Literature DB >> 36134118

Ginkgolide A Participates in LPS-Induced PMVEC Injury by Regulating miR-224 and Inhibiting p21 in a Targeted Manner.

Zhonglin Liu1, Yan Yang2.   

Abstract

Most studies have focused on the protective effects of ginkgolide A against ischemia/reperfusion-induced cardiomyopathy and injury of the brain, liver, and other organs, but there are few reports about the protection of lung tissues. This study was designed to clarify the protection of ginkgolide A against lipopolysaccharide (LPS)-induced pulmonary microvascular endothelial cell (PMVEC) injury. PMVECs were extracted and fell into control, LPS, and ginkgolide A groups. Next, we delved into the growth activity and apoptosis rate of cells via the CCK-8 assay and Hoechst staining, independently. Beyond that, western blotting (WB) was implemented for measurement of the expressions of cyclin D1, cyclin-dependent kinase 4 (CDK4), and CDK inhibitor (p21) that pertained to the cell cycle. The target sites of ginkgolide A were confirmed by miRNA array and real-time quantitative PCR. The relationship between miR-224 and p21 was analyzed using dual-luciferase reporter gene assay. Compared with the control group, the LPS group and ginkgolide A group had significantly decreased cell growth activity and relative expressions of cyclin D1 and CDK4 and elevated apoptosis rate and p21 expression. Pronounced elevations were observable in the cell growth activity and expressions of cyclin D1, CDK4, and p21, while the ginkgolide A group presented with a reduced apoptosis rate in comparison with the LPS group (P < 0.05). MiR-224 was the target of ginkgolide A, which had targeted regulatory effects on p21. Ginkgolide A can modulate miR-224 expression and regulate p21 expression in a targeted manner to enhance the resistance of PMVECs to LPS-induced cell apoptosis.
Copyright © 2022 Zhonglin Liu and Yan Yang.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36134118      PMCID: PMC9482518          DOI: 10.1155/2022/6384334

Source DB:  PubMed          Journal:  Contrast Media Mol Imaging        ISSN: 1555-4309            Impact factor:   3.009


1. Introduction

Sepsis, a systemic inflammatory response syndrome (SIRS), is an outcome of infection with Gram-negative bacteria (GNB) [1]. Delayed control over the disease will elicit its progression into acute lung injury (ALI) and even acute respiratory distress syndrome (ARDS), thus leading to organ failure and threatening the patient's life safety [2]. GNB dominantly comprise lipopolysaccharide (LPS) [3], which can activate multiple inflammatory cells and release massive inflammatory mediators as a powerful initiator of inflammation, thereby causing pulmonary microvascular endothelial cell (PMVEC) injury, damaging the barrier function of cells, inducing pulmonary edema and structural change in lung tissues, and resulting in the occurrence and development of malignant pulmonary diseases [4]. Leng et al. [5] found that the abnormal apoptosis of PMVECs was the primary cause of pulmonary vascular dysfunction and pivotal for the onset and development of ALI. Therefore, deeply investigating the mechanism of PMVEC apoptosis in disease progression and seeking for new antiapoptotic drugs or therapeutic methods are highly constructive for potentiating the pulmonary function and relieving the clinical symptoms of patients [6]. Wu et al. [7] reported that large quantities of regulatory genes (microribonucleic acid (miR)-339-3p, miR-4262, and so on.) and protein factors (e.g., annexin A3 and angiotensin-converting enzyme 2) were involved in the pathological process of ALI. Li et al. [8] discovered through research that cyclin D1, cyclin-dependent kinase 4 (CDK4), and CDK inhibitor (p21) pertaining to the cell cycle were abnormally expressed in the case of LPS-induced PMVEC injury, so the cell cycle was altered. However, the correlations between these abnormally expressed proteins and PMVEC injury were not elaborated. Ginkgolide A is a main active component of ginkgo biloba extract that exerts pharmacological effects [9]. You et al. [10] verified that ginkgolide A could prevent apoptosis in myocardial microvessels and inhibit cardiac remodeling in mice with pressure overload. Most studies have focused on the protective effects of ginkgolide A against ischemia/reperfusion-induced cardiomyopathy and injury of the brain, liver, and other organs [11], but there are few reports about the protection of lung tissues. In this study, therefore, PMVECs were extracted from rats and cultured in vitro, and the protective mechanism of ginkgolide A for PMVECs was explored, aiming to provide new clues for clinical treatment.

2. Materials and Methods

2.1. Laboratory Animals, Main Reagents, and Apparatus

Beijing Huafukang Bioscience Co., Ltd. provided male Wistar rats (aged 3–4 weeks old and weighing 45–65 g) [Animal Production License No. SCXK (Beijing) 2020–0004, and Animal Use License No. SCXK (Beijing) 2019–0022] for primary culture of PMVECs. Subsequent to adaptive feeding in the laboratory animal center of our hospital under specific pathogen-free conditions, experiments were implemented as per the provisions of the animal ethics committee of our hospital. All animal experiments were conducted following the 3R principle. Ginkgolide A (purity >98%, 10 mg/bag) was provided by MedChemExpress LLC (USA). Antibodies against cyclin D1, p21, and CDK4 as well as monoclonal antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were bought from Jackson (USA). TRIzol reagent, reverse transcription kit, and real-time fluorescence quantitative polymerase chain reaction (RT-qPCR) kit were offered by Takara Biotechnology (Dalian) Co., Ltd. The kits for cell counting kit-8 (CCK-8) assay and western blotting (WB) were purchased from Sigma (USA). Total protein extraction kit was provided by Qiagen (Germany), and phosphate-buffered saline (PBS) was bought from Amresco (USA). An Airtech super-clean bench (Beijing Liuyi Instrument Plant, China), Sanyo MCO-15AC cell incubator (Johnson & Johnson, USA), inverted fluorescence microscope (Olympus Corporation, Japan), Synergy HT multifunctional microplate reader (Winooski, USA), Accuri C6 Plus flow cytometer, and PCR amplification system (Bio-Rad, USA) were employed in this study.

2.2. Culture and Identification of PMVECs

The cells were primarily cultured using the tissue explant method. Specifically, the rats were intraperitoneally injected with 3000 U of heparin sodium for anesthesia, and then, D-hanks solution was injected into the right ventricle under sterile conditions for cardiopulmonary perfusion. Next, the lung tissues were taken out, the visceral pleura on the lung surface was cut away, and the lung tissues at the outer edge and 1–3 mm away from the surface were cut. After washing, the lung tissues were cut into blocks (1 mm3) and evenly seeded into a disposable aseptic plastic culture flask (25 cm2). Later, about 1.5 mL of prepared Dulbecco's modified Eagle medium (DMEM) solution comprising 20% fetal bovine serum (FBS), 100 kU/L penicillin, 100 kU/L streptomycin, 50 μg/L VEGF, and 90 kU/L heparin sodium was added into the flask to just immerse the tissue blocks while avoiding tissue block floating, followed by static culture in the incubator. The solution was changed once every day to eliminate blood cells. After cell adherence for 60 h, the tissue blocks were removed gently, and the solution was changed for continuous culture. Subsequently, the solution was replaced once every 3 days until basic cell confluence appeared at the bottom of the flask, followed by subculture. The cells were purified through observation under a microscope, mechanical scraping, and differential digestion, so as to remove mixed cells such as fibroblasts and smooth muscle cells. Finally, immunocytochemical staining for factor VIII-related antigen was applied to identify the cells [12].

2.3. Cell Culture and Grouping

In the exponential phase of growth, cell suspension at proper density was made of PMVECs subsequent to digestion and isolation, seeded into 96-well plates or culture flasks and cultured with the DMEM solution containing 10% FBS for 1–2 days. When the cell fusion reached about 80%, another 24 h cell culture with 0.1% FBS was fulfilled for synchronization. After that, the cells were divided into 3 groups, namely, the LPS group (PMVECs received 48-h treatment with 0.5 μg/mL LPS for 48 h to induce injury), ginkgolide A group (PMVECs were pretreated with 5 μg/mL ginkgolide A for 2 h before intervention with 0.5 μg/mL LPS), and control group (untreated PMVECs). The medium in every group was changed once every 2 days [13].

2.4. PMVEC Growth Activity Detection by CCK-8 Assay

After adjusting the concentration, PMVEC inoculation into 96-well plates at 5 × 104 cells/well was implemented. PMVECs were mixed gently with ginkgolide A under a concentration gradient (0, 1, 5, and 10 μg/mL) and underwent routine incubation in the incubator with 5% CO2 at 37 °C for 24 h, followed by an additional 4 h culture with 5 g/L CCK-8 solution (10 μL per well). For each group, 5 replicate wells and a blank well for zeroing were set up . At last, a microplate reader was utilized for calculation of the optical density [D(λ) value] at 450 nm in each well , and the influence of ginkgolide A on the growth activity of PMVECs was determined before LPS was added. The cell concentration was adjusted and cell inoculation into 96-well plates (5 × 104 cells per well) was implemented. After the group treatments as mentioned above, the cells were gently mixed and experienced a 24 h cell culture in the incubator containing 5% CO2 at 37°C and additional 4 h culture after addition of 5 g/L CCK-8 solution (10 μL per well). For each group, 5 replicate wells and a blank well for zeroing were set . Finally, the measurement of D(λ) value at 450 nm in each well was taken by the microplate reader, and the calculation of PMVEC viability was performed according to the formula: cell viability (%) = [D(λ)experimental group−D(λ)zeroing well/D(λ)blank control group−D(λ)zeroing well] × 100% [14].

2.5. PMVEC Apoptosis Measurement via Hoechst Staining

Each group of cells were placed into 6-well plates and underwent 10-min immobilization with fixative (0.5 mL) after absorbing the culture solution and washed twice with PBS or 0.9% NaCl, followed by 5-min staining with Hoechst staining solution (0.5 mL). Subsequent to removal of the solution, rinsing with PBS or 0.9% NaCl was carried out twice. Finally, a slide was added with antifade fluorescence mounting medium in droplets, covered by a cover glass adhered with cells, and detected under a fluorescence microscope with excitation and emission at around 350 nm and 460 nm, independently. The results were interpreted as follows: the normal cells were stained blue with spherical particles, while the apoptotic cells manifested compact white cell debris. 3 fields of vision (×200) were randomly selected from each quadrant of the cover glass, and a total of 12 fields of vision were photographed, in which the number of total cells and apoptotic cells was obtained to calculate the apoptosis rate: apoptosis rate = (total cell count−white cell count)/total cell count × 100% [15].

2.6. Cell Cycle Inspection via Flow Cytometry

When the pretreated cells were trypsinized and collected, they underwent PBS washing and resuspension, with a concentration adjustment to 1 × 109/L. Subsequent to the addition of precooled 70% ethanol, PMVECs (1 × 106) were immobilized at 4 °C nightlong. Following discarding of fixative and washing in precooled PBS twice, PMVECs underwent resuspension and mixing with RNase A solution (100 μL),and half an hour incubation in a water bath box at 37°C. Subsequently, the PMVECs received half an hour complete drying with PI (400 μL) in the dark at 4°C. Finally, the red fluorescence at 488 nm (excitation) was clarified using the flow cytometer [16].

2.7. Detection of Expressions of Cell Cycle-Related Proteins CyclinD1, CDK4, and p21 via WB

Subsequent to trypsinization, PMVECs underwent centrifugation and dilution in suspensions, followed by the aforementioned grouped treatments. Following seeding into 6 well plates at 1 × 105 cells/well, PMVECs received a 24 h culture in the incubator under 5% CO2 at 37°C. Next, conventional methods were employed for the total protein isolation, and measurements of the protein content were taken by the use of BCA kits. Later, the accurately weighed total proteins (50 μg) underwent SDS-PAGE and membrane (PVDF) transfer by the wet method. Succeeding to 3 h blocking with 10% nonfat milk powder for 3 h, the membrane experienced dilution at 1 : 1500 and incubation at 4°C nightlong. Following rinsing, the proteins received 3 h incubation with HRP-labeled secondary antibodies, followed by color development through enhanced chemiluminescence for 30 min, exposure, image development, and image fixation. In the end, we took measurements of the protein expression levels with GAPDH as the internal reference [17].

2.8. miRNA Array and Data Analysis

After concentration adjustment and placement into 24-well plates at 1 × 104 cells/well, PMVECs were subjected to the grouped treatments mentioned above and a 24 h routine culture in the 5% CO2 incubator at 37°C after mixing gently. Firstly, total RNA in PMVECs was sequestered by the use of TRIzol and further was highly purified by virtue of RNeasy kits. Then, a UV spectrophotometer was wielded to measure the RNA level. Secondly, miRCURY™ LNA microRNA Array Power Labeling Kit (Exiqon) was utilized to label the total RNA in cell samples. The results after hybridization were scanned using the GeneChip Scanner 3000 system, and Command Console software v4.0 (Affymetrix) was introduced for reading raw data. Thirdly, after normalization, the differentially expressed miRNAs in the three groups were screened by fold change >2.0 and examined by t-test. The differentially expressed miRNAs screened in each group were intuitively displayed by cluster maps [18].

2.9. Verification by RT-qPCR

With concentration adjusted, PMVECs underwent inoculation into 36-well plates (1 × 104 cells per well) and treated in groups as mentioned above, and a 24 h routine culture was performed in the incubator with 5% CO2 at 37 °C after mixing gently. Then, RNA extraction kits were utilized for sequestering of the total RNA in PMVECs. By the use of TianScript cDNA Synthesis Kit, RNA (1 μg) experienced transcription into cDNA. Later, SYBR® Premix Ex Taq™ II Kit and ABI 7500 Fast System were adopted for qPCR amplification with thermal cycles set below 30 cycles × (5 min predenaturation at 92°C, 15 s denaturation at 92°C, 30 s annealing at 58°C, and 35 s extension at 72°C). Finally, 2-△△Ct method was introduced for calculation of the relative gene expression with β-actin as the loading control [19]. Table 1 presents a list of sequences of primers for qPCR amplification.
Table 1

Primer sequences.

Upstream primerDownstream primer
miR-505UUUGAUGUCAGUCUCAUUGGGCAAUGAGACUGACAUCAAAAU
miR-27aGGGUUGUUGUGAGAAUUAATTUUAAUUCUCACAACAACCCTA
miR-224TAGACCTCTCACCGGAAAGACCACGAATC CCAGAAACAAAAC
miR-9TGTCTCCATT ACCTGCCTCTGGATTCTTCGCTTCTGTGTC TTCA
miR-145CGCGTGTAAACATCCTCGACAGTGCAGGGTCCGAGGTATT
miR-126AGAAGGAGAACTCCTACCCCCGCGTTAAGATGTCGGGTG
miR-4517CGAGCACAGAATCGCTTCACTCGCTTCGGCAGCACATAT
miR-3133GCGGGAGAATGATAGGATATGGGAATTGGCAAAGG
β-ActinCCCTTTATAGATTCGCCCTTGATCAGATGTTGCTGGCATGA

2.10. Dual-Luciferase Reporter Gene Assay (DLRGA)

PMVECs underwent transfection with both the firefly luciferase (Luc) reporter vector (0.4 mg) and the pRL-TK control vector comprising Renilla Luc (0.1 mg) on the 24-well plates as per the guidelines of the LRGA kit. After culturing at room temperature, the lysate was prepared after 48 h of transfection. Meanwhile, the DLRGA system was employed for measurement of the Luc activity succeeding to 24 h transfection, which was regarded as the activity of the reporter gene. Every sample underwent the assay thrice.

2.11. Statistical Analysis

Statistical analysis was implemented by the use of SPSS 19.0 (IBM, USA) and Prism 5.01 software (GraphPad, USA). A mean ± SD was taken to present the data. Measurements were taken for two-group differences by the t-test and for multi-group differences with one-way ANOVA. The difference turned out to be statistically significant in the case of P value below 0.05.

3. Results

3.1. In Vitro Culture and Identification of PMVECs

Rat PMVECs were successfully cultured by the modified tissue explant method, and there were many cells around the tissue blocks growing adherent to the wall in a radial pattern at 24 h after inoculation (Figure 1(a)). After the tissue blocks were removed, the remaining cells were cultured for 3–5 days to form a cell monolayer in a fusiform or polygonal shape. The cells were arranged closely, reached confluence, and showed a typical cobblestone-like appearance (Figure 1(b)). In addition, the results of identification by immunocytochemical staining indicated that approximately 95% of the cells had a positive expression of factor VIII-related antigen, and yellowish brown cytoplasm was visible under the high-power lens (Figure 1(c)). The cells were separated from the lung tissues at the outer edge and the culture was confirmed to be of PMVECs.
Figure 1

In vitro culture and identification of rat PMVECs observed using a microscope (×400). (a) After 24 h of culture; (b) after another 3–5 d of culture; and (c) identification via immunocytochemical staining for factor VIII-associated antigen. All experiments were performed in triplicate, independently.

3.2. Cell Growth Activity Clarified via CCK-8 Assay

It was revealed by the CCK-8 assay that ginkgolide A under a concentration gradient (0, 1, 5, and 10 μg/mL) exerted no great effects on PMVECs growth activity, suggesting that ginkgolide A has no toxicity on PMVECs. The LPS group presented with a strikingly decremented cell growth activity relative to the control group, but the ginkgolide A group presented with the opposite phenomenon relative to the control group (P < 0.05) (Figure 2).
Figure 2

Cell growth activity detected by the CCK-8 assay. (a) Control group; (b) LPS group; and (c) ginkgolide A group. P < 0.05vs. the control group; #P < 0.05vs. the LPS group. All experiments were performed in triplicate, independently.

3.3. Cell Apoptosis Observed by Hoechst Staining

Hoechst staining yielded that PMVECs in the control group were evenly stained, with blue nuclei and few apoptotic cells (Figure 3(a)). The number of cells in the LPS group was reduced markedly, and apparent white pyknotic nuclei and massive white cell debris could be observed, implying that there are numerous apoptotic cells and necrotic cells (Figure 3(b)). In ginkgolide A group, many cells were stained normal blue again accompanied with some white pyknotic nuclei, suggesting that the number of apoptotic cells was reduced obviously by ginkgolide A (Figure 3(c)). The LPS group and the ginkgolide A group presented with a pronouncedly higher cell apoptosis rates relative to the control group, and LPS group also presented with a prominently higher cell apoptosis rate relative to the ginkgolide A group (P < 0.05).
Figure 3

Cell apoptosis observed by Hoechst staining (×400). (a) Control group; (b) LPS group; and (c) ginkgolide A group. P < 0.05vs. the control group; #P < 0.05vs. the LPS group. All experiments were performed in triplicate, independently.

3.4. Cell Cycle Detected via Flow Cytometry

Flow cytometry unveiled that the cell count in the S phase rose from 20.33 ± 1.22% in the control group to 37.23 ± 3.54% and 27.66 ± 0.98% in the LPS group and the ginkgolide A group, independently, but the cell count in the G2/M phase declined from 36.04 ± 1.17% in the control group to 18.97 ± 3.56% and 22.44 ± 2.28% in the LPS group and the ginkgolide A group, respectively. Furthermore, the cell count plummeted in the S phase rose in the G2/M phase in the ginkgolide A group relative to that in the LPS group (P < 0.05) (Figure 4).
Figure 4

Cell cycle detected by flow cytometry. (a) Control group; (b) LPS group; and (c) ginkgolide A group. P < 0.05vs. the control group; #P < 0.05vs. the LPS group. All experiments were performed in triplicate, independently.

3.5. Cyclin D1, CDK4, and p21 Protein Expressions Measured by WB

It was demonstrated in the WB findings that relative to the control group, the LPS group and the ginkgolide A group had significantly reduced relative expressions of cyclin D1 and CDK4, and a significantly raised expression of p21. Besides, the ginkgolide A group presented with pronouncedly higher expressions of the three indicators relative to the LPS group (P < 0.05) (Figure 5).
Figure 5

Cyclin D1, CDK4, and p21 protein expressions measured by WB. (a) Control group; (b) LPS group; and (c) ginkgolide A group. P < 0.05vs. the control group; #P < 0.05vs. the LPS group. All experiments were performed in triplicate independently.

3.6. Target Gene of Ginkgolide A Analyzed by miRNA Array and RT-qPCR

MiRNA array was applied to analyze the differentially expressed miRNAs in PMVECs in the control group, LPS group, and ginkgolide A group. The top 8 differentially expressed miRNAs (miR-505, miR-27a, miR-224, miR-9, miR-145, miR-126, miR-4517, and miR-3133) were selected. Based on RT-qPCR outcomes, the relative expressions of miR-505 and miR-224 were elevated, but that of miR-145 was significantly lowered in the control group compared with those in the LPS group (P < 0.05). Additionally, the relative expression of miR-224 plummeted in the ginkgolide A group in contrast with that in the LPS group. However, there were no significant changes in the relative expressions of miR-505 and miR-145 (P > 0.05) (Figure 6). It appears that miR-224 is the target of ginkgolide A.
Figure 6

Target gene of ginkgolide A analyzed by miRNA array and RT-qPCR. (a) Control group; (b) LPS group; and (c) ginkgolide A group. P < 0.05vs. the control group; #P < 0.05vs. the LPS group. All experiments were performed in triplicate independently.

3.7. Results of DLRGA

On the strength of the bioinformatics website (https://www.targetscan.org/), there were specific binding sites between miR-224 and p21, but no binding sites between miR-224 and cyclin D1 and CDK4. The DLRGA findings uncovered that the Luc activity of p21-WT was inhibited (P < 0.05), but that of p21-MUT remained unchanged significantly (P > 0.05) after transfection with miR-224, implying that miR-224 can regulate p21 in a targeted manner (Figure 7).
Figure 7

Results of DLRGA. All experiments were performed in triplicate independently.

4. Discussion

Bacterial sepsis and its accompanied severe complications, including ALI, ARDS, and pulmonary arterial hypertension, are ubiquitous life-threatening diseases in clinics. All these complications can lead to endothelial injury and dysfunction [20]. PMVECs are vital lung tissue parenchymal cells, serving as target cells to be first impaired and active inflammatory cells and effector cells pertaining to the pathogenesis of ALI/ARDS. Stimulation by such malignant factors as viruses, inflammation, and hypoxia impairs the role of VECs as mechanical barriers but impels the secretion in the vascular endothelium as well as the release and mutual promotion of large quantities of inflammation-mediating factors and getting mutually promoted, thus forming a waterfall-like cascade and resulting in massive abnormal apoptosis of endothelial cells. As a result, the changes in the structure and function of endothelial cells are pivotal for disease onset and progression [21]. Hence, it is essential for studies on pulmonary circulation diseases to deeply investigate the mechanism of PMVEC injury. LPS or endotoxin is a proinflammatory cytokine with very high bioactivity. Li et al. [22] found that LPS was able to directly act on PMVECs, induce the release of inflammatory factors, and lead to cell permeability change, cytoskeleton rearrangement, cell cycle arrest, and cell apoptosis. Currently, no radical measures have been found to directly prevent PMVECs from injury, and the research hotspots mainly focus on searching for suitable drugs to help PMVECs resist LPS-induced cell injury. Ginkgolide A is one of the terpene lactones that have pharmacological activity in ginkgo biloba extract. According to the latest modern pharmacological study [23], ginkgolide A is capable of eliminating free radicals, repressing the growth of molds and bacteria, and protecting vascular endothelial cells, and it has antioxidative, antihypertensive, and antiinflammatory effects. Jeong et al. [24] found that ginkgolide A could suppress hepatocyte apoptosis and alleviate NAFLD in mice fed with high-fat diets. Most studies on ginkgolide A at home and abroad concentrate on ameliorating hemodynamics, preventing atherosclerosis, and protecting nerves, but the protective effect of ginkgolide A on the respiratory system, especially PMVECs, is rarely explored. In this study, the results manifested that ginkgolide A under a reverse concentration gradient (0, 1, 5, and 10 μg/mL) exerted no great effects on PMVEC growth activity, suggesting that ginkgolide A has no toxicity on PMVECs. After the LPS-induced injury, the growth activity, apoptosis rate, and cycle arrest of cells in the ginkgolide A group improved gradually, demonstrating that ginkgolide A can help PMVECs resist the LPS-induced cell injury. In addition, it was shown in the research results that LPS-induced PMVEC injury blocked the cell cycle and arrested the mitosis in the S phase, thus causing cell apoptosis. Moreover, the expression of cell cycle-associated proteins cyclin D1, CDK4, and p21 was altered as well. During the cell cycle, cyclin D1-CDK4 binding accelerates the cell cycle progression. Belonging to the CDK inhibitor protein family, p21 mainly mediates the cell cycle and has an antiapoptotic effect [25]. MiRNAs, a category of ncRNAs with 19–22 mts in length, can inhibit or promote gene expression by directly conjugating with the coding sequences of mRNA or binding to the 3′UTR of target mRNAs [26]. Besides, miRNAs can serve as pivotal post-transcriptional regulators and participate in diverse physiological and pathological processes, including cell differentiation, proliferation, apoptosis, organ development, and tumorigenesis. Through research, Li et al. [27] confirmed the implications of miRNAs in controlling the pathological process of LPS-induced PMVEC injury. Herein, the three groups of cells were examined via miRNA array, and it was shown that 8 miRNAs exhibited significant expression differences, and miR-224 was the target of ginkgolide A, according to the results of RT-qPCR. There was a prediction based on the bioinformatics website (https://www.targetscan.org/) that specific binding sites existed between miR-224 and p21 but not between miR-224 and cyclin D1 and CDK4. Furthermore, it was unveiled by the DLRGA that miR-224 had a targeted regulatory relation with p21.

5. Conclusion

In conclusion, ginkgolide A can modulate miR-224 expression and regulate p21 expression in a targeted manner to enhance the resistance of PMVECs against the LPS-induced cell apoptosis. Regardless, this study is limited because only animal experiments were conducted. Although the findings offer novel clues for the clinical application of ginkgolide A, more in-depth cell and clinical studies with large sample sizes are needed.
  26 in total

1.  Highly Sensitive Detection of Bladder Cancer-Related miRNA in Urine Using Time-Gated Luminescent Biochip.

Authors:  Yingqian Wang; Zhihao Li; Qiaosong Lin; Yurong Wei; Jie Wang; Yingxue Li; Ronghua Yang; Quan Yuan
Journal:  ACS Sens       Date:  2019-07-31       Impact factor: 7.711

2.  α-Ketoglutarate Modulates Macrophage Polarization Through Regulation of PPARγ Transcription and mTORC1/p70S6K Pathway to Ameliorate ALI/ARDS.

Authors:  Meiyun Liu; Yuanli Chen; Suyu Wang; Huanping Zhou; Di Feng; Juan Wei; Xuan Shi; Lingmin Wu; Pengcheng Zhang; Hao Yang; Xin Lv
Journal:  Shock       Date:  2020-01       Impact factor: 3.454

3.  Slit2/Robo4 signaling pathway modulates endothelial hyper-permeability in a two-event in vitro model of transfusion-related acute lung injury.

Authors:  Jie Weng; Xiaoming Zhou; Hui Xie; Ye Gao; Zhiyi Wang; Yuqiang Gong
Journal:  Blood Cells Mol Dis       Date:  2018-11-13       Impact factor: 3.039

4.  Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells.

Authors:  Peng Xia; Pan Liu; Qiang Fu; Chuanjiang Liu; Qiankun Luo; Xu Zhang; Liyou Cheng; Tao Qin; Hongwei Zhang
Journal:  Biochem Biophys Res Commun       Date:  2019-12-03       Impact factor: 3.575

5.  BH3 profiling discriminates on-target small molecule BH3 mimetics from putative mimetics.

Authors:  Mariana Villalobos-Ortiz; Jeremy Ryan; Thelma N Mashaka; Joseph T Opferman; Anthony Letai
Journal:  Cell Death Differ       Date:  2019-07-22       Impact factor: 15.828

Review 6.  Lipopolysaccharide Biosynthesis and Transport to the Outer Membrane of Gram-Negative Bacteria.

Authors:  Paola Sperandeo; Alessandra M Martorana; Alessandra Polissi
Journal:  Subcell Biochem       Date:  2019

7.  The cholecystokinin receptor agonist, CCK-8, induces adiponectin production in rat white adipose tissue.

Authors:  Adrián Plaza; Beatriz Merino; Nuria Del Olmo; Mariano Ruiz-Gayo
Journal:  Br J Pharmacol       Date:  2019-06-20       Impact factor: 8.739

8.  MicroRNA-339-3p alleviates inflammation and edema and suppresses pulmonary microvascular endothelial cell apoptosis in mice with severe acute pancreatitis-associated acute lung injury by regulating Anxa3 via the Akt/mTOR signaling pathway.

Authors:  Xing-Mao Wu; Kai-Qiang Ji; Hai-Yuan Wang; Yang Zhao; Jia Jia; Xiao-Peng Gao; Bin Zang
Journal:  J Cell Biochem       Date:  2018-04-25       Impact factor: 4.429

9.  Ramelteon protects against human pulmonary microvascular endothelial cell injury induced by lipopolysaccharide (LPS) via activating nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway.

Authors:  Wenjun Yang; Yang Zhang; Dahao Lu; Tianfeng Huang; Keshi Yan; Weiwei Wang; Ju Gao
Journal:  Bioengineered       Date:  2022-01       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.