Literature DB >> 36149919

Muscle contractile exercise through a belt electrode device prevents myofiber atrophy, muscle contracture, and muscular pain in immobilized rat gastrocnemius muscle.

Yuichiro Honda1,2, Ayumi Takahashi2, Natsumi Tanaka2,3, Yasuhiro Kajiwara2,4, Ryo Sasaki2,5, Seima Okita2,6, Junya Sakamoto1,2, Minoru Okita1,2.   

Abstract

PURPOSE: Immobilization of skeletal muscles causes muscle atrophy, muscle contracture, and muscle pain, the mechanisms of which are related to macrophage accumulation. However, muscle contractile exercise through a belt electrode device may mitigate macrophage accumulation. We hypothesized that such exercise would be effective in preventing myofiber atrophy, muscle contracture, and muscular pain. This study tested this hypothesis in immobilized rat gastrocnemius muscle.
MATERIALS AND METHODS: A total of 32 rats were divided into the following control and experimental groups: immobilization (immobilized treatment only), low-frequency (LF; immobilized treatment and muscle contractile exercise with a 2 s (do) /6 s (rest) duty cycle), and high-frequency (HF; immobilized treatment and muscle contractile exercise with a 2 s (do)/2 s (rest) duty cycle). Electrical stimulation was performed at 50 Hz and 4.7 mA, and muscle contractile exercise was applied to the lower limb muscles for 15 or 20 min/session (once daily) for 2 weeks (6 times/week). After the behavioral tests, the bilateral gastrocnemius muscles were collected for analysis.
RESULTS: The number of macrophages, the Atrogin-1 and MuRF-1 mRNA expression, and the hydroxyproline content in the HF group were lower than those in the immobilization and LF groups. The cross-sectional area (CSA) of type IIb myofibers in the superficial region, the PGC-1α mRNA expression, and the range of motion of dorsiflexion in the HF group were significantly higher than those in the immobilization and LF groups. The pressure pain thresholds in the LF and HF groups were significantly higher than that in the immobilization group, and the nerve growth factor (NGF) content in the LF and HF groups was significantly lower than that in the immobilization group.
CONCLUSION: Muscle contractile exercise through the belt electrode device may be effective in preventing immobilization-induced myofiber atrophy, muscle contracture, and muscular pain in the immobilized rat gastrocnemius muscle.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36149919      PMCID: PMC9506634          DOI: 10.1371/journal.pone.0275175

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Immobilizing skeletal muscles causes muscle atrophy, muscle contracture, and muscle pain, which medical professionals often struggle to alleviate. We previously identified similarities in the developmental mechanisms of these muscular symptoms, in which myonuclear apoptosis produced unnecessary cytoplasm in immobilized skeletal muscles, which are phagocytosed by accumulated macrophages, resulting in muscle atrophy [1, 2]. Also, a previous study indicated that muscle protein degradation was more influential than muscle protein synthesis for muscle atrophy in 2-week immobilization [3]. Atrogin-1 and muscle RING-finger protein (MuRF)-1 as ubiquitin-proteasome pathway enzymes played the main role in muscle protein degradation [4], peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α was the main regulator for Atrogin-1 and MuRF-1 [5]. Namely, the changes in factors of muscle protein degradation may affect muscle atrophy. Additionally, accumulated macrophages enhance the expression of fibrosis-related molecules by producing interleukin (IL)-1β, which leads to muscle contracture with fibrosis via collagen overexpression [6]. Moreover, nerve growth factor (NGF), an endogenous mediator of pain, is expressed in immobilized skeletal muscles, and macrophages are the major producers of NGF [7, 8]. Therefore, macrophage accumulation is an important factor related to immobilization-induced muscle atrophy, muscle contracture, and muscle pain. Electrical stimulation therapy has been utilized as a functional substitute for voluntary muscle contraction [9]. The usual patterns of muscle contraction by electrical stimulation are twitch and tetanic contractions, with stimulus frequencies of 1–10 Hz and 50–100 Hz, respectively, in rat skeletal muscle [10, 11]. Although a conventional electrical stimulation device often energizes the skeletal muscle through a monopolar electrode, this method has several limitations. In some situations of electrical intervention, sufficient current (power) for muscle contractile exercise may not be obtained due to the limited size of the electrodes, whereas excessive current can cause pain. Thus, an innovative electrical stimulation method with a safe and large current-carrying capacity is needed. A belt electrode-skeletal muscle electrical stimulation device (Homer Ion, Tokyo, Japan) was recently developed as a novel method to provide electrical stimulation therapy. An advantage of this device is that the belt is an electrode that can deliver electricity to the entire lower limb [12]. Thus, it is less likely to cause pain during muscle contractile exercise owing to the dispersed distribution of electricity during the intervention. Additionally, we previously demonstrated that muscle contractile exercise through a belt electrode device prevented macrophages accumulation [13]. Although muscle contractile exercise through the belt electrode device may be effective in preventing immobilization-induced muscle atrophy, contracture, and pain, this hypothesis has not been verified. Therefore, the present study analyzed rat gastrocnemius muscles in an experimental model to confirm this hypothesis.

Materials and methods

Animals

Eight-week-old male Wistar rats (CLEA Japan Inc., Tokyo, Japan) were maintained at the Center for Frontier Life Sciences of Nagasaki University. The rats were maintained in 30 × 40 × 20-cm cages (two rats/cage) and exposed to a 12-h light-dark cycle at an ambient temperature of 25°C. Food and water were provided ad libitum. In this investigation, 32 rats (258.9 ± 11.5 g) were randomly divided into an experimental group (n = 25) and a control group (n = 7). The rats in the control group were maintained without treatment or intervention. The ankle joints of the rats in the experimental group were subjected to the immobilization process described in our previous studies [7]. Briefly, the animals in the experimental group were anesthetized with the combination of 0.375 mg/kg medetomidine (Kyoritu Pharma, Tokyo, Japan), 2.0 mg/kg midazolam (Sandoz Pharma Co., Ltd., Tokyo, Japan), and 2.5 mg/kg butorphanol (Meiji Seika Pharma, Tokyo, Japan). Then, both ankle joints of each rat were fixed in full plantar flexion with plaster casts to immobilize the gastrocnemius muscle in a shortened position for 2 weeks. The plaster cast, which was fitted from above the knee joint to the distal foot, was changed weekly because of loosening owing to muscle atrophy. Additionally, the experimental groups were divided into the immobilization (n = 9; immobilized treatment only), low-frequency (LF; n = 8; immobilized treatment and muscle contractile exercise with a 2 s (do)/6 s (rest) duty cycle), and high-frequency (HF; n = 8; immobilized treatment and muscle contractile exercise with a 2 s (do)/2 s (rest) duty cycle) groups. The experimental protocol was approved by the Ethics Review Committee for Animal Experimentation at Nagasaki University (approval no. 1903281524). All experimental procedures were performed under anesthesia and efforts were made to minimize suffering.

Protocol for electrical stimulation

According to a previous study, cyclic muscle tetanus contraction was performed using an electrical stimulator in small animals (Homer Ion, Tokyo, Japan). The electrical stimulator consisted of a control unit (for setting the stimulus cycle, frequency, and intensity) and a belt electrode. The rats in the LF and HF groups were anesthetized and the electrical stimulator was connected to a belt electrode. The belt electrodes were wrapped around the proximal thigh and distal lower leg, and the bilateral lower limb skeletal muscles were subjected to electrical stimulation with cast removal (frequency, 50 Hz). The optimum stimulus intensity and duration were determined in preliminary experiments, as outlined below.

Preliminary experiment to determine the stimulus intensity

The preliminary experiment included three rats. The stimulus intensity was gradually increased and plantar flexor muscle strength in the middle position of the ankle joint was measured using a force gauge. Next, 100% maximal voluntary contraction (MVC) was determined and the 60% MVC (most effective in preventing loss of muscle strength) was calculated [14]. The result of the preliminary experiment confirmed that 4.7 mA corresponded to 60% MVC (Fig 1A). Therefore, we defined the stimulus intensity as 4.7 mA.
Fig 1

Results of preliminary experiments to determine the stimulation intensity and time.

(A) Preliminary experiment to determine the stimulus intensity. The 100% and 60% maximal voluntary contraction (MVCs) were 4.8 N and 2.9 N, respectively. The results indicated that 4.7 mA corresponded to the 60% MVC. (B) Preliminary experiment to determine the stimulus time. This experiment observed the changes in the muscle strength of plantar flexion. The results showed that the strength decreased to <2.9 N at 18 min after the electrical stimulation.

Results of preliminary experiments to determine the stimulation intensity and time.

(A) Preliminary experiment to determine the stimulus intensity. The 100% and 60% maximal voluntary contraction (MVCs) were 4.8 N and 2.9 N, respectively. The results indicated that 4.7 mA corresponded to the 60% MVC. (B) Preliminary experiment to determine the stimulus time. This experiment observed the changes in the muscle strength of plantar flexion. The results showed that the strength decreased to <2.9 N at 18 min after the electrical stimulation.

Preliminary experiment to determine the stimulus time

We previously described a preliminary experiment on the 2 s (do)/6 s (rest) duty cycle [13]. Therefore, we performed a preliminary experiment with similar parameters. This preliminary experiment included three rats. The muscle strength of plantar flexion was measured (15 measurements per minute) and the stimulus time to reach <2.9 N (60% MVC) was identified. The results of this preliminary experiment indicated that the muscle strength of plantar flexion decreased to <2.9 N 18 min after starting electrical stimulation (Fig 1B). Therefore, we set the stimulation time to 15 min (without muscle fatigue). In the electrical stimulation protocol of the present study, the stimulus frequency was 50 Hz, the stimulus intensity was 4.7 mA, the duty cycle was 2 s (do)/6 s (rest) or 2 s (do)/2 s (rest), and the stimulus time was 20- or 15-min. Electrical stimulation was applied once daily for six days per week, for 2 weeks.

Pressure pain threshold

The pressure pain threshold (PPT) of the gastrocnemius muscles was measured as the hindlimb withdrawal threshold using a Randall-Selitto apparatus equipped with a round-headed probe (tip diameter = 8 mm) [7]. The rats were tested at baseline and 1 and 2 weeks after immobilization. After cast removal, the probe was applied to the lateral head of the gastrocnemius muscle. The pressure was increased at a constant rate of 48 g/s until the animal withdrew its limb. The measurements were performed five times at intervals of at least 30 s, and the mean value, excluding the minimum and maximum values, was determined as the PPT. Immediately after this test, the plaster casts were replaced in the rats in the experimental groups.

Range of motion of the ankle joint dorsiflexion

At 1 and 2 weeks after immobilization, the rats were anesthetized and the range of motion (ROM) of the ankle joint dorsiflexion was determined using a goniometer. The ROM was measured as the angle (0°–180°) between the line connecting the fifth metatarsal to the malleolus lateralis of the fibula and the line connecting the malleolus lateralis of the fibula to the center of the knee joint. The ankle was passively dorsiflexed at 0.3 N using a tension gauge (Shiro Industry, Osaka, Japan) [15].

Tissue sampling and preparation

The left and right gastrocnemius muscles of all the rats were excised 12 hours after the last electrical stimulation. After measuring the gastrocnemius muscle wet weight, the right samples were embedded in tragacanth and the muscle sample was frozen in liquid nitrogen. Serial frozen cross-sections of the muscles were mounted on glass slides for histological analysis. Part of the left gastrocnemius muscle was rapidly frozen in liquid nitrogen for biochemical analysis.

Histological analysis

The cross-sections were stained with hematoxylin and eosin (H&E) (Mayer’s hemalum solution, Merck KGaA, Darmstadt, Germany; Eosin Y disodium salt, Merck KGaA) and ATPase (Adenosine 5′-triphosphate disodium salt hydrate, Merck KGaA) as described previously [6, 16]. The dyed cross-sections of the muscles were then evaluated under an optical microscope. First, the H&E-stained cross-sections were used to identify myofiber morphological characteristics and signs of previous muscle injury, such as centralized nuclei. Next, the ATPase-stained cross-sectional areas (CSAs) of type I, IIa, and IIb myofibers were analyzed using Scion Image software (National Institutes of Health, MD, USA). More than 100 myofiber measurements were recorded per animal [6, 17].

Immunohistochemical analysis

The cross-sections were air-dried and fixed in ice-cold acetone for 10 min. To inhibit endogenous peroxidase activity, the sections were incubated with 0.3% H2O2 in methanol for 40 min at 37°C. After washing with 0.01 M phosphate-buffered saline (PBS pH 7.4), the sections were incubated for 10 min at 37°C with 0.1% Triton X-100 in PBS. The sections were then blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with mouse anti-CD11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland). The sections were rinsed in PBS for 15 min and incubated with biotinylated goat anti-mouse IgG (1:1000; Vector Laboratories) for 60 min at 37°C. The sections were then rinsed with PBS and allowed to react with avidin-biotin-peroxidase complexes (VECTASTAIN Elite ABC kit, Vector Laboratories) for 60 min at 37°C. Horseradish peroxidase binding sites were visualized with 0.05% 3,3-diaminobenzidine and 0.01% H2O2 in 0.05 M Tris buffer at 37°C. After the final washing step, the CD11b sections were stained with eosin and observed under an optical microscope. Using microscopy and standardized light conditions, the sections were magnified 400× (CD11b) and images were captured with a digital camera (Nikon, Tokyo, Japan). The number of macrophages was determined from the 400× images by counting the number of CD11b-positive cells per 100 muscle fibers. Vascular areas were excluded from the analysis [6, 13].

Molecular biological analysis

The soleus muscles were used for this analysis. Total RNA was extracted from muscle samples using a RNeasy Fibrous Tissue Mini Kit (Qiagen, CA, USA). Total RNA was used as a template with a QuantiTect® Reverse Transcription Kit (Qiagen) to prepare cDNA, and real-time RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, CA, USA). The cDNA concentration of all samples was unified to 25 ng/μl, the cDNA was applied 0.2 μl to each well. The synthetic gene-specific primers are listed in Table 1. The threshold cycle (Ct) was determined using an Mx3005P Real-Time QPCR System (Agilent Technologies). The mRNA expression of target genes was calculated using the ΔΔct method.
Table 1

Arrangement of synthetic gene-specific primers.

Object geneArrangementGene Bank No.
ForwardReverse
PGC-1α 5’- CAAGCCAAACCAACAACTTTATCTCT -3’ 5’- CACACTTAAGGTTCGCTCAATAGT -3’ NC051349.1
Atrogin-1 5’-ACTAAGGAGCGCCATGGATACT-3’ 5’-GTTGAATCTTCTGGAATCCAGGAT-3’ AY059628.1
MuRF-1 5’-TGACCAAGGAAAACAGCCACCAG-3’ 5’-TCACTCTTCTTCTCGTCCAGGATGG-3’ AY059627.1
β-actin 5’-GTGCTATGTTGCCCTAGACTTCG-3’ 5’-GATGCCACAGGATTCCATACCC-3’ BC063166.1

PGC, peroxisome proliferator-activated receptor gamma coactivator; MuRF, muscle RING-finger protein

PGC, peroxisome proliferator-activated receptor gamma coactivator; MuRF, muscle RING-finger protein

Biochemical analysis

The gastrocnemius muscles were assessed for hydroxyproline expression (a parameter for collagen expression) using our previous method [14]. Briefly, the muscle samples were immersed in 1.0 M PBS (pH 7.4) and homogenized using a Micro SmashTM device (MS-100R; Tomy, Tokyo, Japan). Subsequently, the muscle samples were hydrolyzed in 6 N HCl for 15 h at 110°C and then dried in 6 N HCl using an evaporator (EZ-2 HCL-resistant model; Ikeda Scientific, Tokyo, Japan). The muscle samples were hydrolyzed in NaOH for 1 h at 90°C. The hydrolyzed specimens were then mixed with buffered chloramine-T reagent and subsequently oxidized at 20°C. The chromophore was developed by adding Ehrlich’s aldehyde reagent. The absorbance of each sample was measured at 540 nm using a SpectraMax 190 spectrophotometer (Molecular Devices, CA, USA). The absorbance values were plotted against the concentration of the hydroxyproline standard. The concentrations of hydroxyproline in the unknown sample extracts were determined using a standard curve and calculated as content per dry weight (μg/mg dry weight).

Enzyme-linked immunosorbent assay (ELISA)

The gastrocnemius muscle was homogenized in cold lysis buffer (pH 8.0) at 4°C. The homogenate was centrifuged for 20 min at 12,000 rpm at 4°C, and the supernatant was stored at −80°C. NGF protein expression in the gastrocnemius muscle was examined using an ELISA kit (Boster Biological Technology, Pleasanton, California, USA) with a range of validity of 15.6–1,000 pg/mL. The protein content of each tissue supernatant was determined using a bicinchoninic acid protein assay kit (Pierce, Rockford, Illinois, USA). The NGF levels were normalized to the protein content.

Statistical analysis

All data are presented as means ± standard deviation. The ROM of dorsiflexion and PPT were were assessed using two-way ANOVA, followed by Scheffé’s method. Also, the differences between groups of other parameters were assessed using one-way ANOVA, followed by Scheffé’s method. Differences were considered statistically significant at p < 0.05.

Results

Macrophages

The control group showed 5.8 ± 1.0 CD11b-positive cells per 100 myofibers at 2 weeks. In the immobilization, LF, and HF groups, the values were 18.9 ± 0.9, 18.3 ± 1.0, and 14.6 ± 0.8, respectively, at 2 weeks after immobilization (Fig 2A and 2B). The numbers of CD11b-positive cells in the experimental groups were significantly higher than that in the control group and lower in the HF group than in the immobilization and LF groups.
Fig 2

Numbers of CD11b-positive cells in gastrocnemius muscles.

(A) Immunohistochemical staining images of CD11b in gastrocnemius muscles. Arrowheads, CD11b-positive cells. Scale bar, 50 μm. (B) The number of CD11b-positive cells per 100 myofibers. Open bar, control group (Con). Black bar, immobilization group (Im). Gray bar, LF group. Hatched bar, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency.

Numbers of CD11b-positive cells in gastrocnemius muscles.

(A) Immunohistochemical staining images of CD11b in gastrocnemius muscles. Arrowheads, CD11b-positive cells. Scale bar, 50 μm. (B) The number of CD11b-positive cells per 100 myofibers. Open bar, control group (Con). Black bar, immobilization group (Im). Gray bar, LF group. Hatched bar, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency.

Body weight, muscle wet weight, and relative weight ratio

The body weight, muscle wet weight, and relative weight ratio (muscle wet weight per body weight) at 2 weeks are shown in Table 2. All parameters were significantly lower in the experimental groups than those in the control group but did not differ significantly among the immobilization, LF, and HF groups.
Table 2

Body weight, muscle wet weight, and relative weight ratio at 2 weeks.

ControlImmobilizationLFHF
BW (g)296.7 ± 11.5245.8 ± 13.5*235.0 ± 13.7*233.8 ± 7.7*
MWW (mg)663.2 ± 80.5407.2 ± 47.4*418.0 ± 56.4*407.4 ± 31.2*
RWR (mg/g)2.2 ± 0.21.7 ± 0.1*1.8 ± 0.2*1.7 ± 0.1*

BW: body weight, MWW: muscle wet weight, RWR: relative weight ratio

* p < 0.05 compared to the control group.

BW: body weight, MWW: muscle wet weight, RWR: relative weight ratio * p < 0.05 compared to the control group.

H&E imaging and CSA

The H&E-stained cross-sections of the experimental groups showed no abnormal findings, except for atrophic changes (Fig 3). Assessment of the CSAs in the deep and superficial regions of type I, IIa, and IIb myofibers (Fig 4A) showed a CSA of type I myofibers was 2503.3 ± 491.0 μm2 in the deep region of ATPase-stained cross-sections in the control group. The CSAs of type I myofiber in the immobilization, LF, and HF groups were 1113.6 ± 144.6, 1176.0 ± 126.7, and 1351.8 ± 147.5 μm2, respectively, at 2 weeks after immobilization (Fig 4B). The CSA of type IIa myofibers in the deep region was 1783.1 ± 387.4 μm2 in the control group. The CSAs of type IIa myofibers in the immobilization, LF, and HF groups were 934.1 ± 138.2, 938.8 ± 112.8, and 1020.5 ± 129.2 μm2, respectively, at 2 weeks after immobilization (Fig 4C). The CSA of type IIb myofibers of the deep region was 2344.9 ± 572.5 μm2 in the control group. The CSAs of type IIb myofiber in the immobilization, LF, and HF groups were 1275.7 ± 103.3, 1266.7 ± 169.9, and 1477.4 ± 118.6 μm2, respectively, at 2 weeks after immobilization (Fig 4D). In the superficial region of ATPase-stained cross-sections, the CSA of type IIb myofibers was 3516.3 ± 536.2 μm2 in the control group. The CSAs of type IIb myofiber in the immobilization, LF, and HF groups were 1920.4 ± 201.9, 1969.5 ± 253.5, and 2439.8 ± 253.0 μm2, respectively, at 2 weeks after immobilization (Fig 4E).
Fig 3

Hematoxylin and eosin-stained imaging of rat gastrocnemius muscles.

No abnormal findings are visible in the experimental groups, except for atrophic changes. Scale bar, 50 μm.

Fig 4

Cross-sectional areas (CSAs) in the deep and superficial regions of gastrocnemius muscles.

(A) ATPase staining of gastrocnemius muscle. Black areas, type I fibers. White areas, type IIa fibers. Gray areas, type IIa fibers. Scale bar, 50 μm. (B) CSA of type I fibers in the deep region. (C) CSA of type IIa fibers in the deep region. (D) CSA of type IIb fibers in the deep region. (E) CSA of type IIb fibers in the superficial region. Open bars, control group (Con). Black bars, immobilization group (Im). Gray bars, LF group. Hatched bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency.

Hematoxylin and eosin-stained imaging of rat gastrocnemius muscles.

No abnormal findings are visible in the experimental groups, except for atrophic changes. Scale bar, 50 μm.

Cross-sectional areas (CSAs) in the deep and superficial regions of gastrocnemius muscles.

(A) ATPase staining of gastrocnemius muscle. Black areas, type I fibers. White areas, type IIa fibers. Gray areas, type IIa fibers. Scale bar, 50 μm. (B) CSA of type I fibers in the deep region. (C) CSA of type IIa fibers in the deep region. (D) CSA of type IIb fibers in the deep region. (E) CSA of type IIb fibers in the superficial region. Open bars, control group (Con). Black bars, immobilization group (Im). Gray bars, LF group. Hatched bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency. In the deep region of the gastrocnemius muscle, the CSAs of type I, IIa, and IIb myofibers in the experimental groups were significantly lower than those in the control group and did not differ significantly among the immobilization, LF, and HF groups. In addition, in the superficial region of the gastrocnemius muscle, the CSAs of type IIb myofibers in the experimental groups were significantly lower than that in the control group, whereas the CSA of type IIb myofibers in the HF group was significantly higher than those in the immobilization and LF groups.

PGC-1α, Atrogin-1, MuRF-1 mRNA expression

The PGC-1α mRNA expression was 1.1 ± 0.2 in the control group. In the immobilization, LF, and HF groups, the expression was 0.6 ± 0.1, 0.7 ± 0.1, and 1.0 ± 0.1 respectively, at 2 weeks after immobilization (Fig 5A). The Atrogin-1 mRNA expression was 1.1 ± 0.4 in the control group. In the immobilization, LF, and HF groups, the expression was 2.5 ± 0.4, 2.2 ± 0.4, and 1.7 ± 0.4 respectively, at 2 weeks after immobilization (Fig 5B). The MuRF-1 mRNA expression was 1.1 ± 0.1 in the control group. In the immobilization, LF, and HF groups, the expression was 2.2 ± 0.5, 2.0 ± 0.4, and 1.5 ± 0.3 respectively, at 2 weeks after immobilization (Fig 5C).
Fig 5

mRNA expression of PGC-1α (A), Atrogin-1 (B), and MuRF-1 (C) in gastrocnemius muscle. Open bars, control group (control). Black bars, immobilization group (Im). Gray bars, LF group. Hatched bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency.

mRNA expression of PGC-1α (A), Atrogin-1 (B), and MuRF-1 (C) in gastrocnemius muscle. Open bars, control group (control). Black bars, immobilization group (Im). Gray bars, LF group. Hatched bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency. The PGC-1α mRNA expression in the immobilization and LF groups was significantly lower than that in the control group, that in the control and HF groups was no significant difference. Additionally, the Atrogin-1 and MuRF-1 mRNA expressions in the experimental groups were significantly higher than those in the control group, whereas those in the HF group were significantly lower than those in the immobilization and LF groups.

ROM of ankle joint dorsiflexion

The ROM of dorsiflexion in all groups was 160° at baseline, and was 160° in the control group during both experimental periods. At 1 and 2 weeks after immobilization, the ROM values were 118.1 ± 4.6° and 106.4°± 4.8°, 119.1 ± 8.0° and 107.2 ± 4.8°, and 124.4°± 6.0° and 115.9 ± 4.2° in the immobilization, LF, and HF groups, respectively (Fig 6A). During the 1- and 2-week experimental periods, the ROMs of dorsiflexion in the experimental groups were significantly lower than that in the control group and was higher in the HF group than in the immobilization and LF groups.
Fig 6

Range of motion of the ankle joint on dorsiflexion (A) and hydroxyproline content (B) in gastrocnemius muscle. Open circles and bars, control group (control). Black circles and bars, immobilization group (Im). Gray circles and bars, LF group. Hatched circles and bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency.

Range of motion of the ankle joint on dorsiflexion (A) and hydroxyproline content (B) in gastrocnemius muscle. Open circles and bars, control group (control). Black circles and bars, immobilization group (Im). Gray circles and bars, LF group. Hatched circles and bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. †Significant difference (p < 0.05) compared to the LF group. LF, low-frequency; HF, high-frequency.

Hydroxyproline content

The hydroxyproline content was 3.2 ± 0.9 μg/mg dry weight in the control group and 7.8 ± 2.1, 7.4 ± 1.4, and 4.9 ± 1.7 μg/mg dry weight, respectively, in the immobilization, LF, and HF groups at 2 weeks after immobilization (Fig 6B). The hydroxyproline content in the experimental groups was significantly higher than that in the control group and lower in the HF group than in the immobilization and LF groups.

PPT

The PPT of the gastrocnemius muscles in the control group was 210.2 ± 9.6 g at baseline, 221.8 ± 9.5 g at 1 week, and 230.9 ± 7.3 g at 2 weeks. In the immobilization group, the PPT was 207.1 ± 8.2 g at baseline, 167.6 ± 16.0 g at 1 week, and 161.0 ± 7.2 g at 2 weeks. In the LF group, the PPT was 208.2 ± 17.5 g at baseline, 188.4 ± 7.7 g at 1 week, and 194.9 ± 4.7 g at 2 weeks. In the HF group, the PPT was 205.8 ± 13.6 g at baseline, 188.4 ± 9.3 g at 1 week, and 191.8 ± 5.0 g at 2 weeks (Fig 7A). During the 1- and 2-week experimental periods, the PPT values of the gastrocnemius muscles in the experimental groups were significantly lower than that in the control group and were higher in the LF and HF groups than in the immobilization group.
Fig 7

Pressure pain threshold (A) and NGF content (B) in gastrocnemius muscle. Open circles and bars, control group (control). Black circles and bars, immobilization group (Im). Gray circles and bars, LF group. Hatched circles and bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. NGF, nerve growth factor; LF, low-frequency; HF, high-frequency.

Pressure pain threshold (A) and NGF content (B) in gastrocnemius muscle. Open circles and bars, control group (control). Black circles and bars, immobilization group (Im). Gray circles and bars, LF group. Hatched circles and bars, HF group. Data are presented as mean ± standard deviation. *Significant difference (p < 0.05) compared to the control group #Significant difference (p < 0.05) compared to the immobilization group. NGF, nerve growth factor; LF, low-frequency; HF, high-frequency.

NGF content

The NGF content was 9.6 ± 2.3 pg/mg dry weight in the control group at 2 weeks. In the immobilization, LF, HF groups, the content was 30.2 ± 5.0, 19.7 ± 3.6, and 21.0 ± 2.9 pg/mg dry weight, respectively, at 2 weeks after immobilization (Fig 7B). The hydroxyproline content was significantly lower in the HF group than those in the immobilization and LF groups, and did not differ significantly between the HF and control groups.

Discussion

This study investigated the biological effects of muscle contractile exercise using a belt electrode device to prevent immobilization-induced myofiber atrophy, muscle contracture, and muscular pain based on behavioral, histological, biochemical, and immunohistochemical analyses. In the immobilization group, the number of CD11b-positive cells increased 3.3-fold compared to that in the control group at 2 weeks after immobilization, consistent with the results of previous studies [7]. The mechanism underlying the increase in the number of macrophages has been described previously. Monocyte chemoattractant protein-1 (MCP-1) plays a key role in monocyte/macrophage migration [18]. In previous studies, MCP-1 mRNA expression in the gastrocnemius muscle was higher on the immobilized side than on the control side after 2 weeks of immobilization [19]. Additionally, in the soleus muscles of the same immobilized model, MCP-1 mRNA expression and the number of CD11b-positive cells increased after 2 weeks of immobilization. Our findings and those of previous studies regarding CD11b-positive cells demonstrated macrophage accumulation in immobilized gastrocnemius muscles. The relative weight ratio and CSA of the deep and superficial regions in the immobilization group were significantly lower than that in the control group. Previous reports demonstrated a decreased relative weight ratio in immobilized rat gastrocnemius muscles [20]. In addition, previous analysis of the CSAs of both regions showed significantly lower type I, IIa, and IIb myofiber diameters in immobilized gastrocnemius muscles compared to the control [10, 21]. Moreover, the PGC-1α mRNA expression in the immobilization group was significantly lower than that in the control group, the Atrogin-1 and MuRF-1 mRNA expression in the immobilization group were significantly higher than those in the control group. The downregulation of PGC-1α led to the overexpression of Atrogin-1 and MuRF-1, these alterations induced muscle fiber atrophy [5]. Furthermore, macrophage accumulation in skeletal muscle plays an important role in mediating the development of muscle fiber atrophy [22]. Therefore, we surmised that macrophage accumulation and changes in factors of muscle protein degradation were associated with immobilization-induced myofiber atrophy. Hydroxyproline is a unique amino acid composed of collagen; thus, increased hydroxyproline content indicates collagen overexpression known as fibrosis [23]. Reduction in muscle extensibility decreases joint mobility, thus contributing to muscle contracture. Fibrosis in skeletal muscle is strongly associated with reduced muscle extensibility [15, 24]. In addition, myofibroblasts produce large amounts of collagen and play a major role in pathological contracture. The upregulation of fibrosis-related factors via macrophage accumulation induces fibroblast differentiation into myofibroblasts [25, 26]. The results of the present study revealed significantly higher hydroxyproline content in the immobilization group than that in the control group, as well as a significantly lower ROM of dorsiflexion in the immobilization group than that in the control group. Fibrosis via macrophage accumulation may be related to the development of muscle contracture in immobilized gastrocnemius muscles. NGF is a strong pain mediator, with macrophages the main producing cells. NGF expression and hyperalgesia are associated with pathological muscle pain [27, 28]. Additionally, intramuscular injection of NGF decreased PPT in a dose-dependent manner in skeletal muscles [27, 29]. Furthermore, our findings suggested that the injection of an NGF receptor inhibitor increased PPT levels in immobilized gastrocnemius muscles [7]. Thus, NGF upregulation along with macrophage accumulation may be involved in immobilization-induced muscle pain. The HF treatment more effectively prevented muscle atrophy and contracture than LF, while both treatment groups showed similar preventive effects on muscle pain. The number of CD11b-positive cells in the HF group was significantly lower than those in the immobilization and LF groups. A previous report showed that physical exercise reduced macrophage response in the myocardium [30]. Additionally, electrical stimulation of muscle contractile exercise suppressed MCP-1 upregulation and macrophage accumulation [10]. Moreover, >200 muscle contractile exercises via electrical stimulation were required per set to maintain CSA; this alteration was caused by preventing macrophage accumulation [13, 31]. In the present study, the LF and HF groups performed 150 and 225 muscle contractile exercises per set, respectively. Therefore, sufficient muscle contractile exercise via electrical stimulation was applied to the immobilized gastrocnemius muscle only in the HF group, and this treatment may have suppressed macrophage accumulation. Macrophages phagocytose unnecessary cytoplasm via myonuclear apoptosis, which induces muscle fiber atrophy [1, 2]. Mechanical stimuli via electrical stimulation inhibit apoptosis by activating several signaling pathways [32]. Electrical stimulation prevents cell apoptosis by regulating pro- and anti-apoptotic proteins [33, 34]. Furthermore, muscle contractile exercise by electrical stimulation suppresses the reduction of myonuclei, and macrophage accumulation is mitigated in immobilized skeletal muscles [13]. In short, muscle contractile exercise with electrical stimulation may prevent a decrease in myonuclei via apoptosis, which may lead to the suppression of muscle fiber atrophy caused by macrophage accumulation. On the other hand, the downregulation of PGC-1α and the overexpression of Atrogin-1 and MuRF-1 were suppressed in the HF group. Muscle contractile exercise was necessary to keep PGC-1α homeostasis, this led to prevent the upregulation of ubiquitin-proteasome pathway enzymes [35]. Therefore, we surmised that the same alterations as above occurred in HF group. However, these beneficial effects were confirmed only in the superficial region of the gastrocnemius muscle. The motor unit of type IIb myofibers is larger than that of type I and IIa myofibers, and the electrical resistance is small in skeletal muscles with large motor units [36]. The unique effect of electrical stimulation on skeletal muscle is the reversal of the recruitment pattern, which is typically associated with voluntary muscle activation. Muscle contractile exercise with electrical stimulation occurs strongly in type IIb myofibers on the superficial region of skeletal muscles [37, 38]. Based on these reports, we surmised that muscle contractile exercise with electrical stimulation was effective in preventing type IIb myofiber atrophy in the superficial region of immobilized rat gastrocnemius muscles. Macrophage accumulation affected the upregulation of fibrosis-related factors, such as IL-1β and transforming growth factor (TGF)-β1, etc. [6]. However, in immobilized skeletal muscles subjected to muscle contractile exercise, the upregulation of IL-1β and TGF-β1 due to macrophage accumulation is suppressed [13]. Thus, the differentiation of fibroblasts into myofibroblasts via IL-1β/TGF-β1 signaling is disturbed and fibrosis, which is the main lesion of immobilization-induced muscle contracture, is prevented [13]. In the present study, the hydroxyproline content in the HF group was significantly lower than those in the immobilization and LF groups, and the ROM of dorsiflexion in the HF group was the highest among the experimental groups. Therefore, muscle contractile exercises based on the HF protocol may be effective in preventing immobilization-induced muscle contracture. The NGF content in the HF group was significantly lower than that in the immobilization group. Macrophage accumulation is mitigated in immobilized skeletal muscles [13, 31]. In addition, the reduction of macrophages induces NGF downregulation [39] and decreases NGF expression related to increased PPT in skeletal muscles [27]. The results of this study revealed higher PPT in the HF group than that in the immobilization group. Muscle contractile exercise with the HF protocol may prevent NGF upregulation via macrophage accumulation; moreover, these alterations may be involved in the suppression of immobilization-induced muscle pain. This study had several limitations. First, it is uncertain whether the current electrical stimulation protocol is the most effective. Further examination of various frequencies, intensities, duty cycles, times, and intraday sessions of electrical stimulation protocols is required. Additionally, this study was unable to determine why contractile exercise through the LF protocol showed a beneficial effect on the PPT of the gastrocnemius muscles. Further studies on the detailed polarization changes in M1 and M2 macrophages in the gastrocnemius muscles of the LF and HF groups are required to address this issue. Moreover, the present study could not confirm whether myonuclear apoptosis, a key lesion in macrophage accumulation, was suppressed by the muscle contractile exercise in the HF protocol. Future studies using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining of muscle sections are required to answer this question. Finally, data related to the causal relationship between cellular and molecular events were insufficient. Therefore, future studies using antagonists or inhibitors are warranted to address this limitation. In summary, muscle contractile exercise through a belt electrode device may be effective in preventing immobilization-induced myofiber atrophy, muscle contracture, and muscular pain in immobilized rat gastrocnemius muscles. (XLSX) Click here for additional data file. 25 Jun 2022
PONE-D-22-09461
Muscle contractile exercise through a belt electrode device prevents myofiber atrophy, muscle contracture, and muscular pain in immobilized rat gastrocnemius muscle
PLOS ONE Dear Dr. Honda, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. You will see that the reviewers have raised a range of concerns (please further below), from minor aspects on formatting to more substantial aspects on methodological clarity and approaches, which could alter the results and their interpretation. Therefore, I would invite you to carefully consider each comment and address it appropriately. Please submit your revised manuscript by Aug 09 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Theodoros M. Bampouras Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Dear Editor, Re: "Muscle contractile exercise through a belt electrode device prevents myofiber atrophy, muscle contracture, and muscular pain in immobilized rat gastrocnemius muscle " Thank you for my opportunity to review this manuscript. The study used the immobilized rat gastrocnemius muscle model to show the consequences of the belt electrode device on skeletal muscle. The device was used as the therapeutic method to alleviate the myofiber atrophy, muscle contracture, and muscular pain effects caused by immobilization. The objectives of the study are clearly stated, the concept and the experimental design of this study is well structured and the experiments are well conducted. However, there are points need to be addressed to increase the reliability and quality of the manuscript. Reviewer Comments: 1. The name of the abscissa axis in Figure 1. B is wrong, and the author wants to express the stimulation time, not the stimulation intensity. 2. The special symbols for p-values denoting between-group differences in Figure 2. B and Figure 5. B do not exactly match the legends. 3. According to the author's experimental results in Figure 4. A, we found that there are only type IIb muscle fibers in the superficial gastrocnemius muscle in this experiment. How to determine that there are only type IIb muscle fibers in the superficial gastrocnemius muscle? 4. In the text, the baseline PPT of the gastrocnemius muscles in the LF group was higher than that in the immobilization group. However, in Figure 6. A, the gastrocnemius muscle baseline PPT value in the LF group was lower than in the fixed group. Reviewer #2: This study was to test the physiological benefit of repeated muscle contractile exercise using a belt electrode device in an animal model with both ankle joints immobilization. The authors reported that myofiber atrophy, joint movement limitation, and mechanical muscle hyperalgesia were observed in immobilized rats, and muscle contractile exercise through the belt electrode device was beneficiary in preventing them. In general, the study has translational significance followed with previous studies. The method was detailed, and data were presented clearly to support the conclusion. However, there are some major comments to improve this paper before I would recommend that the paper be published. If the authors can address my concerns, I am happy to review this paper again. In addition, here are some minor essential changes needed and some suggestions to consider. Major essential changes needed: 1. In this study, myonuclear apoptosis is mentioned as one of the mechanisms of skeletal muscle atrophy, but the involvement of muscle protein synthesis and degradation is ignored. The total and phosphorylated forms of Akt, p70S6K, and 4E-BP1 (FoxO 1/3 phosphorylation would also be informative) in each experimental group should be added as items to be examined. For example, the time course of the acute effect of a single bout of muscle contractile exercise through the belt electrode device on their phosphorylation should be investigated. In particular, Akt-mTOR signaling pathways may orchestrate both a positive protein metabolism in skeletal muscle and myonuclear apoptosis. 2. Methods. In statistical analysis for "range of motion on ankle joint dorsiflexion" and "pressure pain threshold", a split-plot ANOVA using 2 factors (time [baseline vs. 1W vs. 2W] and group [control vs. immobilization vs. LF vs. HF]) must be used to determine the interaction and main effects, after verifying the normality of the data. Minor essential changes needed: 1. Methods. Please add the length of time between last electrical stimulation, and euthanasia and tissue collection. Exercise itself can raise macrophage accumulation, NGF upregulation, and some cytokines in tissues. This will help exercise physiology readers interpret the results compared to their own. 2. Methods. The authors described "2 sec (do)/6 sec (rest) duty cycle" as low-frequency and "2 sec (do)/2 sec (rest) duty cycle" as high-frequency for electrical stimulation conditions. It is necessary to clarify the definition of low-frequency or high-frequency in the electrical stimulation conditions. 3. Methods. To mention that 60% maximal voluntary contraction is most effective in preventing skeletal muscle atrophy, should be provided a clear link to the previous studies referenced. In general, it is defined not only by the intensity of muscle contraction exercise, but also by the number of exercises and the number of sets. 4. Methods. What is the stimulus intensity you set when you conducted the preliminary experiment to determine the stimulus time? 5. Results. For histological observation, the quality of the tissue images stained with immunohistochemistry (Figure 2A) and H&E (Figure 3) were poor in the PDF file. Minor suggested changes: 1. Introduction. Hypotheses should be added at the end of the Introductory section. 2. Results. In lines 224 on page 10 to line 226 on page 11, "In the immobilization, LF, and HF groups..." seems to be more appropriate than "In the immobilization, LF, HF groups...". 3. Results. In lines 253-254 on page 12, “The CSA of type IIa myofibers was...” could be more accurate if change to “The CSA of type IIa myofibers in the deep region was...”. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Yun Zhou Reviewer #2: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10 Aug 2022 Response to the Editor-in-Chief and reviewers We would like to thank both the reviewers for evaluating our study and their constructive criticism, which allowed us to strengthen and clarify our study's conclusions. We have responded in detail to each comment and discussed how the concerns raised were addressed in the revised manuscript. Journal Requirements 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_ sample_title_authors_affiliations.pdf We revised our manuscript according to The PLOS ONE style templates. Comments to the Author 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. We submitted all data sheets (supplemental file) according to your advice. Reviewer: 1 1. The name of the abscissa axis in Figure 1. B is wrong, and the author wants to express the stimulation time, not the stimulation intensity. We revised Fig 1.B according to your advice. 2. The special symbols for p-values denoting between-group differences in Figure 2. B and Figure 5. B do not exactly match the legends. We modified our legends according to your advice. 3. According to the author's experimental results in Figure 4. A, we found that there are only type IIb muscle fibers in the superficial gastrocnemius muscle in this experiment. How to determine that there are only type IIb muscle fibers in the superficial gastrocnemius muscle? We confirmed all parts in the ATPase-stained cross-sections, and we examined the deep regions (supplement figure 1, blue square) and the superficial regions (supplement figure 1, red square) separately. From supplement figure 1, the superficial regions consisted entirely of type IIb fibers. In addition, the previous report supported this point1). 1) Kernell D, Lind A, van Diemen AB, De Haan A. Relative degree of stimulation-evoked glycogen degradation in muscle fibres of different type in rat gastrocnemius. J Physiol. 1995;484:139-153. 4. In the text, the baseline PPT of the gastrocnemius muscles in the LF group was higher than that in the immobilization group. However, in Figure 6. A, the gastrocnemius muscle baseline PPT value in the LF group was lower than in the fixed group. We retouched the figure of PPT according to your advice. Reviewer: 2 Major essential changes needed: 1. In this study, myonuclear apoptosis is mentioned as one of the mechanisms of skeletal muscle atrophy, but the involvement of muscle protein synthesis and degradation is ignored. The total and phosphorylated forms of Akt, p70S6K, and 4E-BP1 (FoxO 1/3 phosphorylation would also be informative) in each experimental group should be added as items to be examined. For example, the time course of the acute effect of a single bout of muscle contractile exercise through the belt electrode device on their phosphorylation should be investigated. In particular, Akt-mTOR signaling pathways may orchestrate both a positive protein metabolism in skeletal muscle and myonuclear apoptosis. Your advice was very important. Thomason DB indicated that muscle protein degradation was more influential than muscle protein synthesis for muscle atrophy in 2-week immobilization1). Atrogin-1 and muscle RING-finger protein (MuRF)-1 as ubiquitin-proteasome pathway enzymes played a main role in muscle protein degradation2). Also, peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α was the main regulator for Atrogin-1 and MuRF-13). Therefore, we examined the mRNA expression of PGC-1α, Atrogin-1, and MuRF-1. As a result, the PGC-1α mRNA expression in the immobilization and LF groups was significantly lower than that in the control group, that in the control and HF groups was no significant difference. Additionally, the Atrogin-1 and MuRF-1 mRNA expressions in the experimental groups were significantly higher than those in the control group, whereas those in the HF group were significantly lower than those in the immobilization and LF groups. From these results, muscle contractile exercise through a belt electrode device may prevent the progression of muscle protein degradation. These contents were reflected in our manuscript. 1) Thomason DB, Booth FW. Atrophy of the soleus muscle by hindlimb unweighting. J Appl Physiol (1985). 1990;68:1-12. 2) Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA et al. Identification of ubiquitin ligases required for skeletal muscle atrophy. J Science. 2001;294:1704-1708. 3) Kang C, Ji LL. Muscle immobilization and remobilization downregulates PGC-1α signaling and the mitochondrial biogenesis pathway. J Appl Physiol 2013;115: 1618-1625. 2. Methods. In statistical analysis for "range of motion on ankle joint dorsiflexion" and "pressure pain threshold", a split-plot ANOVA using 2 factors (time [baseline vs. 1W vs. 2W] and group [control vs. immobilization vs. LF vs. HF]) must be used to determine the interaction and main effects, after verifying the normality of the data. Thank you for your advice. We modified the statistical process. "range of motion on ankle joint dorsiflexion" and "pressure pain threshold" were assessed using two-way ANOVA, followed by Scheffé’s method. Differences were considered statistically significant at p < 0.05. We added these contents to our manuscript (P10, L218-219). Minor essential changes needed: 1. Methods. Please add the length of time between last electrical stimulation, and euthanasia and tissue collection. Exercise itself can raise macrophage accumulation, NGF upregulation, and some cytokines in tissues. This will help exercise physiology readers interpret the results compared to their own. Based on the previous study, we biopsied 12 hours after the last electrical stimulation1). We added this contents to our manuscript (P8, L169-170). 1) Tanaka M, Morifuji T, Sugimoto K, Akasaka H, Fujimoto T, Yoshikawa M, et al. Effects of combined treatment with blood flow restriction and low-current electrical stimulation on capillary regression in the soleus muscle of diabetic rats. J Appl Physiol (1985). 2021:1219-1229. 2. Methods. The authors described "2 sec (do)/6 sec (rest) duty cycle" as low-frequency and "2 sec (do)/2 sec (rest) duty cycle" as high-frequency for electrical stimulation conditions. It is necessary to clarify the definition of low-frequency or high-frequency in the electrical stimulation conditions. Dow DE examined the effect of the difference in the number of muscle contractions on muscle atrophy1). Dow DE suggested that 200 contractions per day would be a good design choice to maintain mass, force, and fiber CSA while minimizing energy transfer that may negatively affect the tissue and decrease battery life. In our study, the LF and HF groups had 150 and 225 contractions per day. Therefore, we distinguished the 2 groups from the number of muscle contractions. 1) Dow DE, Cederna PS, Hassett CA, Kostrominova TY, Faulkner JA, Dennis RG. Number of contractions to maintain mass and force of a denervated rat muscle. Muscle Nerve. 2004;30:77-86. 3. Methods. To mention that 60% maximal voluntary contraction is most effective in preventing skeletal muscle atrophy, should be provided a clear link to the previous studies referenced. In general, it is defined not only by the intensity of muscle contraction exercise, but also by the number of exercises and the number of sets. American College of Sports Medicine indicated that the intensity of muscle contractile exercise was one of the important factors for increasing muscle strength1). Concretely, the muscle contractile exercise in 60% MVC produced the largest effect sizes for strength increases1). Furthermore, the same report suggested that the alteration of cross-sectional areas was one of the main components to define muscle strength1). From these, we surmised that the muscle contractile exercise in 60% MVC was most effective to prevent muscle atrophy. 1) American College of Sports Medicine. American College of Sports Medicine position stand. Progression models in resistance training for healthy adults. Med Sci Sports Exerc. 2009;41:687-708. 4. Methods. What is the stimulus intensity you set when you conducted the preliminary experiment to determine the stimulus time? We set the stimulus intensity to 4.7 mA in the preliminary experiment to determine the stimulus time. 5. Results. For histological observation, the quality of the tissue images stained with immunohistochemistry (Figure 2A) and H&E (Figure 3) were poor in the PDF file. We modified the dpi of figure 2A and 3. Minor suggested changes: 1. Introduction. Hypotheses should be added at the end of the Introductory section. We revised our manuscript according to your advice. 2. Results. In lines 224 on page 10 to line 226 on page 11, "In the immobilization, LF, and HF groups..." seems to be more appropriate than "In the immobilization, LF, HF groups...". We modified our manuscript according to your advice (P11, L225). 3. Results. In lines 253-254 on page 12, “The CSA of type IIa myofibers was...” could be more accurate if change to “The CSA of type IIa myofibers in the deep region was...”. We retouched our manuscript according to your advice (P12, L254 and L257). Submitted filename: response letter.docx Click here for additional data file. 12 Sep 2022 Muscle contractile exercise through a belt electrode device prevents myofiber atrophy, muscle contracture, and muscular pain in immobilized rat gastrocnemius muscle PONE-D-22-09461R1 Dear Dr. Okita, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Theodoros M. Bampouras Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The revised version of the manuscript by Honda Y et al. has included satisfactory changes and the queries raised have also been adequately dealt with. Reviewer #2: The authors have been very responsive to my concerns. I have no more concerns. I agree with their statements and changes in response to the other reviewers as well. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Yun Zhou Reviewer #2: Yes: Masahiro Iwata ********** 16 Sep 2022 PONE-D-22-09461R1 Muscle contractile exercise through a belt electrode device prevents myofiber atrophy, muscle contracture, and muscular pain in immobilized rat gastrocnemius muscle Dear Dr. Okita: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Theodoros M. Bampouras Academic Editor PLOS ONE
  38 in total

1.  Organization and distribution of intramuscular connective tissue in normal and immobilized skeletal muscles. An immunohistochemical, polarization and scanning electron microscopic study.

Authors:  Tero A H Järvinen; Laszló Józsa; Pekka Kannus; Teppo L N Järvinen; Markku Järvinen
Journal:  J Muscle Res Cell Motil       Date:  2002       Impact factor: 2.698

2.  Effects of the belt electrode skeletal muscle electrical stimulation system on lower extremity skeletal muscle activity: Evaluation using positron emission tomography.

Authors:  Hitoaki Numata; Junsuke Nakase; Anri Inaki; Takafumi Mochizuki; Takeshi Oshima; Yasushi Takata; Seigo Kinuya; Hiroyuki Tsuchiya
Journal:  J Orthop Sci       Date:  2015-11-21       Impact factor: 1.601

3.  Upregulation of interleukin-1β/transforming growth factor-β1 and hypoxia relate to molecular mechanisms underlying immobilization-induced muscle contracture.

Authors:  Yuichiro Honda; Junya Sakamoto; Jiro Nakano; Hideki Kataoka; Ryo Sasabe; Kyo Goto; Miho Tanaka; Tomoki Origuchi; Toshiro Yoshimura; Minoru Okita
Journal:  Muscle Nerve       Date:  2015-06-30       Impact factor: 3.217

4.  Time-course study of macrophage infiltration and inflammation in cast immobilization-induced atrophied muscle of mice.

Authors:  Noriaki Kawanishi; Tomoko Funakoshi; Shuichi Machida
Journal:  Muscle Nerve       Date:  2018-02-05       Impact factor: 3.217

5.  Changes in quadriceps femoris muscle strength using isometric exercise versus electrical stimulation.

Authors:  R J Kubiak; K M Whitman; R M Johnston
Journal:  J Orthop Sports Phys Ther       Date:  1987       Impact factor: 4.751

Review 6.  Motor unit recruitment during neuromuscular electrical stimulation: a critical appraisal.

Authors:  C Scott Bickel; Chris M Gregory; Jesse C Dean
Journal:  Eur J Appl Physiol       Date:  2011-08-26       Impact factor: 3.078

Review 7.  Effects of electrical stimulation on cell proliferation and apoptosis.

Authors:  Maria R Love; Siripong Palee; Siriporn C Chattipakorn; Nipon Chattipakorn
Journal:  J Cell Physiol       Date:  2017-06-06       Impact factor: 6.384

8.  Relationship between extensibility and collagen expression in immobilized rat skeletal muscle.

Authors:  Yuichiro Honda; Miho Tanaka; Natsumi Tanaka; Ryo Sasabe; Kyo Goto; Hideki Kataoka; Junya Sakamoto; Jiro Nakano; Minoru Okita
Journal:  Muscle Nerve       Date:  2017-12-08       Impact factor: 3.217

9.  Repeated intramuscular injections of nerve growth factor induced progressive muscle hyperalgesia, facilitated temporal summation, and expanded pain areas.

Authors:  Koei Hayashi; Shinichiro Shiozawa; Noriyuki Ozaki; Kazue Mizumura; Thomas Graven-Nielsen
Journal:  Pain       Date:  2013-07-16       Impact factor: 6.961

10.  Macrophage depletion suppresses sympathetic hyperinnervation following myocardial infarction.

Authors:  Gwenaelle Wernli; Wohaib Hasan; Aritra Bhattacherjee; Nico van Rooijen; Peter G Smith
Journal:  Basic Res Cardiol       Date:  2009-05-13       Impact factor: 17.165

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.