Literature DB >> 36147796

DNMT1 Gene Expression in Patients with Helicobacter pylori Infection.

Manouchehr Ahmadi Hedayati1,2, Amjad Ahmadi3,4, Zahed Khatooni5.   

Abstract

DNMT1, as a critical enzyme affecting epigenetics through methylation of DNA cytosine-rich sequences, regulates gene expression. Exterior factors including long-term infections, in this study Helicobacter pylori infection, could change host cells' epigenetics by affecting DNMT1 gene expression. This study investigated the statistical correlation between H. pylori virulence genes and DNMT1 gene expression in gastric antral epithelial cells of gastric adenocarcinoma and gastritis patients. In a case-control study, 50 and 53 gastritis and gastric adenocarcinoma antral biopsies, including 23 and 21 patients with H. pylori infection, respectively, were collected from hospitals in the west of Iran. Having extracted total RNA from gastric biopsy samples, cDNA was synthesized and virulence genes of H. pylori were detected by using the PCR method. Relative real-time RT PCR was used to detect ΔΔCt fold changes of the DNMT1 gene expression in divided groups of patients based on H. pylori infection and clinical manifestations. The results showed that along with increasing patients' age, the DNMT1 gene expression will increase in gastric antral epithelial cells of gastric cancer patients (P ≤ 0.05). On the other hand, the biopsy samples with infection of H. pylori cagA, cagY, and cagE genotypes revealed a direct correlation along with increased DNMT1 gene expression. This study revealed the correlations of H. pylori cag pathogenicity island genes with increased DNMT1 gene expression.
Copyright © 2022 Manouchehr Ahmadi Hedayati et al.

Entities:  

Year:  2022        PMID: 36147796      PMCID: PMC9489387          DOI: 10.1155/2022/2386891

Source DB:  PubMed          Journal:  ScientificWorldJournal        ISSN: 1537-744X


1. Introduction

Methylation is a common epigenetic trend in handling cell gene expression [1]. DNMT [DNA (cytosine-5)-methyltransferase] enzymes contribute to the expression of growth-promoting genes and cell differentiation by directly adding and removing methyl groups to cytosine and histones [2]. Mammalian cells' DNMTs include DNMT1, DNMT3A, and DNMT3B; in the meantime, DNMT1 methylates CpG cytosine-rich sequences in the gene's promotors of the newly synthesized DNA strand [1, 3]. The results of related studies show that functionally defective DNMT enzymes increase the incidence of adenocarcinoma [4-6]. By means of this, cell proliferation will be increased following the effects of DNMTs inactivating adenocarcinoma suppressor genes through over-methylation [1, 7]. The molecular mechanism of carcinogens is conducted through their effects on DNMT activity; for instance, microbes such as uropathogenic E. coli increase the DNMT1 gene expression in host cells [8-12]. Cell signaling studies show that the APC (Adenomatous Polyposis Coli) as a tumor suppressor gene and a regulator of the Wnt signaling pathway through β-catenin stability and/or degradation controls DNMT1 gene expression [13]. The Wnt (Wingless oncogene INT1) receptors affect the APC/β-Catenin signaling complex, then releasing β-Catenin and activating the TCF (T-cell factor) transcription factor following attach to the DNMT1 gene promoter block gene expression [13-15]. In this regard, clinical complications are impressed with the direct interaction of DNMT1 protein with the APC/β-Catenin signaling complex that has strongly been reported in colorectal adenocarcinoma mice [15]. In addition, the basic studies show bacteria reduce the expression of Wnt/β-Catenin repressor genes causing an increased expression of the DNMT1 gene [16-18]. Upregulation of Cadherin-1 (CDH1), as an inhibitor of lung cell metastasis, reduces Wnt/β-Catenin activity in non-small-cell lung adenocarcinoma cells [19-21]. Furthermore, methylation of the CpG sequences in the promoter of the CDH1 gene by DNMT1 leads to preventing its expression [21]. Regarding the results of molecular-oriented studies, Helicobacter pylori CagA (Cytotoxin-associated gene A) protein disrupts the Wnt/β-Catenin signaling pathway leading to an increase in DNMT1 gene expression [22-24]. Epstein–Barr virus (EBV) as a well-known carcinogenic viral agent infects B lymphocytes and increases the activity of the DNMT1 enzyme [25, 26]. The relevant studies show that EBV infections have a high prevalence in human societies; in addition, a small percentage of people show H. pylori and EBV co-infection [27-30]. This hypothesis supported that the H. pylori and EBV co-infection could lead to further DNMT1 gene upregulation and accelerates the process of gastric epithelial cell carcinoma [30, 31]. This study aimed to investigate the correlation between H. pylori virulence genes and the DNMT1 gene expression in gastric epithelial cells of patients.

2. Materials and Methods

2.1. Sampling

A case-control study was designed involving gastritis and gastric adenocarcinoma patients as the control and case groups, respectively. 53 and 50 patients with gastric adenocarcinoma and gastritis were enrolled. The cDNA of H. pylori virulence genes in biopsy specimens was detected by conventional PCR (polymerase chain reaction) [32]. The consecutive sampling method was used to collect gastric biopsy samples from patients with gastrointestinal symptoms referred to Tohid and Shahid Ghazi hospitals in Sanandaj city, located in the west of Iran [33-35]. The urea breath test was used to determine the H. pylori active infection [33]. Gastric antral biopsy specimens were obtained from each patient for molecular analysis of H. pylori genotypes, EBV infection, and DNMT1 gene expression. The gastric biopsy specimen was immediately dropped into RNALater (Roche Co.) solution and transferred to the Molecular Microbiology Laboratory of Kurdistan University of Medical Sciences. A clinicopathological biopsy sample was collected from the gastric carcinoma tumor area of patients with gastric adenocarcinoma and transferred to Tohid Hospital Pathology Laboratory. To evaluate the clinicopathological biopsy, the Kaplan–Meier method was used, including stage (TNM system (tumor-node-metastasis)) and tumor grade (including 1, 2, 3, and 4 grades) as macroscopic and microscopic examination methods, respectively [36].

2.2. H. pylori Virulence Gene PCR

Total RNA was extracted from patients' gastric biopsy specimens by using an RNA extraction kit (Takara Co.) and immediately converted to cDNA. The extracted RNA integrity was evaluated by observing the 28S and 18S rRNA bands on the 1.2% agarose gel [37]. The absorbance ratio at 260 nm and 280 nm was assessed for the purity of RNA by using NanoDrop® 2000 spectrophotometer machine (Thermo Fisher Company, Germany) [37]. Using online primer three software (version 0.4.0), specific primers of H. pylori virulence genes were designed and synthesized (Bioneer, South Korea Co.). First, the H. pylori 16s rDNA gene primer was used to determine the H. pylori genome's cDNA by PCR (Table 1). Other primers of H. pylori virulence genes were used in the biopsy specimens of patients with positive-H. pylori 16s rDNA gene. The annealing temperature of H. pylori virulence genes' specific primers is shown in Tables 1 and 2. PCR master mix was included buffer 10X (2.5 microlitre), DNA Taq polymerase 5U/microliter (0.25 microlitre), dNTPs 10 mM (0.5 microlitre), MgCl2 50 mM (1 microlitre), cDNA (2 microlitre), forward and reverse specific primers 10 picoliter (each one 0.5 microlitre) and RNase-free water (12.75 microlitre) in final volume 20 microlitre [37]. The Thermal cycling PCR steps involved an initial denaturation at 94°C for 5 minutes, a denaturation at 94°C for 30 seconds, a primer annealing for 45 seconds (temperatures are shown in Table 1), an extension at 72°C for 45 seconds, and a final extension at 72°C for 5 minutes [37]. The PCR product was rounded on 1.5% agarose gel.
Table 1

Primers of H. pylori T4SS, 16s rDNA, and vacA in simple PCR.

Specific primersSequenceAnnealing, Tm °CProduct size, bpReference
16s rDNA H. pylori FCTGGAGAGACTAAGCCCTCC50446This study
16s rDNA H. pylori RAGGATCAAGGTTTAAGGATT
cagA FTGACCAACAACCACAAACCG57108This study
cagA RTCAGGATCGTATGAAGCGACAG
cagA EPIYA-C FAAGAAAGCAGGACAAGCAGC55188This study
cagA EPIYA-C RCTAACCGATCGCCCTACCTT
cagT FAGGGTGTGGTGATGATAGCG55154This study
cagT RTGCTTGTTGTTTGCTCCACT
cagE FGAATGGAGCGAGCGATGAAA56163This study
cagE RTAGGAATTTGCAGCGCTCAC
cagY FAGTTCAAGTGGCGCTAGATTG57200This study
cagY RACAAGCCTTTCAAGCATTCGT
vacA s1/s2 FATGGAAATACAACAAACACAC55259/286[38]
vacA s1/s2 RCTGCTTGAATGCGCCAAAC
vacA m1/m2 FTGGATAGTGCGACTGGGTTT54205/220This study
vacA m1/m2 RTCCATGCGGTTGTTGTTGTT

The primers yield various vacA depending on a repetitive nucleotide sequence in some vacA alleles.

Table 2

Primers of H. pylori adhesins and surface proteins.

Specific primersSequenceAnnealing, Tm °CProduct size, bpReference
iceA1 FGTGTTTTTAACCAAAGTATC45247[39]
iceA1 RCTATAGCCASTYTCTTTGCA
iceA2 FGTTGGGTATATCACAATTTAT47229/234[39]
iceA2 RTTRCCCTATTTTCTAGTAGGT
hopQIe FACGAACGCGCAAAAACTTTA55187[40]
hopQI RTTGCCATTCTCATCGGTGTA
hopQII FACAGCCACTCCAATCCAGAA55160[40]
hopQII RAACCCCACCGTGGATTTTAG
babA2 FCAATGCGGTGCGTGAAAATC57205This study
babA2 RATACCCTGGCTCGTTGTTGA
babB FCAATTCCCCGGCGTATCAAG56175This study
babB RATTGCAAGTGATGGTCGTCG
sabA FTCTCTCGCTTGCGGTATCAT56204This study
sabA RAGCTCAATGTTGTTGGCGTT
sabB FGCATTCAAACGGCGAACAAC56248This study
sabB RTCCTGTGCAGTTCCCATCTT
alpA FCGCTCCTATCAAAACCGCTC55185This study
alpA RTTCCCGTCCAACTTACCGAA
alpB FTCAACTTGCGAGCAGACCTA57218This study
alpB RAGCCATAGACCCCATACACG
oipA FCTCCACGCTGAAAGGAATGG55233This study
oipA RCCATTTCCTGCGAATCGGTT

2.3. EBER PCR

To detect the EBV virus genome, EBER (Epstein–Barr virus-encoded small RNAs) gene's cDNA was detected by PCR in the gastric epithelial antral biopsy samples. EBER-specific primers were checked by using the Epstein–Barr virus (Human gamma herpes virus 4) gene sequence in the GenBank and online primer software 3. Table 3 shows the sequence and annealing temperature of the EBER-specific primers. According to the standard PCR protocol, PCR was performed to determine gastric epithelial cells' infection to the EBER sequence.
Table 3

Specific primers of the DNMT1 gene in real-time RT PCR.

Specific primersSequenceAnnealing, Tm °CProduct size, bpReference
GAPDH FACCCTGTTGCTGTAGCCA56102Universal
GAPDH RCCACTCCTCCACCTTTGAC
DNMT1 FAGAACGGTGCTCATGCTTACA5681[41]
DNMT1 RCTCTACGGGCTTCACTTCTTG
EBER FAGGACAGCCGTTGCCCTAGTGGTT60173This study
EBER RAAAAATAGCGGACAAGCCGAATACC

2.4. DNMT1 Gene Real-Time PCR

The DNMT1-specific primers as the target gene and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as internal genes were checked using gene sequence in the GenBank and online primer software 3 (Table 3). The PCR amplification program began with a 10 minute denaturation step at 95°C and then 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds [37]. The relative amounts of the DNMT1 expression gene between gastritis (control group) and gastric adenocarcinoma (case group) patients were evaluated by ΔCt (threshold cycle) = Ct (DNMT1) Ct (GAPDH). Finally, the DNMT1 gene expression fold changes were calculated by the 2−ΔCt formula [42].

2.5. Statistical Methods

Statistical analysis of the results was performed using SPSS (Statistical Package for the Social Sciences) software version 26. Correlations between qualitative variables, including sex, disease, and H. pylori infection, were calculated using chi-square and crosstab statistical tests [35]. To investigate the DNMT1 gene ΔCt as a quantitative variable in different groups and subgroups, the distribution of the DNMT1 gene ΔCt was detected using the Kolmogorov–Smirnov test [35]. The DNMT1 gene ΔCt values showed normal distribution, so Student's T-tests and ANOVA analysis were used to investigate the correlation between DNMT1 gene expression in different groups [35]. A P value less than 0.05 was considered a statistically significant level for measures [35].

3. Results

The demographic results showed that gastric adenocarcinoma's prevalence gradually increased with increasing age (Table 4). The prevalence of gastric adenocarcinoma in men was 2.31-fold higher than in women (Table 4). As adenocarcinoma prevalence, the H. pylori infection increased with age increasing (Table 5). The highest H. pylori infection rate was observed in the range between 61 and 85 years old (Table 5). The prevalence of H. pylori infection in men in the study was 1.75-fold higher than in women (Table 5). The statistical relationship between DNMT1 gene expression and demographic variables was investigated using the T-test. This study showed a gradually increased DNMT1 gene expression with along increasing age (Table 6). In gastric antral epithelial cells of both groups of patients with H. pylori infection and gastric adenocarcinoma, the DNMT1 gene expression was significantly increased (Table 6). The DNMT1 gene expression in women was 2.07-fold higher than in men, without statistical correlations (P ≤ 0.094) (Table 6).
Table 4

Demographic characteristics of patients and correlation of demographic variables.

GastritisGastric adenocarcinomaTotal P value ≤
H. pylori infection (positive/negative)23/2721/3244/590.513
Sex (male/female)24/2637/1650/530.024
Age group (18–30/31–45/46–60/61–85)10/18/17/50/1/14/3810/19/31/430.001
Table 5

Demographic characteristics of patients with H. pylori infection.

H. pylori infection (n: 103)Sex (n)Age group (n)
MaleFemale18–3031–4546–6061–85
H. pylori infection28162111417
(Positive)
H. pylori infection3326881726
(Negative)
Total614210193143
Table 6

Correlation of DNMT1 gene ΔCt in gastric antral epithelial cells of patients with gastritis and gastric adenocarcinoma with the Spearman statistical test patients' demographic characteristics.

SexAge groupDisease H. pylori infectionGastric adenocarcinoma areaTumor grade
DNMT1 correlation−0.244−0.475−0.366−0.472−0.2910.012
P value≤0.0940.0010.0100.0010.1890.956
A survey of cDNA of H. pylori virulence genes in gastric biopsy specimens revealed the lowest and highest frequencies for cagE and oipA (Outer Inflammatory Protein) in gastritis patients and sabAB (Sialic Acid Binding Adhesin) (the gastric biopsy samples with both H. pylori sabA and sabB genotypes infection), oipA, and cagT in gastric adenocarcinoma patients, respectively (Table 7). A significant difference between cDNAs ΔCt of cag genes was observed in gastritis biopsy specimens of gastritis patients (P  ≤ 0.05) (Table 7). The H. pylori cagE−, cagA−EPIYAC−, and cagA− genotypes showed a strong correlation with gastritis (Table 7). The results of this study showed that gastric biopsy specimens with H. pylori cagY and cagT genotypes infection correlated with gastric adenocarcinoma (Table 7). The hopQ− (Helicobacter Outer Membrane Protein) and hopQII genotypes of H. pylori were correlated with gastritis and gastric carcinoma, respectively (P ≤ 0.05). Gastric biopsy specimens of patients with the H. pylori cagY+, cagE, and cagA  genotypes infection showed a negative correlation with the DNMT1 gene ΔCt (Table 8). These results indicate an increase in DNMT1 gene expression in gastric biopsy specimens (Table 9). The DNMT1 gene expression with statistically significant differences in patients' subgroups was calculated using the ΔΔCt formula (Table 9). The results showed the lowest and highest expression of the DNMT1 gene in the youngest and oldest patients with a range age of 30–18 and 61–85 years, respectively (Table 9). The DNMT1 expression genes in the age group of 61–85 years were 5.32-fold higher than in 18–30 years old (Table 9). The DNMT1 gene expression in gastric adenocarcinoma patients was 3.25-fold higher than in gastritis patients (Table 9). The difference was 3.11-fold higher in the group of patients with H. pylori infection than without H. pylori infection (Table 9). The DNMT1 gene expression in the groups of patients with H. pylori cagE, cagY, and cagA  genotypes infection compared to patients with H. pylori cagE−, cagY−, and cagA− genotypes infection was 4.09-, 3.08-, and 3.04-fold, respectively (Table 9) (P ≤ 0.05).
Table 7

Frequency of H. pylori genotypes in gastric epithelial cells of patients with gastritis and gastric adenocarcinoma.

H. pylori + (N: 44)Gastritis (N: 23)Gastric adenocarcinoma (N: 21) P value≤
VacA s1m1 7120.074
vacA s1m2 169
cagA + 22100.001
cagA 111
CagAEPIYAC22100.001
CagAEPIYAC+19
CagT + 17210.012
CagT 60
CagY + 5170.001
CagY 184
CagE + 090.001
CagE 2312
Sab + (A/B/AB) 12/2/15/9/30.022
Sab 84
Bab + (A2/B/A2B) 4/3/15/5/40.155
Bab 157
HopQ + (I/II) 4/57/110.006
HopQ 143
Alp + (A/AB) 11/611/70.610
Alp 63
OipA + 20210.086
OipA 30
IceA2 11100.989
iceA1/2 1211
Table 8

Correlation between DNMT1 gene ΔCt in gastric antral epithelial cells of gastritis and gastric adenocarcinoma patients with H. pylori virulence gene cDNAs using the Spearman test.

vacA s1m1/s1m2 cagA cagA−EPEAYC cagT CagY cagE sabA/B babA2/B hopQI/II alpA/B oipA iceA1/2
DNMT1 correlation0.116−0.388−0.2930.209−0.446−0.5170.3130.1760.155−0.0400.196−0.366
P value ≤0.5890.0230.0930.3260.0290.0020.1360.4110.4690.8530.3590.078
Table 9

Analysis of the relationship between gastric diseases, tumor grade, vacA cDNA, and H. pylori infection variables with DNMT1 gene ΔCt (T-test).

N Mean ΔCt DNMT1Standard deviationFold change P value≤
Age group18–30106.57891.723395.320.001
61–85434.16801.93520

DiseaseGastritis536.52271.602693.250.010
Gastric adenocarcinoma504.82261.89975

H. pylori infectionPositive444.76671.994913.110.001
Negative596.40351.49580

cagA Positive166.12001.322373.040.023
Negative287.72671.66526

cagY Positive235.97791.506563.080.029
Negative217.60301.62487

cagE Positive156.10481.301114.090.002
Negative298.13601.48652

4. Discussion

The patients' demographic results of the current study complied with related previous studies' results [33, 43–45]. The prevalence of gastric adenocarcinoma among men was 4 times higher than among women, and the highest adenocarcinoma growth rate was observed among the oldest patients' group (Table 4). According to other study results, H. pylori infection is directly associated with the prevalence of gastric adenocarcinoma, however, our study results showed no significant correlation [44, 45]. In this regard, in the sampling step, we excluded patients with a history of arbitrary use of the anti-H. pylori chemotherapy without a medical prescription. So, it could be the possible reason for no significant correlation between H. pylori infection and gastric adenocarcinoma prevalence in our patients. The DNMT1 enzyme contributes to cell proliferation by methylation and blocking the tumor suppressor genes֝ expression [1]. The DNMT1 gene֝s expression is a consequence of cell signaling pathways leading to cell growth and proliferation [1]. According to the results of previous studies, the DNMT1 gene's expression in gastric epithelial cells increases with age increasing, gastric adenocarcinoma, and H. pylori cagA genotype infection [46-51]. Previous studies show that the H. pylori CagA oncoprotein interferes with the Wnt/β-Catenin signaling pathway and increases DNMT1 gene expression and cell proliferation [22, 23]. CagA inhibits GSK3 (Glycogen Synthase Kinase 3) activity by stimulating c-Met via the PI3K-AKT pathway [22]. By inactivating GSK3, the β-Catenin/TCF complex is inactivated, and the DNMT1 gene is expressed [13, 15, 16, 18]. The H. pylori VacA inhibits GSK3 activity by influencing EGFR receptors via the PI3K-AKT pathway [22, 52, 53]. Some studies show that H. pylori CagA proteins also increase the DNMT1 gene expression and accelerate the methylation process of tumor suppressor genes by affecting integrin receptors and the JAK/STAT3 signaling pathway [22]. The results of the current study were consistent with the Ma et al. (2017) study that showed an increased DNMT1 gene expression increases the chance of developing gastric adenocarcinoma [54]. However, they showed the increased DNMT1 gene expression was not correlated with the prognosis and clinicopathological including gastric adenocarcinoma area and grade tumor consonant with the present study (Table 6). As the results of relevant other studies, the present study results showed that the H. pylori cagA, cagE, and cagY genotypes positively correlate with the DNMT1 gene֝s expression [8]. The H. pylori vacA genotypes showed no statistical correlation with DNMT1 gene֝s expression, which is in contrast with the results of previous studies [8]. In this case, the current study results support the correlation of antitumor VacA effects [55]. Although previous studies have shown the low prevalence of H. pylori and EBV co-infection in gastric epithelial cells, in the current study, no EBER was detected in gastric biopsy samples. So, the possible synergic role of EBV in increasing DNMT1 genes֝ expression was waived. β-Integrins are considered as CagY and CagT proteins֝ receptors that stimulate the cell signaling pathway toward cell growth and differentiation [56]. In the current study, the cagY genotype infection was statistically correlated with increased DNMT1 gene֝ expression (Table 8).

5. Conclusion

This study's results indicate the correlation between DNMT1 gene֝ expression in gastric antral epithelial cells and some gastric adenocarcinoma risk factors, including aging and H. pylori genotypes infection, which is consistent with the results of previous studies.
  52 in total

Review 1.  Regulation of mammalian DNA methyltransferases: a route to new mechanisms.

Authors:  Hélène Denis; Matladi N Ndlovu; François Fuks
Journal:  EMBO Rep       Date:  2011-07-01       Impact factor: 8.807

2.  Viral oncoproteins target the DNA methyltransferases.

Authors:  W A Burgers; L Blanchon; S Pradhan; Y de Launoit; T Kouzarides; F Fuks
Journal:  Oncogene       Date:  2006-09-18       Impact factor: 9.867

3.  Risk Factors and Incidence of Gastric Cancer After Detection of Helicobacter pylori Infection: A Large Cohort Study.

Authors:  Shria Kumar; David C Metz; Susan Ellenberg; David E Kaplan; David S Goldberg
Journal:  Gastroenterology       Date:  2019-10-22       Impact factor: 22.682

4.  How to choose the right statistical test?

Authors:  Barun K Nayak; Avijit Hazra
Journal:  Indian J Ophthalmol       Date:  2011 Mar-Apr       Impact factor: 1.848

Review 5.  The Wnt/β-catenin signaling pathway controls the inflammatory response in infections caused by pathogenic bacteria.

Authors:  Octavio Silva-García; Juan J Valdez-Alarcón; Víctor M Baizabal-Aguirre
Journal:  Mediators Inflamm       Date:  2014-07-17       Impact factor: 4.711

6.  Modulation of DNA methylation by human papillomavirus E6 and E7 oncoproteins in cervical cancer.

Authors:  Prakriti Sen; Pooja Ganguly; Niladri Ganguly
Journal:  Oncol Lett       Date:  2017-10-30       Impact factor: 2.967

7.  Tumor suppressor gene inactivation during cadmium-induced malignant transformation of human prostate cells correlates with overexpression of de novo DNA methyltransferase.

Authors:  Lamia Benbrahim-Tallaa; Robert A Waterland; Anna L Dill; Mukta M Webber; Michael P Waalkes
Journal:  Environ Health Perspect       Date:  2007-10       Impact factor: 9.031

8.  Epigenetic Regulation of Tumor Suppressors by Helicobacter pylori Enhances EBV-Induced Proliferation of Gastric Epithelial Cells.

Authors:  Saurabh Pandey; Hem Chandra Jha; Sanket Kumar Shukla; Meghan K Shirley; Erle S Robertson
Journal:  mBio       Date:  2018-04-24       Impact factor: 7.867

9.  Integrin but not CEACAM receptors are dispensable for Helicobacter pylori CagA translocation.

Authors:  Qing Zhao; Benjamin Busch; Luisa Fernanda Jiménez-Soto; Hellen Ishikawa-Ankerhold; Steffen Massberg; Laurent Terradot; Wolfgang Fischer; Rainer Haas
Journal:  PLoS Pathog       Date:  2018-10-26       Impact factor: 6.823

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.