| Literature DB >> 36159991 |
Anamika Thakur1,2, Manoj Kumar1,2.
Abstract
miRNAs play an essential role in promoting viral infections as well as modulating the antiviral defense. Several miRNA repositories have been developed for different species, e.g., human, mouse, and plant. However, 'VIRmiRNA' is the only existing resource for experimentally validated viral miRNAs and their targets. We have developed a 'AntiVIRmiR' resource encompassing data on host/virus miRNA expression during viral infection. This resource with 22,741 entries is divided into four sub-databases viz., 'DEmiRVIR', 'AntiVmiR', 'VIRmiRNA2' and 'VIRmiRTar2'. 'DEmiRVIR' has 10,033 differentially expressed host-viral miRNAs for 21 viruses. 'AntiVmiR' incorporates 1,642 entries for host miRNAs showing antiviral activity for 34 viruses. Additionally, 'VIRmiRNA2' includes 3,340 entries for experimentally validated viral miRNAs from 50 viruses along with 650 viral isomeric sequences for 14 viruses. Further, 'VIRmiRTar2' has 7,726 experimentally validated targets for viral miRNAs against 21 viruses. Furthermore, we have also performed network analysis for three sub-databases. Interactions between up/down-regulated human miRNAs and viruses are displayed for 'AntiVmiR' as well as 'DEmiRVIR'. Moreover, 'VIRmiRTar2' interactions are shown among different viruses, miRNAs, and their targets. We have provided browse, search, external hyperlinks, data statistics, and useful analysis tools. The database available at https://bioinfo.imtech.res.in/manojk/antivirmir would be beneficial for understanding the host-virus interactions as well as viral pathogenesis.Entities:
Keywords: antiviral; expression; human host; microRNA; network; target; viruses; web server
Year: 2022 PMID: 36159991 PMCID: PMC9493126 DOI: 10.3389/fgene.2022.971852
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1AntiVIRmiR architecture.
FIGURE 2Data statistics: Bar graphs represent the number of entries in top 10 viruses for (A) ‘DEmiRVIR’ and (D) ‘AntiVmiR’. Pie charts representing statistical distribution of cell lines in (B) ‘DEmiRVIR’ and (E) ‘AntiVmiR’ and experimental methods in (C) ‘DEmiRVIR’ and (F) ‘AntiVmiR’ (HCV, Hepatitis C virus; MCV, Merkel cell polyomavirus; HBV, Hepatitis B virus; HIV, Human immunodeficiency virus; WNV, West Nile Virus; INFV, Influenza A virus; WSSV, White spot syndrome virus; BKV, BK polyomavirus; JCV, JC polyomavirus; EBV, Epstein Barr virus; JEV, Japanese encephalitis virus; DENV, Dengue virus; HPV, Human papillomavirus and HCMV, Human cytomegalovirus).
Representative isomeric miRNA sequences for 14 viruses.
| S. No. | miRNA | miRNA sequence | Length | PMID |
|---|---|---|---|---|
| 1 | bfv-miR-bf1-3p | ucccugaagccauauccgaggc | 22 | 24522910 |
| ucccugaagccauauccgaggcu | 23 | 24522910 | ||
| ucccugaagccauauccgaggca | 23 | 24522910 | ||
| ucccugaagccauauccgaggu | 22 | 24522910 | ||
| ucccugaagccauauccgagg | 21 | 24522910 | ||
| 2 | blv-miR-b2-3p | ugcgugucgcucagucauuuu | 21 | 22308400 |
| ugcgugucacucagucauuuu | 21 | 22308400 | ||
| 3 | dev-miR-d11–3p | gcaaaagggcagccugggcucuau | 24 | 22492913 |
| aaaagggcagccugggcu | 18 | 29704894 | ||
| 4 | ebv-miR-bart7-3p | caucauaguccaguguccaggg | 22 | 16557291,17604727, 16540699 |
| aucauaguccaguguccagg | 20 | 29425228 | ||
| 5 | hbv-miR-b14rc-3p | aggaggggucugggagagaaggg | 23 | 21543500 |
| aggaggggucugggagagaagg | 22 | 21543500 | ||
| ggaggggucugggagagaaggg | 22 | 21543500 | ||
| aggaggggucugggagagaag | 21 | 21543500 | ||
| ggaggggucugggagagaa | 19 | 21543500 | ||
| 6 | hcmv-miR-UL148D | ucguccuccccuucuucaccg | 21 | 31749099, 15782219 |
| ucguccuccccuucuucaccu | 21 | 31749099 | ||
| 7 | hsv1-miR-H2-3p | ccugagccagggacgagugcgacu | 24 | 21795359, 25535379 |
| cugagccagggacgagugcga | 21 | 19656888 | ||
| cugagccagggacgagugcgacu | 23 | 19656888 | ||
| ugagccagggacgagugcgacu | 22 | 19656888 | ||
| 8 | kshv-miR-K12-11–3p | uuaaugcuuagccuguguccga | 22 | 27611973, 30533200 |
| uuaaugcuuagccuguguccg | 21 | 29425228 | ||
| uaaugcuuagccuguguccga | 21 | 29425228 | ||
| augcuuagccuguguccg | 18 | 29425228 | ||
| ccuuaaugcuuagccuguguccg | 23 | 29425228 | ||
| 9 | mdv1-miR-m1/mdv1-m1-5p | ugcuuguucacugugcggca | 20 | 16912324, 18842708 |
| ugcuuguucacugugcggcauu | 22 | 24449754 | ||
| ugcuuguucacugugcggcauua | 23 | 24449754 | ||
| 10 | mdv2-m14–5p | ugugguacggugcacccugaga | 22 | 24449754 |
| gugugguacggugcacccugaga | 23 | 24449754 | ||
| 11 | prv-miR-1-3p | ucucaccccuggguccgucgc | 21 | 22292087 |
| ucucaccccuggguccgucgcc | 22 | 22292087 | ||
| cucucaccccuggguccgucgc | 22 | 22292087 | ||
| cucucaccccuggguccgucg | 21 | 22292087 | ||
| ucucaccccuggguccgucg | 20 | 22292087 | ||
| ucucaccccuggguccguc | 19 | 22292087 | ||
| 12 | rcmv-miR-orilyt-1 | gacggggucucgggcuccuga | 21 | 20980502 |
| cccggagcucgaaacccgguucg | 24 | 20980502 | ||
| gacggggucucgggcuccugac | 22 | 20980502 | ||
| 13 | rlcv-miR-rl1-1-3p | cuccgggccugaagagguugac | 22 | 16557291, 20219930 |
| cuccgggccugaagagguuga | 21 | 20219930 | ||
| cuccgggccugaagagguug | 20 | 20219930 | ||
| 14 | rrv-miR-rr1-1-3p | gccaccgaggaugcggucaau | 21 | 20655562 |
| ggccaccgaggaugcggu | 18 | 20655562, 17451774 |
FIGURE 3Heatmap showing human miRNA expression reported in different viruses (EBV, Epstein Barr virus; HBV, Hepatitis B virus; HCMV, Human cytomegalovirus; HIV, Human immunodeficiency virus; HPV, Human Papillomavirus; HSV1, Herpes simplex virus one; KSHV, Kaposi sarcoma-associated herpesvirus; MCV, Merkel cell polyomavirus; SIV, Simian immunodeficiency virus; VZV, Varicella-zoster virus and WNV, West Nile Virus).
FIGURE 4Network showing human miRNA expression reported in different viruses in ‘DEmiRVIR’ (A) hsa-miR-9 and (B) hsa-miR-129 (Viruses with hexagon shape (purple color) represent downregulation, diamond shape (red color) represents upregulation, octagon shape (green color) represents viruses found common in both upregulation as well as downregulation in different studies and miRNA is represented in ellipse shape (pink color)). Network interaction analysis for ‘AntiVmiR’ (C) let-7 and (D) mir-30. Virus name is written in ellipse shape (red color) and miRNA name in octagon shape (pink color).
FIGURE 5‘AntiVIRmiR’ resource overview that includes a browse page, individual search output and detailed information of a miRNA.