qPCR platform was validated in small- and large-scale. It can easily be incorporated for continued monitoring of Omicron sub-lineages, and offers a fast adaption strategy of existing RT-qPCRs to detect new emerging SARS-CoV-2 variants using degenerate probes.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36197885      PMCID: PMC9534396          DOI: 10.1371/journal.pone.0274889

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

The World Health Organization designated the SARS-CoV-2 variant B.1.1.529 as a variant of concern (VOC) with the name ‘Omicron’ on November 26th, 2021 [1]. Omicron, first identified in South Africa and Botswana in November 2021, has spread rapidly worldwide and is the current dominant strain in at least 166 nations worldwide, replacing the Delta variant [2]. Since its designation as a VOC, Omicron has continued to evolve, leading to descendent lineages, termed BA.1-5, with different genetic constellations of mutations [3]. The Omicron variant is exceptional for carrying a large number of mutations not seen in combination before, including more than 40 mutations in the spike protein [4, 5]. The spike protein is the main target of antibodies generated by infection and of many vaccines widely administered, and these mutations are therefore associated with increased transmissibility [6] and immune escape [7, 8]. Initially, the BA.1 sub-variant was the dominant circulating version of Omicron. However, since the beginning of 2022, the proportion of BA.2, confirmed by whole genome sequencing (WGS), has increased dramatically, making BA.2 the dominant SARS-CoV-2 virus globally [2]. BA.1 and BA.2 differ by 19 signature mutations located in the N-terminal and in the receptor-binding domain (RBD) of the spike gene, which makes them as different as some other major variants, e.g. the diversity between the original Wuhan and the Alpha variant in the spike gene is less than between BA.1 and BA.2 [4, 5]. One notable difference between BA.1 and BA.2 is that BA.2 lacks the characteristic S-gene target failure (SGTF)-causing deletion, ΔH69/V70. This key mutation, a 2-amino acid deletion, has appeared in multiple SARS-CoV-2 variants, including the Alpha variant (B.1.1.7) [9]. BA.4 and BA.5 have an identical BA.2-like constellation of mutations in the spike protein, but carry additional signature mutations including S: ΔH69/V70 and S: L452R. The differences between BA.4 and BA.5 instead lie outside the spike gene. The first cases of BA.4 and BA.5 were reported from the Republic of South Africa in January 2022 [2] and have subsequently been found in at least 60 countries [2]. In Denmark, 1,091 patient samples infected with BA.4 and 6,685 infected with BA.5 have been confirmed by WGS per 22nd of June, 2022 [10]. BA.4 and BA.5 display higher transmission than other Omicron sub-variants and partially evade immunity from natural infections or vaccines to a higher extent than BA.1 and BA.2, enabling BA.4 and BA.5 to infect people who were immune to prior sub-lineages of Omicron and other variants [11]. As Omicron continuously evolves under immune pressure, it may develop mutations that would undermine most broadly-neutralizing therapeutic antibodies. Denmark has one of the highest SARS-CoV-2 Reverse Transcription quantitative Real-time PCR (RT-qPCR) testing and WGS capacities in the world [12]. As part of this, a flexible RT-qPCR platform termed Variant-PCR was developed for identification and monitoring of circulating SARS-CoV-2 variants of concern (VOCs) in near real-time, enabling rapid decision-making about testing, contact tracing and isolation [13]. The Variant-PCR platform utilizes signature mutations or combinations hereof that allow differentiation of the most critical VOCs by detection of four signature mutations in the SARS-CoV-2 spike protein: ΔH69/V70, L452R, E484K and N501Y [13]. We designed a degenerate probe for the detection of the ΔH69/V70 key mutation in both Alpha and Omicron variants. By combining additional results from L452R RT-qPCR, we were able to distinguish between the BA.1 and BA.2 sub-lineages, the Delta variant, and furthermore detect BA.4 and BA.5 as they emerged, although differentiation between BA.4 and BA.5 was not possible as they share the same spike protein mutations. Although BA.4 emerged before BA.5 in Denmark, BA.5 is now the dominant SARS-CoV-2 variant [10]. Validation was performed in small-scale and performance was confirmed in large-scale diagnostic settings after adaptation of the Variant-PCR to include the degenerate ΔH69V/70 probe, using paired WGS consensus genomes. This is the first RT-qPCR platform reported for simultaneous detection and discrimination of Omicron sub-variants. Furthermore, this study proves that a flexible platform such as the Variant-PCR platform can be adapted quickly and easily with a degenerate probe to monitor and differentiate existing and upcoming SARS-CoV-2 variants as part of a national testing program to help policy-makers to make public health decisions.

Materials and methods

Ethics

Exemption for review by the ethical committee system was given by the Committee on Biomedical Research Ethics–Capital region in accordance with Danish law on assay development projects. ’The study did not require informed consent. The Statens Serum institute has permission to store excess biological material for surveillance and patients can elect to have their samples excluded for this purpose.

Samples and controls

TWIST Synthetic SARS-CoV-2 RNA control (MT103907 England/205041766/2020) was purchased from TWIST bioscience in a known concentration (copies/μl) and used as PCR standard Alpha (B.1.17) in a seven-step 1:10 dilution series. The average Ct-values and standard deviations were calculated based on biological duplicates. Samples from patients with WGS-confirmed SARS-CoV-2 WT, Alpha variant B.1.1.7, Delta variant B.1.617.2 and Omicron variant B.1.529 were obtained from the Danish National Biobank to verify whether the RT-qPCR assays performs with all circulating VOCs [14]. In short, throat swabs were collected and tested SARS-CoV-2 positive by community testing facilities (Test Center Denmark), which form part of the Danish national testing program [12]. Primary diagnosis of SARS-CoV-2 infection was made by E-Sarbeco RT-qPCR [15]. The identities of the lineages BA.1, BA.2, BA.4 and BA.5 were confirmed by WGS generated by the Danish COVID-19 Genome Consortium (DCGC) and consensus genomes were deposited in GISAID (gisaid.org). Positive controls for large-scale RT-qPCR consisted of heat in-activated (60°C for 45 minutes) Danish virus isolates of Alpha variant B.1.1.7 (SARS-CoV-2/Hu/DK/SSI-H14, NCBI reference sequence ON784346) and Delta variant B.1.617.2 (SARS-CoV-2/Hu/DK/SSI-H11, NCBI reference sequence OM444216) propagated in Vero E6 cells, covering the key mutations (ΔH69/V70 and L452R) present in the Alpha variant B.1.1.7, Delta variant B.1.617.2 and Omicron variant B.1.1.529. Virus isolation, cultivation and dilution was performed as previously described [13]. Sterile 1x PBS pH 7.2 (Gibco) was used as negative control. Positive and negative controls were run in parallel with selected clinical samples throughout RNA isolation and RT-qPCR as described [13].

RNA extraction

For small-scale experiments, viral genomes from throat swabs collected in 1xPBS (700 μL) were isolated using MagNa Pure 96 nucleic acid extraction system (Roche) with reagents from the MagNa Pure 96 DNA and Viral NA Small Volume kit with 200 μL sample in 1xPBS as input and 100 μL elution. As positive control material, supernatant from SARS-CoV-2 infected cells (120 μL) were mixed with 120 μL of MagNA Pure Lysis Buffer (Roche) followed by extraction as small-scale SARS-CoV-2 patient samples. Positive control RNA was stored at -80°C until use. For large-scale SARS-CoV-2 patient screening (Variant-PCR), viral RNA was extracted using Beckman Coulter RNAdvance Viral Reagent kit with 200 μl sample in 1xPBS as input and 50 μl Nuclease-free water for elution on Beckman Coulter Biomek i7 automated workstations.

RT-qPCR assays

The primers and probes listed in Table 1 were synthesized and HPLC-purified by Biosearch Technologies, Denmark. To perform allelic discrimination analysis of the spike gene, two probes were designed for each key mutation: one detecting the wildtype nucleotide sequence and one detecting the mutation, based on sequence alignments using Geneious Prime 2021.0 [13]. The RT-qPCR assay targeting the E gene (E-Sarbeco) was used as unspecific control to determine the presence of the SARS-CoV-2 and estimate viral load [15].
Table 1

Primers and probe sequences and relative concentration used in RT-qPCRs.

TargetNameOligoVolumeRef
(μL) *
S: Δ69/70SARS-CoV-2_Δ69/70 F ACATTCAACTCAGGACTTGTTCT 0.1[13]
SARS-CoV-2_Δ69/70 R TCATTAAATGGTAGGACAGGGTT 0.1[13]
SARS-CoV-2_Δ69/70 P HEX-TTCCATGCTATCTCTGGGACCA-BHQ2 0.05[13]
SARS-CoV-2_Δ69/70 P_Wob HEX-TTCCATGYTATCTCTGGGACCA-BHQ1 0.05
SARS_CoV-2_WT_P3 Texas Red-TACATGTCTCTGGGACCAAT-BHQ2 0.05[13]
S: L452RSARS-CoV-2_L452R F CAGGCTGCGTTATAGCTTGGA 0.1[13]
SARS-CoV-2_L452R R CCGGCCTGATAGATTTCAGT 0.1[13]
SARS-CoV-2_452R_mutant_BHQ+ P HEX-TATAATTACCGGTATAGATTGTT-BHQ1 0.05[13]
SARS-CoV-2_L452_WT BHQ+ P Cal Fluor Red 610-TATAATTACCTGTATAGATTGTT-BHQ1 0.05[13]
E-geneE_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT 0.1[15]
E_Sarbeco_R ATATTGCAGCAGTACGCACACA 0.1[15]
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 0.05[15]

Mutation specific nucleotides are highlighted in bold.

*Concentration of all primer and probes is 100 μM.

Mutation specific nucleotides are highlighted in bold. *Concentration of all primer and probes is 100 μM. The reaction mixtures for the RT-qPCR experiments were prepared as follows: For each 25 μL reaction in a 96-well format used in small-scale experiment, 5 μL extracted RNA was added to a 20 μL reaction mix containing 12.5 μL Luna® Universal Probe One-step RT-qPCR reaction buffer (New England Biolabs Inc), 1.25 μL Luna® Warmstart RT Enzyme mix, primers and probes (100 μM, see volumes in Table 1), brought up to 20μL with nuclease-free water. For each 15 μL reaction in a 384-well format used for large-scale screening, 5 μL extracted RNA was added to 10 μL reaction mix containing 7.5 μL Luna® Universal Probe One-step RT-qPCR reaction buffer (New England Biolabs Inc), 0.75 μL Luna® Warmstart RT Enzyme mix, primers and probes (100 μM, see volumes in Table 1) and nuclease-free water up to 10 μL. The 384-well mastermix plates were arranged in a quadratic pattern enabling analysis of each patient sample with four different mastermixes in parallel, using first quadrate to detect ΔH69/V70, the second to detect L452R, the third to detect E-Sarbeco and the final well was not in use. This allowed for easy transfer of purified RNA from a 96-well format used during extraction to a 384-well mastermix plate for PCR (e.g. isolated RNA in A1 in the 96-well template plate was transferred to A1, A2, B1 and B2 of the 384-mastermix plate). The PCR program consists of reverse transcription at 55°C for 10 min., initial denaturation at 95°C for 3 min., followed by 45 cycles of denaturation and annealing/extension at 95°C for 15 sec., and 58°C for 30 sec., respectively, regardless of PCR plate format. All RT-qPCR reactions were performed in a calibrated Bio-Rad CFX real-time PCR instrument. The raw data was analyzed with the Bio-Rad CFX Maestro Software using a predefined threshold cut-off value of 100 RFU as a quality step, in case one of the probes in the allelic discrimination pair failed. Recorded Ct-values and end-RFU were calculated in Maestro version 5.2.8.222 and exported for further data analysis. For the mutations ΔH69/V70 and L452R, detection was based on allelic discrimination, where the end-RFU values were utilized to determine the presence of a mutation. A sample is considered positive based on the following criteria: Ct-values between 10–38 and end-RFU > 200 at Ct = 45. Validation was performed comparing RT-qPCR data to nucleotide sequences corresponding to the S gene of consensus genomes from WGS as described [13].

Whole genome sequencing

Presence of signature mutations was confirmed by Whole genome sequences generated by The Danish COVID-19 Genome Consortium (DCGC) from PCR-positive samples as described [13].

Results

A degenerate ΔH69/V70 probe is specific for Omicron detection

We evaluated the analytical performance characteristics of the existing ΔH69/V70 RT-qPCR included in our Variant-PCR [13] for the qualitative detection of Omicron in clinical samples. SARS-CoV-2 positive clinical samples containing Omicron (B.1.529), Alpha (B.1.1.7) were used as positive control, and Wuhan (SARS-CoV-2 WT), Delta (B.1.617.2) and negative SARS-CoV-2 patient samples were used as negative controls, for the ΔH69/V70 RT-qPCR (Fig 1A). The presence of SARS-CoV-2 was confirmed in positive samples by E-Sarbeco RT-qPCR [15] multiplexed with the ΔH69/V70 RT-qPCR (Fig 1B).
Fig 1

Detection of SARS-CoV-2 variants with the original ΔH69/V70 probe based on the SARS-CoV-2 alpha variant sequence.

(A) Detection of SARS-CoV-2 variants with the original probe, including patient samples confirmed as SARS-CoV-2 Alpha variant as positive control and SARS-CoV-2 negative patient samples and a water as negative controls. (B) Samples were tested as multiplex RT-qPCRs; E-Sarbeco in parallel with the ΔH69/V70 RT-qPCR. Error bars in (A-B) indicate SEM for three biological replicates.

Detection of SARS-CoV-2 variants with the original ΔH69/V70 probe based on the SARS-CoV-2 alpha variant sequence.

(A) Detection of SARS-CoV-2 variants with the original probe, including patient samples confirmed as SARS-CoV-2 Alpha variant as positive control and SARS-CoV-2 negative patient samples and a water as negative controls. (B) Samples were tested as multiplex RT-qPCRs; E-Sarbeco in parallel with the ΔH69/V70 RT-qPCR. Error bars in (A-B) indicate SEM for three biological replicates. The original ΔH69/V70 RT-qPCR (probe design based on the SARS-CoV-2 Alpha variant sequence) was able to detect the ΔH69/V70 mutation in Omicron confirmed samples (Fig 1A). However, the end fluorescence intensity was reduced about five times in Omicron BA.1 (265 RFU) compared to samples with SARS-CoV-2 Alpha (1407 RFU). Sequence analysis revealed a single C-to-T substitution at nucleotide position 21696 in the Omicron BA.1 sequence, resulting in a mismatch in the middle of ΔH69/V70 probe binding region, which led to the observed reduction of the fluorescence intensity. In order to detect the ΔH69/V70 mutation in all known SARS-CoV-2 variants, we designed a degenerate ΔH69/V70 probe (SARS-CoV-2_Δ69/70 P_Wob, Table 1). Replacing only the original probe targeting ΔH69/V70 with the degenerate probe led to almost a full recovery of the end fluorescence intensity (Fig 2A) in both SARS-CoV-2 variants (Alpha and Omicron) (Fig 2A). Specificity of the degenerate probe was confirmed by the lack of signal from SARS-CoV-2 variants lacking the H69/V70 deletion (SARS-CoV-2 WT, Delta, Omicron BA.2), as well as for the negative controls (Fig 2A). In order to discriminate between BA.1 and BA.2 sub-variants, we included a WT probe in the ΔH69/V70 RT-qPCR. All SARS-CoV-2 variants lacking the ΔH69/V70 (WT, Delta, Omicron BA.2) were detected correctly by the H69/V70 WT probe (Fig 2B).
Fig 2

Detection of SARS-CoV-2 variants with a degenerate ΔH69/V70 probe based on the SARS-CoV-2 BA.1 sequence.

(A) Detection of SARS-CoV-2 variants with a degenerate probe targeting the ΔH69/V70. The SARS-CoV-2 Alpha- and BA.1 variants were included as positive controls, and SARS-CoV-2 negative patient samples and a water as negative controls. (B) Detection of SARS-CoV-2 variants with the WT probe. SARS-CoV-2 WT, Delta and BA.2 variants were included as positive controls and SARS-CoV-2 negative patient samples and a water as negative controls.

Detection of SARS-CoV-2 variants with a degenerate ΔH69/V70 probe based on the SARS-CoV-2 BA.1 sequence.

(A) Detection of SARS-CoV-2 variants with a degenerate probe targeting the ΔH69/V70. The SARS-CoV-2 Alpha- and BA.1 variants were included as positive controls, and SARS-CoV-2 negative patient samples and a water as negative controls. (B) Detection of SARS-CoV-2 variants with the WT probe. SARS-CoV-2 WT, Delta and BA.2 variants were included as positive controls and SARS-CoV-2 negative patient samples and a water as negative controls. Moreover, the fluorescence intensity was moderately reduced for the degenerate probe compared to the original probe targeting the ΔH69/V70 present in the SARS-CoV-2 Alpha variant (TWIST control) (S1A Fig). However, the sensitivity of the ΔH69/V70 RT-qPCR was unchanged including the degenerate ΔH69/V70 probe instead of the original probe, as shown by a dilution row of the TWIST standard (Alpha variant) (Table 2; S1B Fig). The sensitivity of the original primer and probe of the ΔH69/V70 RT-qPCR was determined in a previous study [13].
Table 2

Threshold values (Ct) reported for the TWIST synthetic SARS-CoV-2 RNA quality control assayed with the original and degenerate ΔH69/70 probe in RT-qPCR.

SARS-CoV-2 lineageDilution factorOriginalDegenerate
ΔH69/V70 probeΔH69/V70 probe
(Ct value ± s.d.)(Ct value ± s.d.)
Alpha1 x 10−327.5±0.227.6±0.6
B.1.1.7
Alpha1 x 10−431.2±0.331.7±0.2
B.1.1.7
Alpha1 x 10−534.4±0.435.4±0.007
B.1.1.7
Alpha1 x 10−637.2±0.438.3±0.08
B.1.1.7
Alpha1 x 10−7>45> 38.6
B.1.1.7
NTC0>45>45

Values reported with a standard deviation are average of duplicates. Threshold value reported as “> 45” indicates no target detection, value reported as “>” indicates the lowest Ct value measured with one replicate > 45. NTC: No template control.

Values reported with a standard deviation are average of duplicates. Threshold value reported as “> 45” indicates no target detection, value reported as “>” indicates the lowest Ct value measured with one replicate > 45. NTC: No template control.

Large-scale performance confirmation of allelic discrimination RT-qPCR with degenerate ΔH69/V70 probe

The ΔH69/V70-WT RT-qPCR with the degenerate probe was validated on 745 RT-PCR-positive SARS-CoV-2 patient samples collected from the 3rd to 16th of January 2022 as part of the Danish national testing program. This period was selected since Omicron BA.1 and BA.2 sub-lineages were present in approximately equal proportions [10]. The H69/V70 deletion is not present in the SARS-CoV-2 variants Delta and Omicron BA.2; therefore the L452R RT-qPCR was included into the RT-qPCR large-scale screening platform [13, 16]. Running two RT-qPCRs, each directed against one specific key mutation, e.g. ΔH69/V70 and L452R, made it possible to detect four different variants (Table 3); WT at ΔH69/V70 without L452R mutation (characteristic for Omicron BA.2), WT at ΔH69/V70 with L452R mutation (characteristic for the Delta VOC), ΔH69/V70 without L452R mutation (characteristic for Omicron BA.1) and finally, ΔH69/V70 with L452R mutation (characteristic of BA.4 and BA.5 sub-lineages).
Table 3

SARS-CoV-2 variants and sub-lineages detected by the combination of ΔH69/V70 and L452R RT-qPCRs.

ΔH69/V70 RT-qPCRL452R RT-qPCR[WT]ΔH69/V70
probeprobe
[WT] probeOmicron BA.2Omicron BA.1
452R probeDeltaOmicron BA.4/BA5
Validation was performed by pairwise comparison of results from the Variant-PCR with WGS using the WGS consensus genome from the same samples as the reference standard. We obtained valid RT-qPCR results and a consensus genome sequence from each of the 745 selected SARS-CoV-2 PCR-positive patient samples. In total, 339 patient samples were characterized as BA.1 infections while 399 samples was identified as BA.2 by WGS analysis, showing a nearly even distribution between BA.1 and BA.2 genomes. The Delta genome was found in the last seven patient samples. The ΔH69/V70 mutation was detected by the degenerate ΔH69/V70 probe in 339 patient samples, which correlated 100% with Omicron BA.1 WGS confirmed samples (Fig 3). Furthermore, 406 SARS-CoV-2 positive clinical samples had a WT signal being either of Delta or Omicron BA.2 origin. Out of these 406 samples, seven were also found positive for the 452R mutation, characteristic for the Delta variant, which fully corresponded with the WGS results. The L452-WT sequence was detected in 738 out of the 745 patient samples corresponding to the total consensus sequences identified as Omicron by WGS, regardless of BA.1 and BA.2 sub-lineage identity. Thus, all samples correlated between the degenerate ΔH69/V70-WT RT-qPCR and WGS, demonstrating high specificity (>99.9%) and high sensitivity (>99.9%) in large-scale as well as small-scale settings.
Fig 3

Detection of ΔH69/V70 and L452R mutations in BA.1 and BA.2.

(A) Allelic discrimination analysis to differentiate between the H69/V70 deletion and the WT sequence. (B) Allelic discrimination analysis to differentiate between the 452R mutation and the L452 WT sequence.

Detection of ΔH69/V70 and L452R mutations in BA.1 and BA.2.

(A) Allelic discrimination analysis to differentiate between the H69/V70 deletion and the WT sequence. (B) Allelic discrimination analysis to differentiate between the 452R mutation and the L452 WT sequence. In summary, we developed a RT-qPCR system for rapid differentiation of Omicron BA.1 and BA.2 in large-scale, validated by comparison of RT-qPCR and WGS data from 745 patient samples analyzed in parallel.

Large-scale performance confirmation of BA.4 and BA.5 Omicron variants

The Danish national SARS-CoV-2 genomic surveillance system identified the first case of BA.4 in a sample from the 2nd of March, 2022 based on WGS. On the 15th of April, 2022, the first case of BA.5 case was detected. At this point in time, BA.2 accounted for more than 99% of all sequenced variants in Denmark [10]. The prevalence of BA.4 increased at a linear rate from 0.1% to 4.7% during the period from the 11th of April to 1st of June, 2022 with 327 identified BA.4 genomes in total. In contrast to BA.4, the prevalence of BA.5 increased more rapidly and on the 1st of June, 2022, 30.7% of all sequenced genomes from SARS-CoV-2 positive throat swabs were confirmed as BA.5 consensus sequences, with a total number of 1155 BA.5 cases [10]. Since BA.5 clearly was heading to replace BA.2 as the dominant SARS-CoV-2 lineage in Denmark, we investigated if our adapted RT-qPCR platform was able to detect Omicron BA.4 and BA.5 sub-variants as a group, since this RT-qPCR per se will not able to discriminate between them due to identical genomic sequences in the spike region. WGS data obtained from Danish BA.4 and BA.5 sequences revealed that 92.3% of BA.4 consensus sequences (180/195) and 97.6% of BA.5 consensus sequences (323/331) carried the ΔH69/V70 mutation. The prevalence of the mutation 452R is 93% and 98.8% in BA.4 and BA.5, respectively, which confirmed that nearly all BA.4 and BA.5 carry both signature mutations. Based on alignment of unique sequences, 84 BA.4 and 51 BA.5, respectively, the primers and probes in our L452R RT-qPCR had a complete match with all BA.4 sequences. Of the 51 analyzed BA.5 sequences, one showed an A-to-T substitution in the middle of the L452R probe-binding region, whereas the primer-binding regions were conserved. The BA.5 genomes had a perfect match to the primers and probe in the degenerate ΔH69/V70 RT-qPCR whereas a single nucleotide mismatch, an A-to-G substitution, located in the middle of the ΔH69/V70 forward primer (ACATTCAACTCGGGACTTGTTCT), was observed in 10 of the 84 investigated BA.4 sequences (12%). This mutation did however not abolish the detection of the ΔH69/V70 mutation (Fig 4A).
Fig 4

Detection of ΔH69/V70 and L452R mutations in BA.4 and BA.5.

(A) Allelic discrimination analysis to differentiate between the ΔH69/V70 mutation and the WT sequence. (B) Allelic discrimination analysis to differentiate between the 452R mutation and the L452 WT sequence.

Detection of ΔH69/V70 and L452R mutations in BA.4 and BA.5.

(A) Allelic discrimination analysis to differentiate between the ΔH69/V70 mutation and the WT sequence. (B) Allelic discrimination analysis to differentiate between the 452R mutation and the L452 WT sequence. Validation of the allelic ΔH69/V70-WT and the L452-WT discrimination RT-qPCRs were performed on 66 SARS-CoV-2 positive patient samples collected from 24th to 26th of May, 2022 at Danish community test facilities, covering a broad range of viral load with Ct-values between 16–33 in the initial E-Sarbeco RT-qPCR. Of these selected samples, 28 viral genomes were characterized as BA.4 and 38 as BA.5 by WGS. Results from our adapted Variant-PCR showed that all samples were double-positive for ΔH69/V70 and L452R, in accordance with either a BA.4 or BA.5 viral genotype (Fig 4). Similar Ct-values were obtained in the ΔH69/V70, L452R and E-Sarbeco RT-qPCRs, indicating that all three RT-qPCRs perform equally well with BA.4 and BA.5 variants, confirming high specificity of the degenerate ΔH69/V70 probe for an Alpha VOC-like sequence, and providing evidence for high specificity of this method for surveillance or large-scale studies. Furthermore, we observed no pronounced differences in amplification and detection of BA.4 viral genomes with a mismatch mutation in the sequence recognized by the ΔH69/V70 forward primer compared to patient samples with a conserved sequence (Fig 4). In summary, our adapted Variant-PCR could rapidly detect Omicron BA.4 and BA.5, and distinguish them from earlier BA.1 and BA.2 variants, validated by comparison of RT-qPCR and WGS data from 66 patient samples analyzed in parallel.

Discussion

Control of the pandemic caused by SARS-CoV-2 is challenged by the emergence of new variants, emphasizing the need for rapid and cost-effective detection methods that complement WGS in order to support control of transmission chains and assist public health response and decision-making. RT-qPCR is widely deployed in diagnostic virology [17]. In case of a public health emergency, laboratories can rely on this robust technology to establish new diagnostic tests for screening within their routine services before commercial assays become available. RT-qPCR strategies are of special interest in resource lean countries to complement WGS, the golden standard for SARS-CoV-2 variant surveillance. However, mutations in the targeting primer and probe sequences of new emerging variants can lead to a failure of the existing RT-qPCRs. Currently, most commercial kits for SARS-CoV-2 variant determination utilize a so-called S-gene target failure phenomenon [18], where a detected variant positive for the N and ORF1ab genes, but negative for S gene is interpreted as Omicron, due to the large number of mutations in the S gene of this particular variant. The BA.1 sub-lineage showed S-gene target failure in RT-qPCRs due to the presence of the ΔH69/V70 mutation, however, an S-gene target failure strategy may not be able to detect the Omicron BA.2 lineage, which is currently the dominant SARS-CoV-2 virus circulating worldwide, as BA.2 is missing this particular deletion. Recently, several single one-step RT-qPCRs reported for the specific detection of Omicron in clinical and environmental samples have been developed [19-21]. As Omicron continues to spread and evolve into several lineages and sub-lineages, these methods suffer, as they are not able to differentiate between multiple Omicron sub-lineages, although they have been described as highly specific and sensitive for Omicron. The allelic discrimination RT-qPCR uses four probes, targeting two signature mutations in parallel, and has a very high accuracy, enabling detection of known VOCs almost in real-time (within 24h) after sample collection. We provide evidence for simultaneous, large-scale detection of the L452R mutation and ΔH69/V70 deletion in the spike sequence, using a degenerate probe to detect and differentiate between circulating Omicron- and Delta variants. To the best of our knowledge, this is the first RT-qPCR platform for specific detection and discrimination of Omicron sub-variants using a degenerate probe. This strategy enables detection of a key deletion, ΔH69/V70, regardless of a single nucleotide substitution or not, and hence, increases the robustness of the RT-qPCR. The samples for large-scale performance evaluation were chosen to challenge the robustness of these RT-qPCRs since lineage replacement is expected to occur during a pandemic transition period; the BA.1 sub-variant and its signature mutation, ΔH69/V70 with a single nucleotide substitution, was replaced by BA.2 with a wildtype genotype at both targets, ΔH69/V70 and L452R. Later, the appearance of BA.4 and BA.5 variants was observed in an increasing number of patient samples being positive for both key mutations. In fact, Omicron being the predominant variant worldwide, negative results in allelic discrimination RT-qPCR, but positive in other SARS-CoV-2 methods targeting conserved elements of the SARS-CoV-2 genome such as E-Sarbeco, may indicate the emergence of novel potential VOCs with S-gene mutations in target regions hindering recognition by the primers and/or probes. In summary, after adapting our Variant-PCR platform with a degenerate ΔH69/V70 probe, we were able to detect the four most common Omicron variants in circulation, BA.1, BA.2, BA.4 and BA.5, as well as the Delta VOC, by combined analysis of two different signature mutations in parallel, ΔH69/V70 and L452R, validated by a comparison of paired RT-qPCR and WGS data. Furthermore, this method enables us to differentiate between Omicron and Delta VOCs, between BA.1 and BA.2 sub-lineages, and between BA.2 and emerging BA.4/BA.5 sub-lineages. If SARS-CoV-2 continues to evolve very contagious VOCs with potential to escape humoral immune response, which may lead to a new wave of COVID-19 infection, monitoring and screening might have to last for a prolonged period of time, making the use of degenerate probes an attractive strategy to adapt existing RT-qPCRs for SARS-CoV-2 detection.

SARS-CoV-2 alpha variant standard sample detected by the original and the degenerate probe.

(A) Dilution of the TWIST control standard (SARS-CoV-2 Alpha variant) to a concentration of 10−3 copies/μl detected by the original and the degenerate probe targeting the ΔH69/V70. (B) Dilution row of the TWIST control standard (SARS-CoV-2 Alpha variant) detected by the original and the degenerate probe targeting the ΔH69/V70. (TIF) Click here for additional data file. (TXT) Click here for additional data file. 12 Aug 2022
PONE-D-22-19692
A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) Variants of Concern
PLOS ONE Dear Dr. Spiess, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Sep 26 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Ruslan Kalendar Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information. If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information. 3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Reviewer #1: 1.Titles of X and Y axis in figure 3 and figure4 are the same probe L452, please check carefully. 2.No source information of BA.4 and BA.5 in material and method (Samples and controls), author should support this information. 3.Is there any founding in this study? Reviewer #2: Two separate tests targeting the ΔH69/V70 deletion and the L452R point mutation in the S-gene were developed and used with a previously developed assay (E-gene) for detecting and differentiating SARS-CoV-2 Alpha variant, Delta variant, and BA.1/2/4/5 sub-variants of the Omicron strains. The assay was validated with 745 positive clinical samples, and genotypes were confirmed by WGS. Most strains in Denmark, as well as in most part of the globe, are Omicron variants now, and BA.4 and BA.5 are the most dominant subtypes, with trace number of BA.2 strains. It looks like the L452R wild-type/Mutant assay will provide sufficient information for detection, as it can differentiate BA.1/BA.2 from the most prevalent strains of BA.4/BA.5. The differentiation of BA.2 from BA.1/4/5 using ΔH69/V70 deletion assay does not seems to be necessary. Additionally, the ΔH69/V70 assay, L452R assay and the E-gene assay are separate individual reactions. Taking one out will reduce the number of reactions for a given sample. The assays were well-validated with clinical samples, and compared to WGS results. Yet, there was no standard curve generated to determine PCR efficiencies, dynamic range of detection, and limit of detection. Table 2 provided data of 5 dilutions, but there was no mentioning of the original concentration, thus limit of detection in terms of copy-number cannot be assessed. PCR efficiency and correlation coefficient were not calculated either (By the way, “Concentration” in the table may have been mislabeled, and should be “Dilution factor”). There are many multiplex qPCR developed for SARS-CoV-2 detection and differentiation (J Clin Microbiol. 2021 Jul 19;59(8):e0085921; PLoS One. 2022 Mar 21;17(3):e0265748; Transbound Emerg Dis. 2022 Feb 26. https://doi.org/10.1111/tbed.14497; etc.). If authors can add the E-gene (E-Sarbeco) target into the L452R assay will further reduce the number of reactions, and thus detection cost. Authors have mentioned E848K assay (lines 142-144), but this assay was not mentioned in the rest of the manuscript, and no primer/probe information were given. In Supplementary Fig. 1, the original probe and the degenerate probe may have been mislabeled/switched. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Jianfa Bai ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
5 Sep 2022 Response to the reviewers We thank the reviewers for their enthusiasm for our study and replied in a step-by-step response below: Reviewer #1: 1.Titles of X- and Y axis in figure 3 and figure 4 are the same probe L452, please check carefully. Response: We thank the reviewer for pointing it out and corrected the y-axis in Figs 3A and 4A, accordingly. 2. No source information of BA.4 and BA.5 in material and method (Samples and controls), author should support this information. Response: We submitted the GISAID accessions IDs corresponding to the WGS-confirmed SARS-CoV Delta and Omicron patient samples included in this study for a better overview of the sequence information including the one for BA.4 and BA.5. During this process, we noticed that a total of nine sequences (four BA.4 and five BA.5) were not uploaded to GISAID for unknown reasons. These samples were used in our sequence alignments only and not in the RT-qPCRs, hence their exclusion from our study had no effect on our conclusions. We have corrected the manuscript as follows (line 269 -279): WGS data obtained from Danish BA.4 and BA.5 sequences revealed that 92.3% of BA.4 consensus sequences (180/195) and 97.6% of BA.5 consensus sequences (323/331) carried the ∆H69/V70 mutation. The prevalence of the mutation 452R is 93% and 98.8% in BA.4 and BA.5, respectively, which confirmed that nearly all BA.4 and BA.5 carry both signature mutations. Based on alignment of unique sequences, 84 BA.4 and 51 BA.5, respectively, the primers and probes in our L452R RT-qPCR had a complete match with all BA.4 sequences. Of the 51 analyzed BA.5 sequences, one showed an A-to-T substitution in the middle of the L452R probe-binding region, whereas the primer-binding regions were conserved. The BA.5 genomes had a perfect match to the primers and probe in the degenerate ∆H69/V70 RT-qPCR whereas a single nucleotide mismatch, an A-to-G substitution, located in the middle of the ∆H69/V70 forward primer (ACATTCAACTCGGGACTTGTTCT), was observed in 10 of the 84 investigated BA.4 sequences (12%). This mutation did however not abolish the detection of the ∆H69/V70 mutation (Fig 4A). At the time point of this study, BA.4 and BA.5 were up-coming variants in Denmark, and not yet dominant, hence no cultivated BA.4 or BA.5 virus isolates for use as positive control were available. Instead, virus isolates of Alpha variant B.1.1.7 and Delta variant B.1.617.2 were used as positive controls for the ∆H69/V70 and L452R key mutations, respectively. We tried to clarify it in the material and method part (line 108-115). 3. Is there any founding in this study? Response: The study was performed at the Statens Serum Institut, in collaboration with Test Center Denmark, which are part of the Danish National Surveillance System for SARS-CoV-2. Therefore, no external funding was received for this study. Reviewer #2: Two separate tests targeting the ΔH69/V70 deletion and the L452R point mutation in the S-gene were developed and used with a previously developed assay (E-gene) for detecting and differentiating SARS-CoV-2 Alpha variant, Delta variant, and BA.1/2/4/5 sub-variants of the Omicron strains. The assay was validated with 745 positive clinical samples, and genotypes were confirmed by WGS. Most strains in Denmark, as well as in most part of the globe, are Omicron variants now, and BA.4 and BA.5 are the most dominant subtypes, with trace number of BA.2 strains. It looks like the L452R wild-type/Mutant assay will provide sufficient information for detection, as it can differentiate BA.1/BA.2 from the most prevalent strains of BA.4/BA.5. The differentiation of BA.2 from BA.1/4/5 using ΔH69/V70 deletion assay does not seems to be necessary. Additionally, the ΔH69/V70 assay, L452R assay and the E-gene assay are separate individual reactions. Taking one out will reduce the number of reactions for a given sample. Response: The major aim of this study was to show that a degenerate probe can be incorporated into existing RT-qPCRs to rescue the PCR after a change of a SARS-CoV-2 variant and a potential primer and probe mismatch. However, we agree that a single PCR target could be enough to differentiate BA.1/BA.2 and BA.4/5, but we think that including an additional PCR target is of advantage as the 452R mutation has been detected in BA.1 and BA.2 variants. Thus, including ΔH69/V70 RT-qPCR into the screening helps to minimize false positive results. The assays were well-validated with clinical samples, and compared to WGS results. Yet, there was no standard curve generated to determine PCR efficiencies, dynamic range of detection, and limit of detection. Table 2 provided data of 5 dilutions, but there was no mentioning of the original concentration, thus limit of detection in terms of copy-number cannot be assessed. PCR efficiency and correlation coefficient were not calculated either (By the way, “Concentration” in the table may have been mislabeled, and should be “Dilution factor”). Response: We appreciated the input from the reviewer and changed it to dilution factor in the table. The ΔH69/V70 PCR efficiency has been determined in a previously study for the original ΔH69/V70 primers and probe (https://doi.org/10.1101/2021.10.25.2126548). We made this point more clear in the manuscript and wrote (line 206-211): Moreover, the fluorescence intensity was moderately reduced for the degenerate probe compared to the original probe targeting the ∆H69/V70 present in the SARS-CoV-2 Alpha variant (TWIST control) (S1-A Fig). However, the sensitivity of the ∆H69/V70 RT-qPCR was unchanged including the degenerate ∆H69/V70 probe instead of the original probe, as shown by a dilution row of the TWIST standard (Alpha variant) (S1-B Fig). The sensitivity of the original primer and probe of the ∆H69/V70 RT-qPCR was determined in a previous study (https://doi.org/10.1101/2021.10.25.2126548). There are many multiplex qPCR developed for SARS-CoV-2 detection and differentiation (J Clin Microbiol. 2021 Jul 19;59(8):e0085921; PLoS One. 2022 Mar 21;17(3):e0265748; Transbound Emerg Dis. 2022 Feb 26. https://doi.org/10.1111/tbed.14497; etc.). If authors can add the E-gene (E-Sarbeco) target into the L452R assay will further reduce the number of reactions, and thus detection cost. Response: In our large-scale screening setup, primary diagnosis of SARS-CoV-2 is performed in parallel with an E-Sarbeco singleplex assay. Positive samples are re-analyzed for variant typing in 384-well format (https://doi.org/10.1101/2021.10.25.2126548). In this setup we have chosen to repeat the original E-Sarbeco assay in singleplex as a quality control for the original diagnostic assay. A multiplex PCR of L452R and E-Sarbeco targets would require extensive, time-consuming validation, since even small differences in sensitivity, could affect diagnostics, given the large numbers of sample processed in the Danish testing system. However, in small-scale we think it would be a good idea to run these PCRs as multiplex PCR with the L452R and E-Sarbeco PCR in one run, but this was out of the aim of this study. Authors have mentioned E848K assay (lines 142-144), but this assay was not mentioned in the rest of the manuscript, and no primer/probe information were given. Response: We apologize and deleted this information from the method part, as this assay was not included into this study. In Supplementary Fig. 1, the original probe and the degenerate probe may have been mislabeled/switched. Response: We thank the reviewer for pointing this mistake out, but we checked the Supplementary Fig. 1 carefully and we could not find the mistake. In the Supplementary Fig. 1A, the degenerate ∆H69/V70 probe shows a reduced fluorescence intensity on the TWIST Alpha variant standard (10-3 copies/µl) compared to the original ∆H69/V70 probe. In contrast, the degenerate probe shows a better fluorescence intensity detecting SARS-CoV-2 BA.1 variants from patient samples than the original probe as shown in Fig. 1 and Fig.2. Submitted filename: Response to the reviewers_KS_VG_NIBL_RAJE_20220823_final.docx Click here for additional data file. 7 Sep 2022 A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) Variants of Concern PONE-D-22-19692R1 Dear Dr. Spiess, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Ruslan Kalendar Academic Editor PLOS ONE 12 Sep 2022 PONE-D-22-19692R1 A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) Variants of Concern Dear Dr. Spiess: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Professor Ruslan Kalendar Academic Editor PLOS ONE
  13 in total

1.  SARS-CoV-2 wastewater monitoring using a novel PCR-based method rapidly captured the Delta-to-Omicron ΒΑ.1 transition patterns in the absence of conventional surveillance evidence.

Authors:  Taxiarchis Chassalevris; Serafeim C Chaintoutis; Michalis Koureas; Maria Petala; Evangelia Moutou; Christina Beta; Maria Kyritsi; Christos Hadjichristodoulou; Margaritis Kostoglou; Thodoris Karapantsios; Agis Papadopoulos; Nikolaos Papaioannou; Chrysostomos I Dovas
Journal:  Sci Total Environ       Date:  2022-06-24       Impact factor: 10.753

2.  A qualitative RT-PCR assay for the specific identification of the SARS-CoV-2 B.1.1.529 (Omicron) Variant of Concern.

Authors:  Philippe Corbisier; Mauro Petrillo; Antonio Marchini; Maddalena Querci; Gerhard Buttinger; Meriem Bekliz; Katja Spiess; Charlotta Polacek; Anders Fomsgaard; Guy Van den Eede
Journal:  J Clin Virol       Date:  2022-05-24       Impact factor: 14.481

3.  Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR.

Authors:  Victor M Corman; Olfert Landt; Marco Kaiser; Richard Molenkamp; Adam Meijer; Daniel Kw Chu; Tobias Bleicker; Sebastian Brünink; Julia Schneider; Marie Luisa Schmidt; Daphne Gjc Mulders; Bart L Haagmans; Bas van der Veer; Sharon van den Brink; Lisa Wijsman; Gabriel Goderski; Jean-Louis Romette; Joanna Ellis; Maria Zambon; Malik Peiris; Herman Goossens; Chantal Reusken; Marion Pg Koopmans; Christian Drosten
Journal:  Euro Surveill       Date:  2020-01

Review 4.  Use of emerging testing technologies and approaches for SARS-CoV-2: review of literature and global experience in an Australian context.

Authors:  Maryza Graham; Susan A Ballard; Shivani Pasricha; Belinda Lin; Tuyet Hoang; Timothy Stinear; Julian Druce; Mike Catton; Norelle Sherry; Deborah Williamson; Benjamin P Howden
Journal:  Pathology       Date:  2021-08-10       Impact factor: 5.306

5.  Increased immune escape of the new SARS-CoV-2 variant of concern Omicron.

Authors:  Jie Hu; Pai Peng; Xiaoxia Cao; Kang Wu; Juan Chen; Kai Wang; Ni Tang; Ai-Long Huang
Journal:  Cell Mol Immunol       Date:  2022-01-11       Impact factor: 11.530

6.  Omicron extensively but incompletely escapes Pfizer BNT162b2 neutralization.

Authors:  Sandile Cele; Laurelle Jackson; David S Khoury; Khadija Khan; Thandeka Moyo-Gwete; Houriiyah Tegally; James Emmanuel San; Deborah Cromer; Cathrine Scheepers; Daniel G Amoako; Farina Karim; Mallory Bernstein; Gila Lustig; Derseree Archary; Muneerah Smith; Yashica Ganga; Zesuliwe Jule; Kajal Reedoy; Shi-Hsia Hwa; Jennifer Giandhari; Jonathan M Blackburn; Bernadett I Gosnell; Salim S Abdool Karim; Willem Hanekom; Anne von Gottberg; Jinal N Bhiman; Richard J Lessells; Mahomed-Yunus S Moosa; Miles P Davenport; Tulio de Oliveira; Penny L Moore; Alex Sigal
Journal:  Nature       Date:  2021-12-23       Impact factor: 49.962

7.  Increased transmissibility of SARS-CoV-2 lineage B.1.1.7 by age and viral load.

Authors:  Frederik Plesner Lyngse; Kåre Mølbak; Robert Leo Skov; Lasse Engbo Christiansen; Laust Hvas Mortensen; Mads Albertsen; Camilla Holten Møller; Tyra Grove Krause; Morten Rasmussen; Thomas Yssing Michaelsen; Marianne Voldstedlund; Jannik Fonager; Nina Steenhard; Carsten Thure Kirkeby
Journal:  Nat Commun       Date:  2021-12-13       Impact factor: 14.919

Review 8.  Spike protein of SARS-CoV-2 variants: a brief review and practical implications.

Authors:  Kattlyn Laryssa Candido; Caio Ricardo Eich; Luciana Oliveira de Fariña; Marina Kimiko Kadowaki; José Luis da Conceição Silva; Alexandre Maller; Rita de Cássia Garcia Simão
Journal:  Braz J Microbiol       Date:  2022-04-09       Impact factor: 2.214

9.  SARS-CoV-2 RNA stability in dry swabs for longer storage and transport at different temperatures.

Authors:  Alonzo Alfaro-Núñez; Stephanie Crone; Shila Mortensen; Maiken Worsøe Rosenstierne; Anders Fomsgaard; Ellinor Marving; Sofie Holdflod Nielsen; Michelle Grace Pinto Jørgensen; Charlotta Polacek; Arieh S Cohen; Claus Nielsen
Journal:  Transbound Emerg Dis       Date:  2021-10-11       Impact factor: 4.521

10.  Molecular epidemiology of the SARS-CoV-2 variant Omicron BA.2 sub-lineage in Denmark, 29 November 2021 to 2 January 2022.

Authors:  Jannik Fonager; Marc Bennedbæk; Peter Bager; Jan Wohlfahrt; Kirsten Maren Ellegaard; Anna Cäcilia Ingham; Sofie Marie Edslev; Marc Stegger; Raphael Niklaus Sieber; Ria Lassauniere; Anders Fomsgaard; Troels Lillebaek; Christina Wiid Svarrer; Frederik Trier Møller; Camilla Holten Møller; Rebecca Legarth; Thomas Vognbjerg Sydenham; Kat Steinke; Sarah Juel Paulsen; José Alfredo Samaniego Castruita; Uffe Vest Schneider; Christian Højte Schouw; Xiaohui Chen Nielsen; Maria Overvad; Rikke Thoft Nielsen; Rasmus L Marvig; Martin Schou Pedersen; Lene Nielsen; Line Lynge Nilsson; Jonas Bybjerg-Grauholm; Irene Harder Tarpgaard; Tine Snejbjerg Ebsen; Janni Uyen Hoa Lam; Vithiagaran Gunalan; Morten Rasmussen
Journal:  Euro Surveill       Date:  2022-03
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.