Heng Lu1,2, Yi Chen1,2, Yinhai Chen1,2, Lingchen Huang1,2, Liangwan Chen1,2. 1. Department of Cardiovascular Surgery, Fujian Medical University Union Hospital, Fuzhou, China. 2. Key Laboratory of Cardio-Thoracic Surgery, Fujian Medical University, Fujian Province University, Fuzhou, China.
Abstract
Purpose: To investigate the function of C/EBPα in the development of aortic dissection (AD) and the underlying mechanism. Methods: Aortic vascular smooth muscle cells (VSMCs) were isolated, cultured, and identified from AD rats. Then, C/EBPα and PIK3C2A were knockdown or overexpressed by siRNA or plasmid transfection, respectively. Rapamycin or 3-MA was utilized to stimulate and restrain autophagy of VSMCs, respectively. Western blot was used to evaluate the expression levels of C/EBPα, PIK3C2A, LC3, Beclin-1, p62, MMP-2, MMP-9, α-SMA, SM-MHC, and OPN. The pathological status of aortic ring was evaluated by stretch stress, and ChIP assay was used to analyze the binding between C/EBPα and PIK3C2A. C/EBPα shRNA was injected into tail vein to observe the effect of C/EBPα knockdown in vivo on phenotype, autophagy of aortic vascular tissue by immunohistochemical staining and Western blot. Results: The protein levels of C/EBPα, PIK3C2A, MMP-2, MMP-9, and LC3 in the aorta of AD rats were all upregulated significantly. C/EBPα and rapamycin promoted notable upregulation of the synthesized proteins (OPN), PIK3C2A, matrix metalloproteinases, LC3, and Beclin-1 in VSMCs, while suppressed contractile proteins (α-SMA and SM-MHC) and p62. The opposite results were observed in the C/EBPα-knockdown VSMCs, PIK3C2A-knockdown VSMCs, or VSMCs treated with 3-MA. C/EBPα, PIK3C2A, and LC3 were dramatically upregulated by the stimulation of 3 g and 5 g stretch stress. The downregulated contractile proteins, upregulated synthetic proteins, activated autophagy, and aggravated pathological state in 5 g stretch stress-treated aortic rings were significantly reversed by the knockdown of C/EBPα. ChIP results indicated that there was a binding site for C/EBPα in the promoter of PIK3C2A. C/EBPα also downregulated α-SMA level and upregulated OPN levels in AD rats in vivo. Conclusion: Our data indicated that during the development of AD, C/EBPα regulated the transition of VSMC phenotype and extracellular matrix remodeling by activating autophagy through regulating the transcriptional activity of PIK3C2A promoter.
Purpose: To investigate the function of C/EBPα in the development of aortic dissection (AD) and the underlying mechanism. Methods: Aortic vascular smooth muscle cells (VSMCs) were isolated, cultured, and identified from AD rats. Then, C/EBPα and PIK3C2A were knockdown or overexpressed by siRNA or plasmid transfection, respectively. Rapamycin or 3-MA was utilized to stimulate and restrain autophagy of VSMCs, respectively. Western blot was used to evaluate the expression levels of C/EBPα, PIK3C2A, LC3, Beclin-1, p62, MMP-2, MMP-9, α-SMA, SM-MHC, and OPN. The pathological status of aortic ring was evaluated by stretch stress, and ChIP assay was used to analyze the binding between C/EBPα and PIK3C2A. C/EBPα shRNA was injected into tail vein to observe the effect of C/EBPα knockdown in vivo on phenotype, autophagy of aortic vascular tissue by immunohistochemical staining and Western blot. Results: The protein levels of C/EBPα, PIK3C2A, MMP-2, MMP-9, and LC3 in the aorta of AD rats were all upregulated significantly. C/EBPα and rapamycin promoted notable upregulation of the synthesized proteins (OPN), PIK3C2A, matrix metalloproteinases, LC3, and Beclin-1 in VSMCs, while suppressed contractile proteins (α-SMA and SM-MHC) and p62. The opposite results were observed in the C/EBPα-knockdown VSMCs, PIK3C2A-knockdown VSMCs, or VSMCs treated with 3-MA. C/EBPα, PIK3C2A, and LC3 were dramatically upregulated by the stimulation of 3 g and 5 g stretch stress. The downregulated contractile proteins, upregulated synthetic proteins, activated autophagy, and aggravated pathological state in 5 g stretch stress-treated aortic rings were significantly reversed by the knockdown of C/EBPα. ChIP results indicated that there was a binding site for C/EBPα in the promoter of PIK3C2A. C/EBPα also downregulated α-SMA level and upregulated OPN levels in AD rats in vivo. Conclusion: Our data indicated that during the development of AD, C/EBPα regulated the transition of VSMC phenotype and extracellular matrix remodeling by activating autophagy through regulating the transcriptional activity of PIK3C2A promoter.
Aortic dissection (AD) is one of the most dangerous aortic diseases [1]. Although certain therapeutic benefits have been achieved on the clinical diagnosis and treatment of AD by constantly updated and improved surgical techniques [2], the mortality and the incidence rate of surgical complications are rising due to unclear pathological mechanism [3]. The deep investigation on the pathogenesis of AD and the analysis on the prognosis of disease are urgently needed. Vascular remodeling is a critical step that impacts the development of AD [4]. Vascular smooth muscle cells (VSMCs), as an important component of tunica media of artery, are essential in maintaining the structure and function of vascular wall [5]. VSMCs are involved in the multiple physiological progressions, including proliferation, migration, and apoptosis [6]. Once the aortic vascular wall is damaged, VSMCs will be changed from mature contractible phenotypes to synthetic phenotypes, which results in the increased synthesis of collagens and the disruption of homeostasis in extracellular matrix (ECM). As a consequence, AD will be developed [7]. Our previous researches indicate that the change of VSMCs phenotype will be induced, the formation of AD will be accelerated, and the vascular structure will be remodeled by the mechanical tension [8].CCAAT/enhancer binding protein (C/EBP) belongs to the transcriptional factor family and is composed of a highly conservative basic leucine zipper (bZIP) domain at the C-terminal and a DNA-binding domain (DBD) with positive charge [9]. C/EBPα and C/EBPβ have been payed the highest attention [10]. The differentiation and physiology effect by C/EBPα in pulmonary epithelial cells has been confirmed by the investigations including gene knockout mice [11]. In addition, the transition from resting to activation of multiple cell types can be regulated by C/EBPα, such as facilitating the transition from hematopoietic stem cells to myeloid tumor [12]. It is reported that C/EBPα impacts the progression of liver fibrosis by activating autophagy during the activation of hepatic stellate cells [13]. However, the study of C/EBPα on VSMCs phenotype has not been reported.In autophagy, the damaged organelles and misfolded proteins are degraded and metabolized in cytoplasm for eliminating harmful components and maintaining cell homeostasis [14, 15]. Recently, it is reported that the proliferation of VSMCs can be facilitated by the activation of autophagy. The contractile proteins are suppressed, and that of synthetic proteins are elevated in VSMCs by the activation of autophagy induced by the stimulation of the platelet-derived growth factor (PDGF) [16]. Phosphoinositol 3-kinase (PI3K) family members are key proteins that regulate the eukaryotic membrane dynamics and transportation [17] and are involved in multiple cellular progressions [18]. The details on type I PI3Ks and type III PI3Ks have been claimed, whereas the recognition on type II PI3Ks remains unclear. It is reported that the number of autophagosome will be decreased by knocking out PIK3C2A (the gene encoding type II PI3Ks) [19]. Boukhalfa et al. [20] pointed out that the primary autophagy response process mediated by cilia could be regulated by PIK3C2A independently. Bischoff et al. [21] claimed that the PIK3C2A was one of the upstream regulators for LC3, a classic autophagy-related protein. These reports confirmed the important regulatory effect of PIK3C2A on autophagy. In this study, compared to control, C/EBPα, PIK3C2A, and LC3 were significantly upregulated in AD animals. The purpose of this study is to explore the regulatory mechanism of C/EBPα on the autophagy and phenotype change in VSMCs.
2. Materials and Methods
2.1. AD Rat Model
Fifty of 3-week male Sprague-Dawley (SD) rats were purchased from Hunan SJA Laboratory Animal Co., Ltd. (China). After a 7-day adaptive feeding, AD model were established by intragastrically administering SD rats with 1 g/kg/day β-aminopropionitrile for 6 weeks until AD was formed in animals.
2.2. Hematoxylin and Eosin (H&E) Staining
The aortic ring tissues were fixed with 4% paraformaldehyde and then embedded in paraffin. The tissue was sectioned to 5 μm thickness, and then, the pathological changes were observed by H&E staining.
2.3. Isolation and Culture of Primary VSMCs from AD Rats
The aortic vascular tissues were isolated under the sterile condition by stripping the blood vessel lengthways and removing the intima. The tunica media was torn from the tunica external and cut into 1 mm [2] pieces, then was centrifuged, and the supernatant was removed. After adding 2 mL of 2% collagenase in Hank's solution, the tissue were placed in 37°C incubator for 4-6 hours, followed by incubating in DMEM/F12 medium containing 20% FBS. The isolated VSMCs were identified using the immunofluorescence assay.
2.4. Immunofluorescence
The isolated VSMCs were fixed by 4% paraformaldehyde, treated with Triton X-100, and blocked with 5% goat serum. The VSMCs were incubated overnight with the primary antibody against α-SMA (1: 200, 14395-1-AP, Proteintech, USA) and then incubated with FITC-conjugated secondary antibody (1 : 200, BM2012, BOSTER, China) at room temperature for 2 h. The cell nuclei were stained by DAPI. The positive expressed cells were observed and photographed by a fluorescence microscope (CKX53, OLYMPUS, Japan).
2.5. Knockdown and Overexpression in VSMCs
The cDNA sequence of C/EBPα was synthesized and inserted into pcDNA3.1 vector to construct the recombinant pcDNA3.1-C/EBPα-overexpressing vector (pcC/EBPα). To obtain the C/EBPα-overexpressed VSMCs, the pcC/EBPα or the empty vector (vector) were transfected into VSMCs by Lipofectamine3000 (Invitrogen, California, USA) for 48 hours, respectively. VSMCs were transfected with negative control siRNA (siNC) or targeted siRNA sequences synthesized by Genscript (Nanjing, China) to knockdown C/EBPα or PI3KC2A using Lipofectamine 3000 according to the manufacturer. VSMCs were collected after 48 h and detected the transfection efficacy by RT-qPCR.
Total RNA in VSMCs was extracted by TRIzol (CW0580S, CWBIO, China), followed by reverse transcription with iScript cDNA synthesis kit (Bio-Rad Laboratories, USA) according to the manufacturer. The cDNA template was amplified using SYBR Green PCR Master Mix (4309155, Applied Biosystems, USA) and RT-qPCR instrument. 2−ΔΔCt was used to calculate the relative expression fold of target genes. The primer sequences are shown in Table 1.
Table 1
The sequences of primers for PIK3C2A, C/EBPa, and β-actin.
Primer ID
Sequences
PIK3C2A F
CTTTGGAAGTTACCTGGCTTTCCTA
PIK3C2A R
AAGAGGGTGCCATTTCGGTAA
C/EBPa F
GCTTACAACAGGCCAGGTTTC
C/EBPa R
GATGGATCGATTGTGCTTCAA
β-Actin F
GCCATGTACGTAGCCATCCA
β-Actin R
GAACCGCTCATTGCCGATAG
2.7. Western Blot
VSMCs were washed with PBS, lysed with RIPA lysis buffer containing phosphatase inhibitor (C1053, Applygen Technology, China) for total protein extraction on ice. Following the routine procedures of Western blot, 20 μg total protein per sample was electrophoresed on SDS-PAGE gel, then transferred to PVDF membrane (Invitrogen, USA), and blocked with 5% defatted milk powder at room temperature. The membranes were incubated overnight with the primary antibodies of OPN (1 : 1000, AF0227), SM-MHC (1 : 1000, DF8344) PIK3C2A (1 : 1000, DF2623), LC3 (1 : 1000, AF5402), Beclin-1 (1 : 1000, AF5128), p62 (1 : 1000, AF5384), C/EBPα (1 : 1000, AF6333), MMP-2 (1 : 1000, AF5330), MMP-9 (1 : 1000, AF5228), or GAPDH (1 : 1000, AF7021), followed by the incubation at room temperature with the secondary antibody (1 : 2000). All antibodies were purchased from Affinity Biosciences (Australia). Then, the bands were exposed with ECL solution and visualized by Chemi Doc MP. The bands were analyzed by the ImageJ software with GAPDH as the internal reference.
2.8. Flow Cytometric Analysis of Intracellular Reactive Oxygen Species (ROS)
VSMCs were incubated with 5 μM of DCFH-DA at 37°C for 20 min, followed by trypsinization. DCFH-DA fluorescence at excitation wavelength 488 nm and emission wavelength 525 nm was detected by flow cytometry.
2.9. Chromatin Immunoprecipitation (ChIP)
VSMCs were treated with formaldehyde for cross-linking, followed by ultrasonication. Some samples were used to identify the expression of C/EBPα and PIK3C2A, which were utilized as the input. After adding the antibody against C/EBPα or normal IgG, agarose beads were used to bind the antibody/protein/DNA complex and washed to elute DNA. The eluted DNA was extracted by phenol-chloroform (Sigma, USA) and detected the expression level of PI3KC2A by qPCR.
2.10. Animal Treatment
During the last week of AD model establishment (9-week-old), AD rats were further divided into AD model group, shRNA NC group, and shC/EBPα group with 5 rats per group. shRNA NC group and shC/EBPα group were, respectively, injected with lentivirus (5 × 1010 PFU/rat) carrying control vector and C/EBPα siRNA via tail vein, respectively. After 3 days, the rats were killed via an overdose of anesthetic.
2.11. Mechanical Stress Intervention
The rat aortic rings were collected and intervened by stretch stress according to our previously published study [3]. Briefly, the aortic vessels were cut into 4 mm ring segments and removed the adventitia and intima. After the AD ring segments were suspended, equilibrated for 90 min, and precontracted by prostaglandin F2α (1.5 μM), the aortic rings were stretched by 3 g or 5 g for 30 minutes. After that, the aortic rings were frozen in liquid nitrogen and stored at −80°C until analysis.
2.12. Statistical Analysis
Data was analyzed using the GraphPad software and presented as mean ± SD. One-way ANOVA was used to analyze the difference among groups, followed by Tukey's post hoc test for multiple comparisons. P < 0.05 was considered a significant difference in the present study.
3. Results
3.1. PIK3C2A, C/EBPα, and LC3 Were Highly Expressed in AD
As shown in Figure 1(a), H&E staining was used to observe the arterial dissection with the increased aortic media thickness in the AD rats, while no dissection was observed in control rats. Compared to control rats, significantly higher expression levels of C/EBPα, LC3II/I, PIK3C2A, MMP-2, and MMP-9 in aortic dissection rings were observed in AD rats (Figures 1(b) and 1(c)).
Figure 1
Establishment of aortic dissection rats reveals model-specific patterns of C/EBPα, PIK3C2A, LC3, and MMPs proteins. (a) The pathological changes in aorta tissues evaluated by H&E staining (scale bar = 500 μm). (b) Representative images of C/EBPα, PIK3C2A, LC3, MMP-2, and MMP-9 protein expression in aortic dissection rings determined by Western blot. (c) The expression level of indicated proteins (∗P < 0.05 vs. control).
3.2. Primary Aortic VSMCs Were Isolated and Identified
The images of α-SMA immunofluorescence are shown in Figure 2. α-SMA was positively expressed in isolated aortic VSMCs with a parallel and fibrous morphology, indicating that primary aortic VSMCs were successfully isolated.
Figure 2
The identification of isolated aortic VSMCs using the immunofluorescence staining of VSMC-specific marker of α-SMA. Nuclei were stained with DAPI. Scale bar = 25 μm.
3.3. The Verification of the Efficacy of C/EBPα siRNA and pcC/EBPα in VSMCs
Three siRNAs targeting C/EBPα were designed and compared the knockdown efficacies (Figures 3(a) and 3(b)). The lowest C/EBPα mRNA and protein level were observed in C/EBPα siRNA-3 transfected VSMCs, which was utilized in the subsequent assays. Compared to pcDNA3.1 vector, C/EBPα mRNA and protein level significantly increased in aortic VSMCs with pcC/EBPα transfection indicating a successful establishment of C/EBPα-overexpressed VSMCs (Figures 3(c) and 3(d)).
Figure 3
C/EBPα knockdown and overexpression in aortic VSMCs. C/EBPα was knocked down using three independent siRNAs in aortic VSMCs, and knockdown was confirmed at both mRNA level by RT-qPCR (a) and protein level by Western blot (b). To overexpress C/EBPα in aortic VSMCs, C/EBPα cloned in pcDNA3.1 (pcC/EBPα) was transfected and confirmed at both mRNA level by RT-qPCR (c) and protein level by Western blot (d). Experiments done in triplicate. ∗P < 0.05 vs. control.
3.4. The Impact of C/EBPα on Contractile and Synthetic Phenotypes, Matrix Metalloproteinases, Autophagy, and Oxidative Stress in Angiotensin II-Treated VSMCs
Aortic VSMCs were treated with angiotensin II (AngII, 1 μM) for 48 h (model) or with AngII and vector transfection (vector), AngII and pcC/EBPα transfection (pcC/EBPα), AngII and siRNA NC transfection (siNC), and AngII and C/EBPα siRNA transfection (siC/EBPα), respectively. Untreated VSMCs were used as control group (control). Compared to model group, contractile proteins of α-SMA and SM-MHC were significantly downregulated, and the synthetic protein (OPN) and PIK3C2A was significantly upregulated with C/EBPα overexpression. The opposite results were stimulated by C/EBPα knockdown (Figures 4(a)–4(d)). pcC/EBPα downregulated p62 and upregulated LC3 and Beclin-1, and siC/EBPα provides the opposite trend (Figures 4(e) and 4(f)). Similarly, ROS level and MMP-2 and MMP-9 protein expression were dramatically elevated by pcC/EBPα and declined by siC/EBPα (Figures 4(g)–4(i)). These results suggested that C/EBPα was positively associated with phenotypic alteration, PIK3C2A expression, autophagy, extracellular matrix remodeling, and oxidative stress.
Figure 4
The impact of C/EBPα in angiotensin II- (Ang II-) treated VSMCs. The relative protein expressions in Ang II-treated VSMCs with presence of C/EBPα overexpression or knockdown were analyzed by Western blot. GAPDH was used as an internal control. Data are presented as means ± SEM. (a, b) Evaluation of the influence of C/EBPα on the expression of α-SMA, SM-MHC, and OPN proteins. (c, d) Evaluation of the influence of C/EBPα on the expression of PIK3C2A protein. (e, f) Evaluation of the influence of C/EBPα on the expression of Beclin-1, p62, LC3II, and LC3I proteins. (g, h) Evaluation of the influence of C/EBPα on the expression of MMP-2 and MMP-9 proteins. (i) Intracellular ROS was measured by flow cytometry using DCFH-DA probe with presence of C/EBPα overexpression or knockdown. Control: control group; model: treated with 1 μM Ang II; vector: treated with 1 μM Ang II in vector transfected VSMCs; pcC/EBPα: treated with 1 μM Ang II in C/EBPα-overexpressed VSMCs; siNC: treated with 1 μM Ang II in siRNA NC-transfected VSMCs; siC/EBPα: treated with 1 μM Ang II in C/EBPα-knockdown VSMCs. ∗P < 0.05 vs. control, #P < 0.05 vs. model.
3.5. The Morphology Effect of Autophagy by C/EBPα in Angiotensin II-Treated VSMCs
The number of autophagy cells and autophagosome increased significantly in Ang II-treated VSMCs; however, the formation of LC3 puncta and autophagosome could be further increased by C/EBPα overexpression or be decreased by C/EBPα knockdown (Figures 5(a)–5(c)).
Figure 5
The formation of LC3 puncta and autophagosome varied with C/EBPα gene expression in angiotensin II-treated VSMCs. Representative LC3 puncta images (a) of Ang II-treated VSMCs and the quantitation of LC3 IOD (b) of positive cells (∗P < 0.05 vs. control, #P < 0.05 vs. model). (c) The autophagosome in each group observed using TEM.
3.6. The Determination of Optimized siRNA for Knockdown of PIK3C2A in Angiotensin II-Treated VSMCs
Three siRNAs targeting PIK3C2A were transfected and compared the knockdown efficacies against Ang II-induced PIK3C2A. The lowest mRNA and protein levels were observed in PIK3C2A siRNA-3-transfected VSMCs (Figures 6(a) and 6(b)).
Figure 6
PIK3C2A knockdown in angiotensin II-treated aortic VSMCs. PIK3C2A was knocked down using three independent siRNAs in angiotensin II-treated aortic VSMCs, and knockdown was confirmed at both mRNA level by RT-qPCR (a) and protein level by Western blot (b). Experiments done in triplicate. ∗P < 0.05 vs. control.
3.7. The Impact of C/EBPα, PIK3C2A, and Autophagic Compounds on Contractile and Synthetic Phenotypes in Angiotensin II-Treated VSMCs
1 μM AngII-treated aortic VSMCs (model) were cotreated with 0.25 μM autophagy activator rapamycin (Rap) or with 5 mM autophagy inhibitor 3-methyladenine (3-MA), and with 3-MA and pcC/EBPα transfection (pcC/EBPα+3-MA) or cotransfected with pcDNA3.1 and siRNA NC (vector+siNC), with pcDNA3.1 and PIK3C2A siRNA (vector+siPIK3C2A), with pcC/EBPα and siRNA NC (pcC/EBPα+siNC), and with pcC/EBPα and PIK3C2A siRNA (pcC/EBPα+siPIK3C2A).Compared to model group, α-SMA and SM-MHC were significantly downregulated, and OPN was significantly upregulated in the Rap group and pcC/EBPα+siNC group, while in 3-MA group and vector+siPIK3C2A group, the opposite results were found (Figure 7(a)). The ratio of LC3II/I and Beclin-1 protein level significantly elevated in the Rap group and pcC/EBPα+siNC group, while LC3II/I ratio and Beclin-1 level were dramatically declined in the 3-MA group and vector+siPIK3C2A group. p62 protein expression presented the opposite changes compared to LC3II/I ratio and Beclin-1 (Figure 7(b)). Compared to pcC/EBPα+siNC group, PIK3C2A knockdown in pcC/EBPα+siPIK3C2A group increased α-SMA, SM-MHC, and p62 protein levels, decreased OPN and Beclin-1 expression, and also decreased LC3II/I ratio (Figures 7(a) and 7(b)). Overall, our results indicate that PIK3C2A knockdown inactivate the phenotype change and elevated autophagy by C/EBPα overexpression. And autophagy induce by C/EBPα and PIK3C2A might be the potential mechanism for phenotype change.
Figure 7
The impact of PIK3C2A and autophagy in angiotensin II- (Ang II-) treated VSMCs. The autophagy and phenotype changes in Ang II-treated VSMCs were analyzed by Western blot. GAPDH was used as an internal control. Data are presented as means ± SEM. (a) Evaluation of the influence on the expression of α-SMA, SM-MHC, and OPN proteins. (b) Evaluation of the influence on the expression of Beclin-1, p62, LC3II, and LC3I proteins. Model: treated with 1 μM Ang II; Rap: cotreated with 1 μM Ang II and 0.25 μM rapamycin; 3-MA: cotreated with 1 μM Ang II and 5 mM 3-methyladenine; pcC/EBPα+3-MA: cotreated with 1 μM Ang II and 5 mM 3-methyladenine in C/EBPα-overexpressed VSMCs; vector+siNC: treated with 1 μM Ang II in pcDNA3.1 and siRNA NC cotransfected VSMCs; vector+siPIK3C2A: treated with 1 μM Ang II in pcDNA3.1 and PIK3C2A siRNA cotransfected VSMCs; pcC/EBPα+siNC: treated with 1 μM Ang II in pcC/EBPα and siRNA NC cotransfected VSMCs; pcC/EBPα+siPIK3C2A: treated with 1 μM Ang II in pcC/EBPα and PIK3C2A siRNA cotransfected VSMCs. ∗P < 0.05 vs. model, #P < 0.05 vs. pcC/EBPα+siPIK3C2A.
3.8. The Morphology Effect of Autophagy by C/EBPα, PIK3C2A, and Autophagic Compounds in Angiotensin-Treated VSMCs
Compared to model group, the number of autophagy cells and autophagosome significantly increased by RAP and pcC/EBPα+siNC, while in 3-MA group and vector+siPIK3C2A group, the opposite results were found (Figure 8). Compared to pcC/EBPα+siNC group, PIK3C2A knockdown in pcC/EBPα+siPIK3C2A group decreased the number of autophagy cells and autophagosome. The results further confirmed the gene changes of C/EBPα and PIK3C2A were associated with autophagy.
Figure 8
The formation of LC3 puncta and autophagosome varied with C/EBPα, PIK3C2A, and autophagy in angiotensin II-treated VSMCs. Representative LC3 puncta images (a) of Ang II-treated VSMCs and the quantitation of LC3 IOD (b) of positive cells. (c) The autophagosome in each group observed using the TEM. Model: treated with 1 μM Ang II; Rap: cotreated with 1 μM Ang II and 0.25 μM rapamycin; 3-MA: cotreated with 1 μM Ang II and 5 mM 3-methyladenine; pcC/EBPα+3-MA: cotreated with 1 μM Ang II and 5 mM 3-methyladenine in C/EBPα-overexpressed VSMCs; vector+siNC: treated with 1 μM Ang II in pcDNA3.1 and siRNA NC cotransfected VSMCs; vector+siPIK3C2A: treated with 1 μM Ang II in pcDNA3.1 and PIK3C2A siRNA cotransfected VSMCs; pcC/EBPα+siNC: treated with 1 μM Ang II in pcC/EBPα and siRNA NC cotransfected VSMCs; pcC/EBPα+siPIK3C2A: treated with 1 μM Ang II in pcC/EBPα and PIK3C2A siRNA cotransfected VSMCs. ∗P < 0.05 vs. model, #P < 0.05 vs. pcC/EBPα+siPIK3C2A.
3.9. Induction of C/EBPα, PIK3C2A, and LC3 by Stretch Stress in AD Rat
Increased LC3II/I ratio and expression of C/EBPα and PIK3C2A in the aortic rings were verified in AD rat. Applying mechanical strength of 3 g and 5 g resulted in the further upregulation of C/EBPα, PIK3C2A, and LC3II/I as compared to those observed in model group (Figure 9).
Figure 9
The impact of C/EBPα, PIK3C2A, and LC3 by stretch stress in aortic rings of AD rat. Representative Western blot analysis and mean fold change of C/EBPα, PIK3C2A, and LC3 expression in aortic dissection rings of AD rat after being stretched by 0 g (model), 3 g (3 g), and 5 g (5 g) for 30 minutes. Aortic rings of normal rat were used as control. ∗P < 0.05 vs. control, #P < 0.05 vs. model.
3.10. C/EBPα Regulated the Expression Level of α-SMA and OPN in AD Rats In Vivo
Compared to AD rats (model), C/EBPα mRNA and protein were significantly downregulated in aortic vessels after C/EBPα shRNA lentivirus injection (shC/EBPα), indicating a successful knockdown of C/EBPα in vivo (Figures 10(a) and 10(b)). α-SMA was significantly downregulated, and OPN was dramatically upregulated in AD rat model. Furthermore, compared to the model group and shNC group, α-SMA was significantly upregulated, and OPN was dramatically downregulated in shC/EBPα group (Figures 10(c) and 10(d)).
Figure 10
The impact of C/EBPα in AD rats in vivo. C/EBPα expression in vivo was knocked down using C/EBPα shRNA lentivirus in AD rats, and knockdown was confirmed at both mRNA level by RT-qPCR (a) and protein level by Western blot (b) (∗P < 0.05 vs. model). The representative images (c) and expression levels (d) of α-SMA and OPN in the aortic vessels were determined by the immunohistochemistry (∗P < 0.05 vs. control, #P < 0.05 vs. model).
3.11. The Impact of C/EBPα Deficiency on PIK3C2A, Phenotypes, and Autophagy in Stretch-Activated Aortic Rings of AD Rat
Compared to control group, α-SMA, SM-MHC, and p62 were significantly downregulated, while PI3KC2A, OPN, Beclin-1, and LC3II/I ratio greatly raised by 5 g stretch stress in AD rat, which were dramatically reversed by C/EBPα knockdown (Figure 11).
Figure 11
The impact of C/EBPα deficiency in stretch-activated aortic rings of AD rat. C/EBPα expression in vivo was knocked down using C/EBPα shRNA lentivirus in AD rats, and the aortic rings were collected, stretched by 5 g for 30 minutes, and analyzed the protein levels of PIK3C2A, α-SMA, SM-MHC, OPN, LC3, Beclin-1, and p62 by Western blot. Representative images and the quantitative relative expression were shown. ∗P < 0.05 vs. control, #P < 0.05 vs. model (5 g).
3.12. The Identification of the Interaction between C/EBPα and PIK3C2A
To verify the interaction between C/EBPα and PIK3C2A, the ChIP assay was performed. The results of the qPCR assay indicated that compared to IgG, PIK3C2A was significantly upregulated in C/EBPα group, indicating that there was a binding site for C/EBPα in the promoter of PIK3C2A (Figure 12).
Figure 12
The interaction between C/EBPα and PIK3C2A was identified using the ChIP assay. ∗P < 0.05 vs. IgG.
4. Discussion
The change of VSMC phenotype and the extracellular matrix remodeling play the important roles in AD [22]. Although the previous report indicates that high correlation is observed between the regulatory effect of C/EBPα on cell differentiation and autophagy, the underlying mechanism on VSMC phenotypes by C/EBPα remains unclear. Our data revealed that autophagy was activated by C/EBPα through upregulating PIK3C2A at the transcriptional level, which further contributed to the VSMC synthetic phenotype transformed from contraction phenotype. Additionally, C/EBPα regulates the extracellular matrix remodeling.It is reported that the resting and activation of cells can be regulated by C/EBPα [23]. During the transition from resting to activation in hepatic stellate cells, C/EBPα upregulates [13]. Our results indicated that the transition of VSMC phenotype and extracellular matrix remodeling were regulated by C/EBPα. The expression level of PIK3C2A was elevated, and the transition from contraction phenotype to synthetic phenotype in AD VSMCs was facilitated by the overexpression of C/EBPα, accompanied by autophagy activation. These symptoms were blocked as C/EBPα knockdown. These results indicated that the transition of VSMC phenotype could be induced by C/EBPα through activating autophagy. Currently, it is reported that the proliferation of VSMC is facilitated, and the VSMC phenotype is changed by rapamycin, an activator of autophagy [24]. In addition, considering the key function of rapamycin-mediated autophagy in the function of VSMCs, autophagy-related drug has been applied in the prevention of restenosis after coronary intervention [25].Recent report indicates that molecular pathways and indexes that regulate the transition of VSMC phenotype might impact the development of AD [26]. In eukaryocytes, the metabolism of phosphoinositol is the core of regulating cell homeostasis [27], among which PI3P family is one of the most abundant lipids and play a critical role in endocytosis and autophagosome membrane dynamics in cells [28]. Previous researches indicate that the synthesis of PIK3C2A-dependent PI3P can be triggered by the mechanical stimulation, which further induces the progression of autophagy to impact the cellular biological function [29]. Our data revealed that in AD VSMCs, the activation of autophagy could be suppressed and the expression level of contractional proteins was decreased by knocking down PIK3C2A or using 3-MA, the autophagy inhibitor. More importantly, the transition of VSMC phenotype induced by the knockdown of PIK3C2A or the treatment of 3-MA was meaningfully reversed as overexpressing C/EBPα. Recently, diverse functions of C/EBPα are reported, especially regulating the progression of cellular metabolism as a transcriptional factor [30]. In addition, a synergistic effect between the replication factor C (RFC) and C/EBPα is identified by the interaction between C/EBPα and 3 subunits of RFC, RFC1, RFC4, and RFC5, using the method of proteomics and immunoprecipitation [31]. The synergistic effect is beneficial for the transcriptional activity of the reporter gene promoter, indicating a promising function of C/EBPα in activating transcription. Our ChIP results evidenced that C/EBPα regulated the transition of VSMC phenotype by activating autophagy through regulating the transcriptional activity of PIK3C2A promoter.It is reported that 70% AD patients have hypertension history [32] and during the early stage of AD, elevated pulse pressure or mechanical tension of active vein wall is observed [33]. To simulate the progression of clinical AD, the stretch stress was performed on aortic ring tissues. As the increase of stretch stress, the expression level of C/EBPα, PIK3C2A, and LC3 was elevated, indicating that C/EBPα, PIK3C2A, and LC3 could be upregulated by the stimulation of mechanical tension. More importantly, the activation of autophagy and the transition of VSMC phenotype induced by the stimulation of the mechanical tension were reversed as knockdowning C/EBPα. These results indicated that C/EBPα-mediated PIK3C2A activated autophagy to regulate the transition of VSMC phenotype, and it was critical to AD development.The transition of VSMC phenotype is indispensable to AD development and is involved in cardiovascular diseases. Autophagy is an important regulatory mechanism in cells and plays a critical role in maintenance of the cellular homeostasis and energy balance. However, it is controversial that whether autophagy is protective or harmful to AD development. It is recently reported that the autophagy in VSMCs can be facilitated by the dysfunction of EZH2 [34], which further aggravates the progression of AD. In addition, LC3, an important autophagy-related protein, is reported to be upregulated in aorta tissues in AD patients [35], which is also confirmed by another independent research institution [36]. In the present study, we evidenced that C/EBPα regulated the transition of VSMC phenotype by activating autophagy through regulating the transcriptional activity of PIK3C2A promoter. However, autophagy is also regarded as a protective mechanism in vascular diseases. Due to deletion of some autophagy-related genes, the autophagy of VSMCs will be damaged, and the cell death will be induced [37], which further impacts the progression of atherosclerotic or dissecting aneurysm [38]. Therefore, autophagy in VSMCs is a “double-edged sword.” Apart from regulating autophagy, it is recently reported that C/EBPα regulates the progression of cardiovascular diseases through the gluconeogenic pathway [39]. In the initiation of cell differentiation in VSMCs, C/EBPα might impact the progression of cardiovascular diseases by changing the cellular metabolic pattern [40]. These reports indicate that C/EBPα is related to AD development through autophagy or cellular metabolic patterns. However, the specific function of C/EBPα in cardiovascular diseases and the essential mechanism need to be further scrutinized in our future work.Additionally, in this study, C/EBPα promoted ROS level and MMP expression in VSMCs, indicating that excessive C/EBPα affected extracellular matrix remodeling. p62 competes with Nrf2 for binding to Keap1 to cause nuclear translocation of Nrf2 to activate the antioxidant response element (ARE), inducing antioxidant gene expression and protecting VSMCs from ROS injury [41]. ROS could promote MMP expression through a variety of signaling pathways, such as MAPK signaling pathway [42]. In this present study, C/EBPα upregulated autophagy and downregulated p62 expression. It was speculated that the downregulated p62 weakened the antioxidative effect of Nrf2, to enhance ROS level and MMP expression, which might be the possible explanation for extracellular matrix remodeling by C/EBPα in VSMCs.Taken together, our data indicated that during the development of AD, C/EBPα regulated the transition of VSMC phenotype by activating autophagy through regulating the transcriptional activity of PIK3C2A promoter.
Authors: Marc Clément; Joel Chappell; Juliette Raffort; Fabien Lareyre; Marie Vandestienne; Annabel L Taylor; Alison Finigan; James Harrison; Martin R Bennett; Patrick Bruneval; Soraya Taleb; Helle F Jørgensen; Ziad Mallat Journal: Arterioscler Thromb Vasc Biol Date: 2019-06 Impact factor: 8.311