Hamidreza Totonchi1, Pooneh Mokarram2, Saeed Karima1, Ramazan Rezaei3, Sanaz Dastghaib4, Farhad Koohpeyma4, Shokoofe Noori5, Negar Azarpira6. 1. Department of Clinical Biochemistry, School of Medicine, Shahid Beheshti University of Medical Science, Tehran, Iran. 2. Autophagy Research Center, Department of Biochemistry, Shiraz University of Medical Sciences, Shiraz, Iran. 3. Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 4. Endocrinology and Metabolism Research Center, Shiraz University of Medical Sciences, Shiraz, Iran. 5. Department of Clinical Biochemistry, School of Medicine, Shahid Beheshti University of Medical Science, Tehran, Iran. Shnoori85@yahoo.com. 6. Shiraz Transplant Research Center, Namazi Hospital, Shiraz University of Medical Sciences, Shiraz, Iran. Negarazarpira@gmail.com.
Abstract
BACKGROUND: Ischemia-reperfusion (I/R) of the liver is a multifactorial condition that happens during transplantation and surgery. The deleterious effects of I/R result from the acute production of reactive oxygen species (ROS), which can trigger immediate tissue damage and induce a series of destructive cellular responses, including apoptosis organ failure and inflammation. The production of ROS in the I/R process can damage the antioxidant system and cause liver damage. Resveratrol has been shown to have antioxidant properties in several investigations. Here, we address the therapeutic effect of resveratrol on I/R-induced liver injury by focusing on unfolded protein response (UPR) signaling pathway. METHODS: Five minutes before reperfusion, resveratrol was injected into the tail vein of mice. They were ischemic for 1 h and then re-perfused for 3 h before being slaughtered (I/R). The activity of liver enzymes and the expression levels of genes involved in the unfolded protein response pathway were used to measure the hepatic damage. RESULTS: Our results revealed that the low dose of resveratrol (0.02 and 0.2 mg/kg) post-ischemic treatment significantly reduced the ALT and AST levels. In addition, compared with the control group, the expression of UPR pathway genes GRP78, PERK, IRE1α, CHOP, and XBP1 was significantly reduced in the resveratrol group. In the mice that received lower doses of resveratrol (0.02 and 0.2 mg/kg), the histopathological changes induced by I/R were significantly improved; however, the highest dose (2 mg/kg) of resveratrol could not significantly protect and solve the I/R damage. CONCLUSION: The findings of this study suggest that hepatic ischemia occurs after liver transplantation and that receiving low-dose resveratrol treatment before reperfusion may promote graft survival through inhibition of UPR arms, especially PERK and IRE1α.
BACKGROUND: Ischemia-reperfusion (I/R) of the liver is a multifactorial condition that happens during transplantation and surgery. The deleterious effects of I/R result from the acute production of reactive oxygen species (ROS), which can trigger immediate tissue damage and induce a series of destructive cellular responses, including apoptosis organ failure and inflammation. The production of ROS in the I/R process can damage the antioxidant system and cause liver damage. Resveratrol has been shown to have antioxidant properties in several investigations. Here, we address the therapeutic effect of resveratrol on I/R-induced liver injury by focusing on unfolded protein response (UPR) signaling pathway. METHODS: Five minutes before reperfusion, resveratrol was injected into the tail vein of mice. They were ischemic for 1 h and then re-perfused for 3 h before being slaughtered (I/R). The activity of liver enzymes and the expression levels of genes involved in the unfolded protein response pathway were used to measure the hepatic damage. RESULTS: Our results revealed that the low dose of resveratrol (0.02 and 0.2 mg/kg) post-ischemic treatment significantly reduced the ALT and AST levels. In addition, compared with the control group, the expression of UPR pathway genes GRP78, PERK, IRE1α, CHOP, and XBP1 was significantly reduced in the resveratrol group. In the mice that received lower doses of resveratrol (0.02 and 0.2 mg/kg), the histopathological changes induced by I/R were significantly improved; however, the highest dose (2 mg/kg) of resveratrol could not significantly protect and solve the I/R damage. CONCLUSION: The findings of this study suggest that hepatic ischemia occurs after liver transplantation and that receiving low-dose resveratrol treatment before reperfusion may promote graft survival through inhibition of UPR arms, especially PERK and IRE1α.
Cases of end-stage liver disease are common worldwide [1]. The only treatment option for these patients is liver transplantation [2]. Ischemia-reperfusion injury (I/R) is a phenomenon with multiple causes, which occurs during transplantation and often impairs early transplantation function after liver transplantation (LT) [3]. Because liver cells are the primary source of multiple metabolic pathways and have a high basal-specific metabolic rate, they are more vulnerable to the exacerbating effects of ischemia, such as hypoxia and ATP depletion [4]. The destructive effect of I/R stems from generating reactive oxygen species abruptly after re-oxygenation, damaging tissues directly, and triggering a series of destructive cellular reactions, resulting in apoptosis, inflammation, and organ failure [5]. A deficiency of ATP causes major intracellular organelles to dysfunction and triggers stress responses, e.g., endoplasmic reticulum (ER) stress response [6]. The endoplasmic reticulum plays a role in calcium homeostasis, lipid biosynthesis, and correct protein folding, helping the inhibition of the accumulation of unfolded and misfolded proteins in the ER [7].Endoplasmic reticulum stress is a condition caused by ER malfunction (ERS). In this circumstance, the proper balance between protein synthesis and protein folding in the ER is broken. Depending on the severity and duration of the stress, several compensatory processes, such as the unfolded protein response (UPR), activate the adaptive defense systems [8, 9]. The unfolded protein response (UPR) is a defensive mechanism activated by ERS that inhibits the protein translation, destroys the misfolded proteins, and activates the signaling pathways that boost the synthesis of molecular chaperones involved in protein folding [10]. UPR is activated when misfolded or unfolded proteins accumulate in the endoplasmic reticulum lumen [11, 12]. It is worth mentioning that cell death occurs under excessive stress and when the adaptive pathways fail to compensate for the ER normal function [13, 14]. In mammals, UPR consists of three specific sensors or arms located on the outer membrane of ER in association with GRP78. The ER stress response is regularly monitored by three specific UPR sensors, including inositol-requiring enzyme 1α (IRE1α) and IRE1β, protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK), and activated transcription factor 6 (ATF6; α and β are the same species) [15]. GRP78 (78 kD glucose-regulated protein), also named immunoglobulin binding protein (BiP)—master ER chaperone—binds to the abovementioned sensors and inhibits their activation under normal conditions [16, 17]. When unfolded proteins accumulate in the ER, GRP78 dissociates from ATF6, IRE1, and PERK arms. This separation leads to the release of these ER sensors and activates the UPR pathway [18]. In the presence of ER stress, activated PERK dissociates from GRP78 and phosphorylates eukaryotic initiation factor 2 (eIF2) to relieve ER pressure. Dissociated PERK then inhibits the translation of extracytoplasmic mRNA and prevents newly synthesized proteins from entering the ER. Furthermore, activated IRE-1 has an effect on the X-box-binding protein (XBP-1) mRNA transcription factor via endonuclease activity. XBP-1 regulates the expression of several genes involved in the ER quality control, ERAD (ER-related degradation), and apoptosis when it is spliced and activated [19]. Finally, activated ATF6 is disassociated from GRP78 and transported to the Golgi organelle. The transported ATF6 is then activated by site 1 and site 2 (SP) proteases via regulated intramembrane proteolysis (RIP). The activated ATF6 cytoplasmic domain (50 kDa) is translocated to the nucleus and increases the levels of ER chaperones, XBP-1, and protein folding [12, 20]. The activation of these arms also contributes to cell growth suppression by inducing C/EBP homologous protein (CHOP), a DNA damage-inducible protein (GADD34), and pro-apoptotic BCL-2 family proteins. Overall, UPR has two faces in various situations based on the cellular nature, intensity, and time to cope with stress; they are cell-protective and cell-cytotoxic roles [21, 22]. In the recent decade, researchers have begun to search for new drug discovery and strategies for therapeutic interventions based on endoplasmic reticulum stress. ER stress and UPR are associated with such complications such as inflammation, neurodegenerative diseases, metabolic syndrome, and cancer [9, 21]. It has been shown that the ectopic expression of activated ATF6 can reduce the damage to the heart caused by of I/R. ATF6 reduces the I/R damage by regulating the expression of the antioxidant genes including catalase, peroxiredoxin 5 (Prdx5), and Vimp as selenoprotein, especially by reducing the ROS levels [23]. Recent studies have shown that UPR pathways are activated in two phases when livers are re-perfused, as during the ischemic phase, IRE-1 is induced and PERK and eIF2α are inhibited before these effects are reversed during reperfusion [24].Resveratrol (trans-3,49,5-trihydroxystilbene) is a plant-derived polyphenolic compound which is found abundantly in various plant species such as grapes that have attracted great interest from researchers due to its anti-cancer, anti-aging, anti-neurodegenerative, and anti-inflammatory properties [25]. To date, several clinical trials have tested the efficacy, safety, and pharmacokinetics of resveratrol in the prevention and treatment of different pathological conditions (www.ClinicalTrials.gov). Most of these studies have tested resveratrol-mediated effects in central nervous system disorders and metabolic disorders including insulin resistance, dyslipidemia, and non-alcoholic fatty liver disease (NAFLD). It was shown to be involved in the activation of macrophages, T cells, and natural killer cells [26]. All these effects are due to its ability to remove the ROS, inhibit cyclooxygenase (COX), and trigger anti-inflammatory pathways via SIRT1 activation [27]. The Sirtuin 1 (SIRT1) gene encodes a nicotinamide adenosine dinucleotide (NAD)-dependent histone deacetylase that is involved in a variety of biological processes such as longevity, stress response, and cell survival. SIRT1 activated by RSV reduces the expression of inflammatory factors such as TNFa, IL-1b, IL-6, metalloprotease (MMP)-1, MMP-3, and NFkB-mediated Cox-2 [27]. Resveratrol protects the hepatic cells against experimental ischemia-reperfusion injury by suppressing the expression of hypoxia-inducible factor (HIF1α) and vascular endothelial growth factor (VEGF) [28]. Previous reports have demonstrated that resveratrol suppresses the nuclear translocation of NF-κB in the rat hepatocytes (BRL-3A) cells and decreases the TNF-α and IL-1β production in vitro and in vivo [29]. Resveratrol has been shown to have a significant effect on endoplasmic reticulum stress regulation, but this effect is highly complex [30]. RSV plays a role in inducing the stress of the endoplasmic reticulum to promote apoptosis of cancer cells. Other studies have shown that RSV can improve cardio-myocyte hypertrophy by inhibiting ER stress [31]. Moreover, resveratrol can prevent hepatic steatosis and endoplasmic reticulum stress in rats fed with a high-fat diet [32].SIRT1 deacetylates XBP1 and inhibits its transcriptional activity to promote ER stress-induced apoptosis, and SIRT1 suppresses the PERK-eIF2-dependent translational inhibition in mammals, according to recent findings [12-14]. In liver cells, sirtuin 1 (SIRT1) which is a negative regulator of UPR signaling [33] leads to the reduction of ER stress by preventing UPR overactivation, induces ER chaperone expression, and inhibits the pro-apoptotic activity of UPR targets [34]. Thus, it may mean that SIRT1 can be regulated through specific SIRT1 activators, e.g., resveratrol (3, 5, 4′trihydroxystilbene; RSV), to restore ER homeostasis [35]. Although the antioxidant effect of resveratrol has been evaluated in multiple studies [36-38], few studies have demonstrated the effect of resveratrol on the UPR pathway. Therefore, this study aims to evaluate the effects of resveratrol on ischemia/reperfusion injury and UPR pathways and its specific arms to ultimately improve the success rate of liver transplantation.
Materials and methods
Animals
Male BALB/c mice obtained from Shiraz Medical University Transgenic Research Center were used in this study. The mice were kept in the laboratory for 1 week to adapt to the laboratory conditions. The animals were raised, treated, and handled exactly based on the ethical treatment and animal handling program of the Institutional Ethics Committee and Research Advisory Committee of Shiraz University of Medical Sciences (IR.SBMU.MSP.REC.1397.836).
Ischemia-reperfusion (I/R)
The mice were anesthetized by IP (intraperitoneal) injection of 100 mg/kg ketamine and 10 mg/kg xylazine [39]. After a midline abdominal incision, partial ischemia was achieved by clamping the portal vein and hepatic artery supplying the middle and left lobes (about 70% of the liver parenchyma) for 1 h. Occlusion of these vein and artery caused an immediate change in liver color to a lighter hue. The clamp was then removed to allow the tissue to be re-perfused. Next, the skin and muscle tissue were stitched together during the reperfusion process. The animals were sacrificed 3 h after reperfusion [40]. The left and middle lobes of the liver were removed and stored at −80°C.
Principal materials
Rabbit and mouse primary antibodies against human, namely GRP78 and IRE1α, were provided by the Cell Signaling Technology, Co. (Beverly, MA, USA). Resveratrol (Cas Number: 501-36-0) was purchased from Sigma-Aldrich Co. (Oakville, ON, Canada). GAPDH was prepared from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA), and anti-rabbit IgG (whole molecule) and anti-mouse immunoglobulin G (IgG) (Fab specific) as secondary antibodies were provided by Sigma-Aldrich (Oakville, ON, Canada). The bicinchoninic acid (BCA) protein assay kit was provided by Thermo Fisher Scientific (Winnipeg, MB, Canada).The enhanced chemiluminescence (ECL) western blot (high sensitivity) substrate kit (ab133406) was obtained from Abcam (Cambridge, MA, USA).
Administration of resveratrol
Dimethyl sulfoxide (DMSO) was used to dissolve resveratrol [41] in different concentrations (0.02, 0.2, 2.0 mg/kg) [40] and injected into the mouse tail vein 5 min before reperfusion. The mice underwent 1 h of ischemia and were sacrificed after 3 h of reperfusion (I/R). Afterwards, the mice were randomly divided into 5 separated groups (Table 1). We put 5 mice in each group and selected the minimum number of mice based on “resource equation method” and the formula (E=total number of animals-total number of groups) [42].
Table 1
The study design
Groups
Number of mice
Details
I
5
Ischemia for 1-h mi followed by reperfusion for 3 h (I/R)
II
5
I/R+ Dmso
III
5
Mice were treated with 2 mg/kg resveratrol
IV
5
Mice were treated with 0.2 mg/kg resveratrol
V
5
Mice were treated with 0.02 mg/kg resveratrol
The study design
Blood sampling
Blood samples were collected from the heart 3 h after reperfusion. The samples were centrifuged (3500 rpm, 4°C for 10 min), and the plasma was kept at −20°C. Evaluation of liver damage was done by measuring the activity of cytolytic enzymes in plasma-aspartate aminotransferase (AST) and alanine transaminase (ALT) using diagnostic colorimetric kits (BioSystem, Spain) by prestige instrument (Hitachi Japan).
Total RNA isolation and real-time PCR analysis
According to the manufacturer’s protocol, the total RNA was extracted from the liver using RNAiso Plus reagent (TaKaRa Biotechnology, Dalian, Liaoning, China) and stored at −75°C. We used BioFact cDNA synthesis kit (Biofact, Daejeon, Korea) to synthesize cDNA. Table 2 provides specific primer sets for target genes. The expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 were performed by applying SYBR Green Master Mix on a RotorGene Q real-time PCR machine (Qiagen, Hamburg, Germany). In short, a total volume of 20 μl in a 0.2-ml test tube was run at 95°C for 30s, and then, 40 cycles were performed at 95°C for 20s and 60°C for 40 s. Each experiment was repeated 3 times. The expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 were standardized to the GAPDH genes as housekeeping genes by applying the 2-ΔΔCt method.
Table 2
The sequence of primer sets applied for real-time PCR assays
The sequence of primer sets applied for real-time PCR assaysF- CCAGCGACAAGCAACCAAAGR- AGCTGCTGTACTGTGAGGATGF-GATGCCTTGGGAGTCAGACCR-ATGGAGCAACTGGAGGAAGCF- AGAGATAGATGGGTGGCAAAAR: ATTCGTCCATCTAAAGTGCTGF- GGAGCAGCAAGTGGTGGATTR- ATCCAGCGTGTCCATTCCCF- CTGGAAGCCTGGTATGAGGATR- CAGGGTCAAGAGTAGTGAAGGT
Western blot assay
Frozen liver samples were homogenized in a lysis buffer in the presence of proteinase inhibitors to isolate total liver protein. Total protein was extracted and lysed by applying NP40 Lysis Buffer [30]. The bicinchoninic acid method was used to quantify the collected protein. Depending on the type of protein, 20 to 40μg of total protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and electroblotted onto a 0.2-μm nitrocellulose membrane. Subsequently, the membrane was blocked by applying 5% free milk and incubated with primary antibodies (IRE1α, GRP78, GAPDH) overnight at 4°C. Subsequently, the membranes were treated for 60 min at 25°C with horseradish peroxidase (HRP)-conjugated secondary antibody. Finally, protein bands were observed by incubating the membrane with enhanced chemiluminescence (ECL) reagents and detected using the ChemiDoc™ MP imaging system (BioRad, USA). The intensity of the band was quantified using Image lab software, and all blots were standardized to GAPDH as an internal control protein.
Histological analyses
For histopathological evaluation, liver sections were fixed with formalin (10%) and then dehydrated with ethanol. In the next step, the fixed sample was embedded in paraffin and cut into 5-μm wide sections. Tissue samples were de-paraffinized in xylene, and finally, hematoxylin-eosin (H&E) staining was used to assess hepatocyte vacuolation, sinusoidal congestion, and focal parenchyma inflammation [40]. Histopathological sections were evaluated according to Suzuki’s histologic grading [43]. The degree of cytoplasmic vacuolization, sinusoidal congestion, and parenchymal necrosis was scored from 0 to 4 as previously described [44]: 0=none, 1=mild, 2=moderate, 3=marked, and 4=severe to diffuse.
Statistics
The results are shown as mean ± SEM. Based on the results of the normal test, a parametric test, or a nonparametric test, was applied to compare different groups (control, DMSO, RES 0.02, RES 0.2, and RES 2). One-way ANOVA was applied to compare the variables between the treated and control groups. Tukey’s post hoc test was applied for parametric test, and Kruskal-Wallis post hoc was used for non-parametric analysis. On the other hand, for western blot analysis, one-way ANOVA post hoc Bonferroni was done. The results were analyzed using SPSS (version 24, Chicago, IL, USA) and Graph pad Prism 6.07 software. The statistical significance thresholds were established as P<0.05.
Results
Effect of resveratrol on liver injury caused by hepatic ischemia-reperfusion
The release of ALT and AST into plasma reflects the hepatic injury. Three hours after reperfusion, evaluation of plasma levels of ALT and AST revealed that there was no significant association between I/R+Res 2 group and I/R + DMSO and I/R groups. However, post-ischemic treatment with low doses of resveratrol (0.02 and 0.2 mg/kg) significantly decreased the levels of ALT and AST compared to I/R, I/R + DMSO, and I/R+Res 2 groups (Fig. 1).
Fig. 1
The effect of resveratrol on the serum ALT and AST levels after I/R. Resveratrol was injected into the tail vein of the mouse 5 min before reperfusion. The mice underwent 1 h of ischemia and were sacrificed after 3 h of reperfusion (I/R). Data are expressed as mean ± SD. According to the Tukey post hoc test used for the comparison between groups, the groups with the same superscript letters did not have significant differences when α = 0.05 (p ≥ .05). Thus, various letters show considerable differences (p <0.05)
The effect of resveratrol on the serum ALT and AST levels after I/R. Resveratrol was injected into the tail vein of the mouse 5 min before reperfusion. The mice underwent 1 h of ischemia and were sacrificed after 3 h of reperfusion (I/R). Data are expressed as mean ± SD. According to the Tukey post hoc test used for the comparison between groups, the groups with the same superscript letters did not have significant differences when α = 0.05 (p ≥ .05). Thus, various letters show considerable differences (p <0.05)
Effect of resveratrol on the mRNA expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 in ischemia-reperfusion injury
For the evaluation of the effect of different doses of resveratrol on the genes involved in the UPR pathway, real-time PCR was used. Gene expression of GRP78, PERK, CHOP, and XBP1 was significantly decreased in the resveratrol groups (0.02, 0.2, and 2 mg/kg) compared with the IR and IR+DMSO groups (p<0.01). In addition, the effect of resveratrol at a lower dose was significantly greater than at a higher dose. In fact, expression of GRP78, PERK, CHOP, and XBP1 was significantly higher in the group receiving resveratrol at a dose of 2 mg/kg (Res 2mg/kg) compared to the other treatment groups (Res 0.2mg/kg and Res 0.02mg/kg) (p<0.05) (Fig. 2A–E). However, none of the treated doses of resveratrol had any effect on ATF6α expression in the treatment groups, and a comparison between different treatment groups and control groups did not reach a statistically significant threshold (Fig. 2B).
Fig. 2
The impact of resveratrol on the expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 after I/R. Control group, DMSO, 0.02, 0.2, and 2 I/R: The mice were sacrificed after 1 h of ischemia and reperfusion (I/R) for 3 h. Data are expressed as mean ± SD. One-way analysis of variance is used to compare the groups with the same superscript letters, which are not significantly different when α = 0.05 (p ≥ 0.05). However, various letters show considerable differences (p <0.05)
The impact of resveratrol on the expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 after I/R. Control group, DMSO, 0.02, 0.2, and 2 I/R: The mice were sacrificed after 1 h of ischemia and reperfusion (I/R) for 3 h. Data are expressed as mean ± SD. One-way analysis of variance is used to compare the groups with the same superscript letters, which are not significantly different when α = 0.05 (p ≥ 0.05). However, various letters show considerable differences (p <0.05)
Effect of resveratrol on the protein level of IRE1α and GRP78
After ischemia-reperfusion, the protein levels of IRE1α and GRP78, as a master regulator of the UPR pathway, were determined by immunoblotting (Fig. 3A). The results of immunoblotting revealed that resveratrol at all three doses (0.02, 0.2, and 2 mg/kg) significantly reduced IRE1α protein levels compared to IR and IR+DMSO groups (Fig. 3B). Moreover, in line with the real-time PCR results, resveratrol at lower doses (0.02 and 0.2 mg/kg) significantly decreased the protein level of GRP78 (Fig. 3C). However, a high dose (2 mg/kg) of resveratrol had no significant effect on the protein level of GRP78 compared to IR and IR+DMSO groups. There was no significant difference between IRE1α and GRP78 expression levels in the I/R group compared to I/R +DMSO groups.
Fig. 3
Results of Western blot analysis. A IRE1α and GRP78 protein levels in different experimental groups. GAPDH is applied as a load control. B, C Densitometric analysis of Western blot bands used to quantify the amount of IRE1α and GRP78 protein. The intensity of the IRE1α and GRP78 band signal quantified by the ImageJ software is expressed as a ratio to GAPDH. Data are expressed as mean ± SD. (a, b, c, d) According to the post hoc Tukey test for comparison between groups, the groups with the same superscript letter do not have a significant difference when α = 0.05 (p ≥ .05). However, different letters show considerable differences (p <0.05)
Results of Western blot analysis. A IRE1α and GRP78 protein levels in different experimental groups. GAPDH is applied as a load control. B, C Densitometric analysis of Western blot bands used to quantify the amount of IRE1α and GRP78 protein. The intensity of the IRE1α and GRP78 band signal quantified by the ImageJ software is expressed as a ratio to GAPDH. Data are expressed as mean ± SD. (a, b, c, d) According to the post hoc Tukey test for comparison between groups, the groups with the same superscript letter do not have a significant difference when α = 0.05 (p ≥ .05). However, different letters show considerable differences (p <0.05)
Histopathological analysis
After 3 h of reperfusion, the animals were sacrificed, and liver specimens were sent for pathological evaluation. After ischemic perfusion, the main histological findings were sinusoidal congestion, vacuolation of hepatocytes, and focal parenchyma inflammation (Fig. 4A, B, and F). In addition, in the IR and IR+DMSO groups, the infiltration of inflammation and inflammatory cells into the sinusoids was obvious. Severe hepatocyte vacuolation, sinusoidal congestion, and focal parenchyma inflammation were observed in the IR group (Fig. 4A). In the group which received lower doses of resveratrol (0.02 and 0.2 mg/kg), these histopathological changes were significantly improved (Fig. 4C, D, and F) (p <0.05). However, higher doses (2 mg/kg) of resveratrol did not have a significant protective effect in solving the I/R injury of the treated mice (Fig. 4E). As depicted in Fig. 4F, low doses of resveratrol (0.02 and 0.2 mg/kg) significantly decreased the focal inflammation compared to 2 mg/kg of resveratrol. It has been shown that 0.2 mg/kg resveratrol declined the number of Kupffer cells compared to the dose of 2 mg/kg. The score of histopathological changes of sinusoidal congestion, vacuolation of hepatocytes, focal inflammation, and the number of Kupffer cells was shown in Fig. 4G.
Fig. 4
Evaluation of the effect of resveratrol on the liver injury after I/R by histopathological analysis. In mice in the IR and IR + DMSO groups (A, B), obvious sinusoidal congestion, vacuolation of the hepatocytes, and focal parenchyma inflammation were obvious. Mice with mild sinusoidal dilation received resveratrol at 0.02 and 0.2 mg/kg. Abnormal histopathological changes in the resveratrol group (C, D) were significantly improved. A higher dose (2 mg/kg) of resveratrol did not have a significant protective effect on the treatment of I/R injury in mice (E). Low doses of resveratrol significantly decreased the focal inflammation compared to 2 mg/kg of resveratrol (F). The score of histopathological changes (G) of sinusoidal congestion, vacuolation of hepatocytes, focal inflammation, and the number of Kupffer cells. *P <0.05, I/R+DMSO versus I/R+Res 0.02 and I/R+Res 0.2. †P <0.05 I/R+Res 2.0 versus I/R+Res 0.02 and I/R+Res 0.2
Evaluation of the effect of resveratrol on the liver injury after I/R by histopathological analysis. In mice in the IR and IR + DMSO groups (A, B), obvious sinusoidal congestion, vacuolation of the hepatocytes, and focal parenchyma inflammation were obvious. Mice with mild sinusoidal dilation received resveratrol at 0.02 and 0.2 mg/kg. Abnormal histopathological changes in the resveratrol group (C, D) were significantly improved. A higher dose (2 mg/kg) of resveratrol did not have a significant protective effect on the treatment of I/R injury in mice (E). Low doses of resveratrol significantly decreased the focal inflammation compared to 2 mg/kg of resveratrol (F). The score of histopathological changes (G) of sinusoidal congestion, vacuolation of hepatocytes, focal inflammation, and the number of Kupffer cells. *P <0.05, I/R+DMSO versus I/R+Res 0.02 and I/R+Res 0.2. †P <0.05 I/R+Res 2.0 versus I/R+Res 0.02 and I/R+Res 0.2
Discussion
In this study, we assessed the effect of resveratrol on ischemia/reperfusion injury and UPR pathway in the in vivo system. Considering the cross-talk between oxidative stress, ER stress, and UPR arms, we evaluated the effect of resveratrol on UPR sensors to regulate the cellular antioxidant capacity. The goal of this project was to evaluate for the molecular mechanism of resveratrol and answer the following novel questions: (1) is the UPR process involved in the effects of resveratrol on the I/R injury of the liver? (2) Which arm of the UPR is mostly involved in the effectiveness of resveratrol on damaged liver? The results of the current study suggest that post-ischemic treatment with resveratrol can increase the survival of liver allografts after transplantation at lower doses. Post-ischemic treatment with low doses of resveratrol significantly decreased the levels of ALT and AST. In addition, a significant reduction in the expression of GRP78, Perk, IRE1, CHOP, and XBP1 was identified compared to the IR+DMSO group. However, the effects of different doses of resveratrol on the expression of the ATF6 gene did not reach a statically significant threshold.Ischemia-reperfusion injury (I/R) is a multifactorial phenomenon which occurs during transplantation events and often impairs the transplant function early after liver transplantation [45]. The mechanism of injury is closely related to the inflammatory response, which leads to microcirculation failure, followed by necrosis and cell death [45]. Although many studies have been done on I/R injury of the liver, the exact mechanism that causes transplant rejection is not fully understood. Due to the high level of metabolism, liver cells are highly susceptible to the destructive effects of I/R, including reduced levels of ATP and hypoxia, which can subsequently cause damage to various organs, such as the endoplasmic reticulum [46]. Liver cells respond to endoplasmic reticulum stress through a defense process called the unfolded protein response (UPR) [46].Resveratrol is a polyphenolic compound that has a protective effect on the liver cells and can improve the survival rate of liver allografts after transplantation [47]. Resveratrol can reportedly be used as a signal molecule in the tissues and cells to regulate the gene and protein expression. Stimulation of these proteins and enzymes may explain some of the antioxidant properties in cells [48]. Genetic regulation is sufficient to explain some of the cytoprotective effects of resveratrol, as well as its effects on blood flow, cell death, and the inflammatory cascade [49]. In recent years, the therapeutic effect of resveratrol on liver diseases has been confirmed in several studies. Resveratrol significantly improves the survival rate after liver transplantation and reduces apoptosis, necrosis, and ischemia-induced fat deposition in animal models [50].In 2005, Sylvain et al. demonstrated for the first time that resveratrol could be used as a signal molecule in cells to regulate the expression of genes and proteins. The stimulation of these proteins and enzymes can explain some of the antioxidant properties in cells [51]. Consistent with our study, Khabbar et al. demonstrated that low-dose resveratrol helped resolve liver inflammation secondary to liver surgery and/or liver allograft rejection [40]. Therefore, they concluded that trans-resveratrol might be a viable treatment option that can selectively inhibit the self-cutting cycle of inflammatory damage [40].A number of studies have shown that resveratrol is a new type of anti-inflammatory agent, which can improve the endoplasmic reticulum environment by reducing the protein load on the endoplasmic reticulum and maintaining the integrity of the ER membrane [52]. Resveratrol inhibits the expression of genes expressed by the UPR cell response. In this study, it was found that the expression levels of CHOP and GRP78 in low-dose resveratrol were significantly reduced compared to I/R group. With a decrease in the expression levels of GRP78 and CHOP, it can be concluded that the resveratrol induces survival branch of the UPR.Consistent with this finding, Tabata et al. showed that Vaticanol B (a resveratrol tetramer) prevented the induction of the UPR pathway by inhibiting the expression of CHOP and GRP78 [52]. In fact, ischemia-reperfusion injury leads to an increase in IRE1 and PERK, which in turn leads to cell death by increasing CHOP [53]. Resveratrol regulates these two arms to prevent the cell death. Furthermore, polycystic ovary syndrome (PCOS) patients have been reported to have reduced XBP-1 mRNA expression after resveratrol treatment, which is in line with our findings [54]. Our data also showed that resveratrol reduced the level of XBP-1 expression, while ATF6 expression was slightly decreased or unchanged. In fact, resveratrol can reduce the activity of the ATF6 arm in the UPR pathway, but this reduction was not significant in our study. One of the main reasons for this situation may be related to the interaction between ATF6 and catalase. ATF6 is one of the main inducers of catalase, and complete inhibition of this transcription factor will lead to the loss of antioxidant properties in the cell and ultimately cell death [55].It can be understood that resveratrol reduces the number of UPR target genes by reducing XBP-1 and simultaneously increases the transcription of inhibitory proteins in the inflammatory pathway by increasing ATF6.In 2019, Zhao et al. studied the effects of resveratrol on hepatic endoplasmic reticulum (ERS) stress and insulin sensitivity in vivo and in vitro [56]. They showed that resveratrol could reduce liver ERS, thereby improving insulin sensitivity and glucose levels. However, high doses of resveratrol can have damaging effects on the cells, increasing ERS and insulin resistance [56].It is worth mentioning that resveratrol has yet to be fully examined, according to various research. The in vivo toxicity of resveratrol in rodents has been studied in several publications. It has been observed that a high dose of resveratrol produces pro-oxidant effects in mice via suppressing cyclooxygenase (COX1) expression and prostaglandin (PG2) synthesis, leading to ulcerative damage [57, 58]. According to another study, high doses of resveratrol produce renal fibrosis, severe nephropathy, and considerable increases in BUN and creatinine, and their anti-fibrotic benefits are entirely reversed [59]. Only low doses (0.02, 0.2 mg/kg) of trans-resveratrol (penis vein injection) in rats can reduce the liver injury (decrease ALT, AST by roughly 40%) caused by I/R. However, low-dose resveratrol improves the antioxidant defense system and increases the activity of hepatic GPx, Cu/Zn SOD, catalase enzymes, as well as the total and reduced glutathione if all of these effects are completely reversed at high doses of resveratrol (2.0, 20 mg/kg) [40]. Consistent with this finding, our results also showed that low-dose resveratrol (0.02 and 0.2 mg/kg) had a significant protective effect (ALT, AST) on the resolution of I/R damage. In fact, based on several previous published data, it appears that higher doses of resveratrol resemble more to a pro-oxidant than to an antioxidant and can cause cell damage [40, 60]. As there is no more research on the appropriate dosage of resveratrol, more research is needed to confirm our results. Despite numerous intriguing findings, the current study has some limitations. For example, it is much better to analyze all UPR elements on gene and protein expression in order to arrive at a more precise conclusion. According to several related publications, no significant changes were seen in the sham-operated control group without ischemia-reperfusion in liver function tests, histopathological studies, inflammatory factors, as well UPR elements (ATF4, CHOP), and apoptosis factors after (1, 3, 6, 12, and 24 h) post-liver reperfusion [61-64]. But with these details in our study, considering one group as a sham-operated control is better to make the findings more objective and analyze the influence of the operation on variables as a baseline, particularly in UPR molecular pathways. These points will undoubtedly be taken into account in future research.
Conclusion
Taking into account the effects of the UPR pathway and the cross-talk between oxidative stress, ER stress, and UPR arms in restoring cellular homeostasis, we investigated the ability of resveratrol to regulate cellular antioxidant capacity in this study. According to our findings, resveratrol can reduce the severity of ERS and suppress the expression of UPR arms (PERK and IRE1α) activated by hepatic ischemia/reperfusion in response to ERS. The findings of this study suggest that hepatic ischemia occurs after liver transplantation and that treating recipients with low-dose resveratrol before reperfusion may improve the graft survival by inhibiting UPR arms in particular (IRE1α and PERK). More research is needed, however, to determine an effective and safe dose of resveratrol.Additional file 1: Figure 1S. The effect of resveratrol on the serum ALT and AST levels after I/R. Resveratrol was injected into the tail vein of the mouse 5 minutes before reperfusion. The mice’s underwent 1 hour of ischemia and were sacrificed after 3 hours of reperfusion (I/R). Data are expressed as mean ± SD. According to the Tukey post-hoc test used for the comparison between groups, the groups with the same superscript letters did not have significant differences when α = 0.05 (p ≥ .05). Thus, various letters show considerable differences (p <0.05). Figure 2S. The impact of resveratrol on the expression levels of GRP78, PERK, ATF6α, CHOP and XBP1 after I/R. Sham-operated group, I/R, DMSO, 0.02, 0.2 and 2. The mice’s were sacrificed after 1 hour of ischemia and reperfusion (I/R) for 3 hours. Data are expressed as mean ± SD. One-way analysis of variance is used to compare the groups with the same superscript letters, which are not significantly different when α = 0.05 (p ≥ 0.05). However, various letters show considerable differences (p <0.05). Figure 4S. Evaluation of the effect of resveratrol on the liver injury after I/R by histopathological analysis. Sham-operated group with normal liver architecture (A). In mice’s in the IR and IR + DMSO groups (B and C), obvious sinusoidal congestion, vacuolation of the hepatocytes (thin arrow), and focal parenchyma inflammation (thick arrow) were obvious. Mice’s with mild sinusoidal dilation received resveratrol at 0.02 and 0.2 mg/kg. Abnormal histopathological changes in the resveratrol group (D and E) were significantly improved. A higher dose (2 mg / kg) of resveratrol did not have a significant protective effect on the treatment of I / R injury in mice’s (F).
Authors: Yuta Abe; Ian N Hines; Gazi Zibari; Kevin Pavlick; Laura Gray; Yuko Kitagawa; Matthew B Grisham Journal: Free Radic Biol Med Date: 2008-10-10 Impact factor: 7.376