| Literature DB >> 36147796 |
Manouchehr Ahmadi Hedayati1,2, Amjad Ahmadi3,4, Zahed Khatooni5.
Abstract
DNMT1, as a critical enzyme affecting epigenetics through methylation of DNA cytosine-rich sequences, regulates gene expression. Exterior factors including long-term infections, in this study Helicobacter pylori infection, could change host cells' epigenetics by affecting DNMT1 gene expression. This study investigated the statistical correlation between H. pylori virulence genes and DNMT1 gene expression in gastric antral epithelial cells of gastric adenocarcinoma and gastritis patients. In a case-control study, 50 and 53 gastritis and gastric adenocarcinoma antral biopsies, including 23 and 21 patients with H. pylori infection, respectively, were collected from hospitals in the west of Iran. Having extracted total RNA from gastric biopsy samples, cDNA was synthesized and virulence genes of H. pylori were detected by using the PCR method. Relative real-time RT PCR was used to detect ΔΔCt fold changes of the DNMT1 gene expression in divided groups of patients based on H. pylori infection and clinical manifestations. The results showed that along with increasing patients' age, the DNMT1 gene expression will increase in gastric antral epithelial cells of gastric cancer patients (P ≤ 0.05). On the other hand, the biopsy samples with infection of H. pylori cagA, cagY, and cagE genotypes revealed a direct correlation along with increased DNMT1 gene expression. This study revealed the correlations of H. pylori cag pathogenicity island genes with increased DNMT1 gene expression.Entities:
Year: 2022 PMID: 36147796 PMCID: PMC9489387 DOI: 10.1155/2022/2386891
Source DB: PubMed Journal: ScientificWorldJournal ISSN: 1537-744X
Primers of H. pylori T4SS, 16s rDNA, and vacA in simple PCR.
| Specific primers | Sequence | Annealing, Tm °C | Product size, bp | Reference |
|---|---|---|---|---|
|
| CTGGAGAGACTAAGCCCTCC | 50 | 446 | This study |
|
| AGGATCAAGGTTTAAGGATT | |||
|
| TGACCAACAACCACAAACCG | 57 | 108 | This study |
|
| TCAGGATCGTATGAAGCGACAG | |||
|
| AAGAAAGCAGGACAAGCAGC | 55 | 188 | This study |
|
| CTAACCGATCGCCCTACCTT | |||
|
| AGGGTGTGGTGATGATAGCG | 55 | 154 | This study |
|
| TGCTTGTTGTTTGCTCCACT | |||
|
| GAATGGAGCGAGCGATGAAA | 56 | 163 | This study |
|
| TAGGAATTTGCAGCGCTCAC | |||
|
| AGTTCAAGTGGCGCTAGATTG | 57 | 200 | This study |
|
| ACAAGCCTTTCAAGCATTCGT | |||
|
| ATGGAAATACAACAAACACAC | 55 | 259/286 | [ |
|
| CTGCTTGAATGCGCCAAAC | |||
|
| TGGATAGTGCGACTGGGTTT | 54 | 205/220 | This study |
|
| TCCATGCGGTTGTTGTTGTT |
The primers yield various vacA depending on a repetitive nucleotide sequence in some vacA alleles.
Primers of H. pylori adhesins and surface proteins.
| Specific primers | Sequence | Annealing, Tm °C | Product size, bp | Reference |
|---|---|---|---|---|
|
| GTGTTTTTAACCAAAGTATC | 45 | 247 | [ |
|
| CTATAGCCASTYTCTTTGCA | |||
|
| GTTGGGTATATCACAATTTAT | 47 | 229/234 | [ |
|
| TTRCCCTATTTTCTAGTAGGT | |||
|
| ACGAACGCGCAAAAACTTTA | 55 | 187 | [ |
|
| TTGCCATTCTCATCGGTGTA | |||
|
| ACAGCCACTCCAATCCAGAA | 55 | 160 | [ |
|
| AACCCCACCGTGGATTTTAG | |||
|
| CAATGCGGTGCGTGAAAATC | 57 | 205 | This study |
|
| ATACCCTGGCTCGTTGTTGA | |||
|
| CAATTCCCCGGCGTATCAAG | 56 | 175 | This study |
|
| ATTGCAAGTGATGGTCGTCG | |||
|
| TCTCTCGCTTGCGGTATCAT | 56 | 204 | This study |
|
| AGCTCAATGTTGTTGGCGTT | |||
|
| GCATTCAAACGGCGAACAAC | 56 | 248 | This study |
|
| TCCTGTGCAGTTCCCATCTT | |||
|
| CGCTCCTATCAAAACCGCTC | 55 | 185 | This study |
|
| TTCCCGTCCAACTTACCGAA | |||
|
| TCAACTTGCGAGCAGACCTA | 57 | 218 | This study |
|
| AGCCATAGACCCCATACACG | |||
|
| CTCCACGCTGAAAGGAATGG | 55 | 233 | This study |
|
| CCATTTCCTGCGAATCGGTT |
Specific primers of the DNMT1 gene in real-time RT PCR.
| Specific primers | Sequence | Annealing, Tm °C | Product size, bp | Reference |
|---|---|---|---|---|
|
| ACCCTGTTGCTGTAGCCA | 56 | 102 | Universal |
|
| CCACTCCTCCACCTTTGAC | |||
|
| AGAACGGTGCTCATGCTTACA | 56 | 81 | [ |
|
| CTCTACGGGCTTCACTTCTTG | |||
|
| AGGACAGCCGTTGCCCTAGTGGTT | 60 | 173 | This study |
|
| AAAAATAGCGGACAAGCCGAATACC |
Demographic characteristics of patients and correlation of demographic variables.
| Gastritis | Gastric adenocarcinoma | Total |
| |
|---|---|---|---|---|
|
| 23/27 | 21/32 | 44/59 | 0.513 |
| Sex (male/female) | 24/26 | 37/16 | 50/53 | 0.024 |
| Age group (18–30/31–45/46–60/61–85) | 10/18/17/5 | 0/1/14/38 | 10/19/31/43 | 0.001 |
Demographic characteristics of patients with H. pylori infection.
|
| Sex ( | Age group ( | ||||
|---|---|---|---|---|---|---|
| Male | Female | 18–30 | 31–45 | 46–60 | 61–85 | |
|
| 28 | 16 | 2 | 11 | 14 | 17 |
| (Positive) | ||||||
|
| 33 | 26 | 8 | 8 | 17 | 26 |
| (Negative) | ||||||
| Total | 61 | 42 | 10 | 19 | 31 | 43 |
Correlation of DNMT1 gene ΔCt in gastric antral epithelial cells of patients with gastritis and gastric adenocarcinoma with the Spearman statistical test patients' demographic characteristics.
| Sex | Age group | Disease |
| Gastric adenocarcinoma area | Tumor grade | |
|---|---|---|---|---|---|---|
| DNMT1 correlation | −0.244 | −0.475 | −0.366 | −0.472 | −0.291 | 0.012 |
|
| 0.094 | 0.001 | 0.010 | 0.001 | 0.189 | 0.956 |
Frequency of H. pylori genotypes in gastric epithelial cells of patients with gastritis and gastric adenocarcinoma.
|
| Gastritis ( | Gastric adenocarcinoma ( |
|
|---|---|---|---|
|
| 7 | 12 | 0.074 |
|
| 16 | 9 | |
|
| 22 | 10 | 0.001 |
|
| 1 | 11 | |
|
| 22 | 10 | 0.001 |
|
| 1 | 9 | |
|
| 17 | 21 | 0.012 |
|
| 6 | 0 | |
|
| 5 | 17 | 0.001 |
|
| 18 | 4 | |
|
| 0 | 9 | 0.001 |
|
| 23 | 12 | |
|
| 12/2/1 | 5/9/3 | 0.022 |
|
| 8 | 4 | |
|
| 4/3/1 | 5/5/4 | 0.155 |
|
| 15 | 7 | |
|
| 4/5 | 7/11 | 0.006 |
|
| 14 | 3 | |
|
| 11/6 | 11/7 | 0.610 |
|
| 6 | 3 | |
|
| 20 | 21 | 0.086 |
|
| 3 | 0 | |
|
| 11 | 10 | 0.989 |
|
| 12 | 11 |
Correlation between DNMT1 gene ΔCt in gastric antral epithelial cells of gastritis and gastric adenocarcinoma patients with H. pylori virulence gene cDNAs using the Spearman test.
|
| cagA |
|
|
|
|
|
|
|
|
|
| |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| DNMT1 correlation | 0.116 | −0.388 | −0.293 | 0.209 | −0.446 | −0.517 | 0.313 | 0.176 | 0.155 | −0.040 | 0.196 | −0.366 |
|
| 0.589 | 0.023 | 0.093 | 0.326 | 0.029 | 0.002 | 0.136 | 0.411 | 0.469 | 0.853 | 0.359 | 0.078 |
Analysis of the relationship between gastric diseases, tumor grade, vacA cDNA, and H. pylori infection variables with DNMT1 gene ΔCt (T-test).
|
| Mean ΔCt | Standard deviation | Fold change |
| ||
|---|---|---|---|---|---|---|
| Age group | 18–30 | 10 | 6.5789 | 1.72339 | 5.32 | 0.001 |
| 61–85 | 43 | 4.1680 | 1.93520 | |||
|
| ||||||
| Disease | Gastritis | 53 | 6.5227 | 1.60269 | 3.25 | 0.010 |
| Gastric adenocarcinoma | 50 | 4.8226 | 1.89975 | |||
|
| ||||||
|
| Positive | 44 | 4.7667 | 1.99491 | 3.11 | 0.001 |
| Negative | 59 | 6.4035 | 1.49580 | |||
|
| ||||||
|
| Positive | 16 | 6.1200 | 1.32237 | 3.04 | 0.023 |
| Negative | 28 | 7.7267 | 1.66526 | |||
|
| ||||||
|
| Positive | 23 | 5.9779 | 1.50656 | 3.08 | 0.029 |
| Negative | 21 | 7.6030 | 1.62487 | |||
|
| ||||||
|
| Positive | 15 | 6.1048 | 1.30111 | 4.09 | 0.002 |
| Negative | 29 | 8.1360 | 1.48652 | |||