| Literature DB >> 36158207 |
Anton Lennikov1,2, Menglu Yang1, Karen Chang1,2, Li Pan1,3, Madhu Sudhana Saddala4, Cherin Lee1, Ajay Ashok1,2, Kin-Sang Cho1, Tor Paaske Utheim1,2,5, Dong Feng Chen1.
Abstract
Non-invasive electric stimulation (ES) employing a low-intensity electric current presents a potential therapeutic modality that can be applied for treating retinal and brain neurodegenerative disorders. As neurons are known to respond directly to ES, the effects of ES on glia cells are poorly studied. A key question is if ES directly mediates microglial function or modulates their activity merely via neuron-glial signaling. Here, we demonstrated the direct effects of ES on microglia in the BV-2 cells-an immortalized murine microglial cell line. The low current ES in a biphasic ramp waveform, but not that of rectangular or sine waveforms, significantly suppressed the motility and migration of BV-2 microglia in culture without causing cytotoxicity. This was associated with diminished cytoskeleton reorganization and microvilli formation in BV-2 cultures, as demonstrated by immunostaining of cytoskeletal proteins, F-actin and β-tubulin, and scanning electron microscopy. Moreover, ES of a ramp waveform reduced microglial phagocytosis of fluorescent zymosan particles and suppressed lipopolysaccharide (LPS)-induced pro-inflammatory cytokine expression in BV-2 cells as shown by Proteome Profiler Mouse Cytokine Array. The results of quantitative PCR and immunostaining for cyclooxygenase-2, Interleukin 6, and Tumor Necrosis Factor-α corroborated the direct suppression of LPS-induced microglial responses by a ramp ES. Transcriptome profiling further demonstrated that ramp ES effectively suppressed nearly half of the LPS-induced genes, primarily relating to cellular motility, energy metabolism, and calcium signaling. Our results reveal a direct modulatory effect of ES on previously thought electrically "non-responsive" microglia and suggest a new avenue of employing ES for anti-inflammatory therapy.Entities:
Keywords: BV-2; bulk RNA sequencing; cell motility; electric stimulation; inflammation; microglia; phagocytosis
Year: 2022 PMID: 36158207 PMCID: PMC9493490 DOI: 10.3389/fcell.2022.980775
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
List of mouse-specific primers used in the study.
| Gene | Direction | Sequence |
|---|---|---|
| TNFα | Forward | CTGGGACAGTGACCTGGACT |
| Reverse | GCACCTCAGGGAAGAGTCTG | |
| IL-6 | Forward | AAGTGCATCATCGTTGTTCATACA |
| Reverse | GAGGATACCACTCCCAACAGACC | |
| COX-2 | Forward | GCGAGCTAAGAGCTTCAGGA |
| Reverse | CAGACGCCACTGTCGCTTT | |
| Tbkbp1 | Forward | AGGAGCAACTCCAGGCGGAATG |
| Reverse | AGCCATGTCACATTCCGACTGG | |
| Atp2b4 | Forward | CACCATCTCACTAGCCTACTCTG |
| Reverse | AGTGTGCCTGTCTTATCGGAGC | |
| GAPDH | Forward | ACTCCACTCACGGCAAATTC |
| Reverse | TCTCCATGGTGGTGAAGACA | |
| β-actin | Forward | CATTGCTGACAGGATGCAGAAGG |
| Reverse | TGCTGGAAGGTGGACAGTGAGG |
FIGURE 1Microcurrent ES of ramp waveform inhibits BV-2 cell migration. (A–C) Schematic representation of different ES waveforms: (A) Ramp; (B) Rectangular; (C) Sine. (D–G) Photomicrographs of migratory BV-2 cells stained by a fluorescence vital dye Calcein AM (green) in the scratch assay and assessed at 0 and 48 h post scratching. Cells were cultured under a control condition (D) or subjected to ES of ramp (E), rectangular (F), or sine (G) waveform. Scale bar: 100 µm. (H,I) Quantitative analysis of scratch distance (H) and scratch surface area (I). n = 8 cultures/group; Statistical significance was determined using one-way ANOVA with Tukey multiple comparisons. *p < 0.05; **p < 0.01; value = means ± S.D.
FIGURE 2Ramp ES inhibits the redistribution of cytoskeletal and motility proteins and the formation of cellular lamellipodia and microvilli. (A–D) Immunostaining of F-actin (red) and β-tubulin (green) in BV-2 cells cultured under a control condition (A) after ES biphasic ramp; white arrow indicates redistribution of F-actin within the cell. (B), ES biphasic rectangular (C), or ES biphasic sine (D). Scale bar: 20 µm. (E,F) Scanning electron microscopy images of BV-2 cells in control (E) and after ES biphasic ramp (F). Inserts reveal cell membrane morphology in the leading edge and lamellipodia. Scale bar: 5 μm; insert: 1 µm.
FIGURE 3Ramp ES reduces phagocytosis of BV-2 cells. Representative fluorescent images of BV-2 cells cultured under a control condition or ES biphasic ramp (A) and incubated with fluorescent (cy3) zymosan particles (red) for 24 h and Calcein AM stain (green) was used to visualize BV-2 cells. Scale bar: 50 µm. Inserts present individual cells with zymosan particles. Quantification of zymosan particles in BV-2 cells in control and ramp ES-treated cultures per field (B) and the average number of zymosan particles per cell (C); Control n = 17; Ramp n = 14. Statistical significance was determined by Student’s t-test. **p < 0.01; value = means ± S.D.
FIGURE 4Electric stimulation with ramp waveform reduces BV-2 cell activation in response to LPS stimulation. (A) Heatmap of inflammatory cytokine levels as measured by values of densitometry of cytokine arrays and presented as fold changes normalized to the value of the LPS-stimulated group without the ES. RT-PCR (B–D) demonstrated changes in levels of expression of TNF-α (B), IL-6 (C), and COX-2 (D) in BV-2 cells subjected to ES biphasic ramp at 24 h after LPS stimulation. n = 3; Statistical significance was determined using one-way ANOVA with Tukey multiple comparisons. *p < 0.05; **p < 0.01; value = means ± S.D.
FIGURE 5RNA-seq analysis for the transcriptome profiles of LPS-challenged BV-2 cells with or without ES-treatment. (A) Heatmap of DEGs in Control, LPS, and Ramp ES + LPS treated groups; the values were normalized as fold change over the control group. (B,C) Volcano plots of Control vs LPS (B) and LPS vs Ramp ES + LPS (C). (D–F) Dot plots of top ten GO terms through analysis of ES-suppressed genes that were divided into the categories of Biological process (D), Cellular components (E), and Molecular function (F).
FIGURE 6Graphical summary of the study findings. The Ramp ES affects the cytoskeletal organization, reducing cell motility in the scratch assay and phagocytosis. Rectangular and sine waveforms do not appear to have a prominent effect on cytoskeleton, motility, and phagocytosis. Ramp stimulation also reduces pro-inflammatory microglia activation and cytokine release by the BV-2 cells. RNA sequencing indicates genes’ downregulation in regulating cell migration, energy metabolism, and Ca2+ signaling.