| Literature DB >> 36135757 |
Fang Su1,2,3,4,5,6, Lina Sun1,2,3,4,5,6, Xiaoni Li1,5, Wei Cui1,2,3,4,5,6, Hongsheng Yang1,2,3,4,5,6,7.
Abstract
Apostichopus japonicus achieves intestinal regeneration in a short period after evisceration, and multiple genes are involved in this process. The transcriptome of A. japonicus was screened for regeneration-associated protein (Aj-Orpin), a gene that is specifically upregulated during intestinal regeneration. The expression and function of Aj-Orpin were identified and investigated in this study. The 5' and 3' RACE polymerase chain reaction (PCR) was used to clone the full-length cDNA of Aj-Orpin. The open reading frame codes for a 164 amino-acid protein with an EF-hand_7 domain and overlapping signal peptides and transmembrane regions. Moreover, Aj-Orpin mRNA and protein expression during intestinal regeneration was investigated using real-time quantitative PCR and Western blot. The expression pattern of Aj-Orpin in the regenerating intestine was investigated using immunohistochemistry. The results showed that Aj-Orpin is an exocrine protein with two EF-hand-like calcium-binding domains. Expression levels were higher in the regenerating intestine than in the normal intestine, but protein expression changes lagged behind mRNA expression changes. Aj-Orpin was found to play a role in the formation of blastema and lumen. It was primarily expressed in the serosal layer and submucosa, suggesting that it might be involved in proliferation. These observations lay the foundation for understanding the role of Orpin-like in echinoderm intestinal regeneration.Entities:
Keywords: Aj-Orpin; gene function; holothurians; regeneration; sea cucumber (Apostichopus japonicus)
Year: 2022 PMID: 36135757 PMCID: PMC9501386 DOI: 10.3390/md20090568
Source DB: PubMed Journal: Mar Drugs ISSN: 1660-3397 Impact factor: 6.085
Figure 1Sequence analysis of Aj-Orpin in A. japonicus. (a) Nucleotide sequence (1136 bp) of the Aj-Orpin gene (accession No. ARI48335.1) aligned with the predicted amino acid (AA) sequence (capital single-letter code). The full-length nucleotide sequence includes 22 bp 5′-untranslated region (UTR), a 619 bp 3′-UTR, and a 495 bp open-reading frame (164 AA). The start and stop codons are included in the black box. The stop codon is indicated by an asterisk. The signal peptide and the transmembrane region are denoted by the red box and the red underline respectively, and the cleavage site is shown with the red arrow. (b) Multiple alignment of the deduced amino acid sequences of Aj-Orpin. The EF-hand domain pair is denoted by the red box. (c) Phylogenetic trees based on Aj-Orpin amino acid sequences from A. japonicus and other species. The tree was constructed based on the multiple sequences generated by MUSCLE algorithm and aligned using the Maximum Likelihood method with 100 bootstraps.
Figure 2Relative expression levels of Aj-Orpin mRNA and protein during intestinal regeneration. (a) Real-time quantitative PCR analysis of Aj-Orpin expression at different intestinal regeneration time points: control, 0, 30 min, 1, 2, 6, 12 h and 1, 3, 7, and 14 days post-evisceration. Normal intestine was treated as the control group. (b) Western blot analysis showed Aj-Orpin protein expression at different time points during intestinal regeneration. β-actin served as the reference protein. (c) The protein expression level was evaluated by calculating the gray value of the bands. Data are shown as the mean ± SE. The lowercase letters indicate statistically significant differences (p < 0.05).
Figure 3(a) Diagram to show the location of the slices. (b) Immunohistochemical staining for Aj-Orpin at different regeneration time points. (A1–F1) showed the pattern of Aj-Orpin protein expression from time 0 to day 7; (A2–F2) are the 4-fold magnification images of (A1–F1). ser: serosal layer, mus: muscle layer, sub: submucosal layer, muc: mucosal layer, lum: lumen. The reddish-brown particles pointed to by the arrows indicate positive Aj-Orpin expression. Aj-Orpin was mainly expressed in the serosal layer and submucosal layer and weakly in other layers.
Sequences of RACE PCR and real-time PCR primers.
| Primer | Sequence |
|---|---|
| GspAj-Orpin F1 | 5′- GACCCACCCCAACCCGATTC -3′ |
| GspAj-Orpin R1 | 5′- GCTTTGCCGCCCTCTTTCGT -3′ |
| GspAj-Orpin F2 | 5′- GGTGGATGGTTGAAGAGAAGTTGGAAG -3′ |
| GspAj-Orpin R2 | 5′- CCCCACTTCGTCACGTTGATATTTACC -3′ |
| UPM | Long5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′ |
| RT-Aj-Orpin F | 5′-AGTGGTGCTGTTGGTGTTAAGGTC-3′ |
| RT-Aj-Orpin R | 5′-CCGCCCTCTTTCGTCCATTCAC-3′ |
| NADHF | 5′-GTCCTACGACCCAATCTGGA-3′ |
| NADHR | 5′-ATGAGCCTTGGTTACGTTGG-3′ |