Jessica R Shartouny1,2, Chung-Young Lee1,2, Gabrielle K Delima1,2, Anice C Lowen1,2. 1. Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, Georgia, United States of America. 2. Emory Center of Excellence for Influenza Research and Response (Emory-CEIRR), Atlanta, Georgia, United States of America.
Abstract
For diverse viruses, cellular infection with single vs. multiple virions can yield distinct biological outcomes. We previously found that influenza A/guinea fowl/Hong Kong/WF10/99 (H9N2) virus (GFHK99) displays a particularly high reliance on multiple infection in mammalian cells. Here, we sought to uncover the viral processes underlying this phenotype. We found that the need for multiple infection maps to amino acid 26K of the viral PA protein. PA 26K suppresses endonuclease activity and viral transcription, specifically within cells infected at low multiplicity. In the context of the higher functioning PA 26E, inhibition of PA using baloxavir acid augments reliance on multiple infection. Together, these data suggest a model in which sub-optimal activity of the GFHK99 endonuclease results in inefficient priming of viral transcription, an insufficiency which can be overcome with the introduction of additional viral ribonucleoprotein templates to the cell. More broadly, the finding that deficiency in a core viral function is ameliorated through multiple infection suggests that the fitness effects of many viral mutations are likely to be modulated by multiplicity of infection, such that the shape of fitness landscapes varies with viral densities.
For diverse viruses, cellular infection with single vs. multiple virions can yield distinct biological outcomes. We previously found that influenza A/guinea fowl/Hong Kong/WF10/99 (H9N2) virus (GFHK99) displays a particularly high reliance on multiple infection in mammalian cells. Here, we sought to uncover the viral processes underlying this phenotype. We found that the need for multiple infection maps to amino acid 26K of the viral PA protein. PA 26K suppresses endonuclease activity and viral transcription, specifically within cells infected at low multiplicity. In the context of the higher functioning PA 26E, inhibition of PA using baloxavir acid augments reliance on multiple infection. Together, these data suggest a model in which sub-optimal activity of the GFHK99 endonuclease results in inefficient priming of viral transcription, an insufficiency which can be overcome with the introduction of additional viral ribonucleoprotein templates to the cell. More broadly, the finding that deficiency in a core viral function is ameliorated through multiple infection suggests that the fitness effects of many viral mutations are likely to be modulated by multiplicity of infection, such that the shape of fitness landscapes varies with viral densities.
Cellular coinfection modulates the biology of diverse viruses. In VSV, inducing multiple infections via virion aggregation can accelerate viral production such that it outpaces innate antiviral responses [1]. In HIV-1, delivery of multiple viral genomes through cell-to-cell transmission of infection leads to more rapid onset of viral gene expression [2, 3]. For rotavirus and norovirus, vesicle-bound packets of viral particles have enhanced infectivity relative to free virions and are important vehicles for transmission [4, 5].Similarly, in the case of influenza A viruses (IAVs), interactions between homologous coinfecting viruses can be highly biologically significant [6-8]. While most single infections are abortive, delivery of multiple viral genomes to a cell strongly increases the likelihood of productive infection and can augment both replication rate and yield [6, 7, 9]. In other words, the virus-virus interactions that play out during cellular coinfection are typically beneficial and often required for productive infection. Of note, this feature of IAV biology strongly increases the frequency of reassortment, an important source of viral genetic diversity [10].IAV reliance on multiple infection appears to be particularly acute under conditions that are unfavorable for viral replication, such as in a new host species [7]. For a G1-lineage strain, influenza A/guinea fowl/Hong Kong/WF10/99 (H9N2) virus (GFHK99, also referred to as WF10), we found that coinfection with multiple homologous viruses was essential for robust replication in mammalian cells, but not avian cells. While every IAV tested thus far has shown some reliance on multiple infection, the strong host-specific reliance of GFHK99 was not apparent for influenza A/mallard/Minnesota/199106/99 (H3N8) virus (MaMN99). Using gene segment reassortments between these two IAVs, we found that the PA segment drives the high reliance of GFHK99 virus on multiple infection. However, the functional basis for this genetic association remained unclear.The PA gene segment encodes two proteins: PA and PA-X. PA is one of three protein subunits that comprise the viral RNA-dependent RNA polymerase, along with PB2 and PB1. The N-terminus of PA contains an endonuclease that cleaves cellular mRNAs 10–20 bases downstream of the 5’ cap, in a process termed cap-snatching [11, 12]. The resultant capped primer is required for mRNA synthesis by the viral polymerase [13]. PA-X, discovered in the past decade, is produced by ribosomal frame-shifting during translation of the PA mRNA [14]. The N-terminal 191 amino acids of PA-X are identical to those of PA, while the C-terminal 41 or 61 amino acids are unique [15]. PA-X has been shown to contribute to the shutoff of host protein synthesis [16].In this work, we sought to elucidate the drivers of the GFHK99 strain’s high reliance on multiple infection, tied to the PA gene segment. Our data demonstrate that the phenotype maps to residue 26K within the PA endonuclease. This amino acid lowers endonuclease activity, leading to inefficient viral transcription in cells infected at low multiplicity of infection (MOI). Conditions conducive to cellular coinfection allow robust transcription by a PA 26K virus in mammalian cells and support enhanced progeny production. Treatment of infected cells with a PA endonuclease inhibitor, baloxovir acid, leads to a similar reliance on multiple infection. These data suggest that cellular coinfection is beneficial because the delivery of multiple copies of the eight viral ribonucleoproteins (vRNPs) to the cell increases the frequency of successful transcription events, allowing infection to be initiated efficiently despite sub-optimal conditions.
Results
Reliance on multiple infection of GFHK99 is linked to the endonuclease region of PA
To determine which region of the PA gene segment contributed to the high reliance on multiple infection seen in GFHK99, chimeric PA gene segments were created using GFHK99 PA and MaMN99 PA. The segment was divided into three regions roughly corresponding to the domains of the PA protein (Fig 1A). Each chimeric segment and the full-length GFHK99 PA were incorporated into the MaMN99 background. To allow virus-virus interactions to be monitored, homologous infection pairs, termed wildtype (WT) and variant (VAR) viruses, were produced for each PA genotype. VAR viruses contained a synonymous mutation in each of the eight gene segments to allow differentiation from WT segments in molecular assays. In addition, WT and VAR virus HA proteins were differentially modified with epitope tags to allow quantification of cellular infection at a protein level [7].
Fig 1
Replacement of the MaMN99 PA endonuclease region with that of GFHK99 PA increases reliance on multiple infection.
(A) Chimeric PA gene segments that introduce regions of the GFHK99 PA into the MaMN99 PA: the endonuclease (GFHK99 Endo), the middle region (GFHK99 Arch), and the C-terminal domain (GFHK99 C-term). Amino acid positions are noted at the top of the figure. (B) The relationship between cells dually-infected with WT and VAR and cells infected with WT, VAR, or both. Data shown for each virus are derived from three independent experiments. Curve similarity to GFHK99 PA is determined by least sum-of-squares F test: GFHK99 PA Endo is represented by the same curve (p = 0.9385, F = 0.1356) while MaMN99, GFHK99 PA Arch and GFHK99 C-term are represented by different curves (p < 0.0001, F = 47.59, 34.24, and 39.01) (C) The percentage of progeny viruses with any reassortant genotype is plotted against the percentage of cells expressing hemagglutinin (HA). Curve similarity to GFHK99 PA is determined by least sum-of-squares F test: GFHK99 PA Endo is represented by the same curve (p = 0.8962, F = 0.11.0) while MaMN99, GFHK99 PA Arch and GFHK99 C-term are represented by different curves (p < 0.001, F = 23.73, 9.789, and 18.11) Data shown for each virus are derived from two independent experiments. The PA segment genotype of WT and VAR viruses is indicated in the legend. All viruses carried the remaining seven segments from MaMN99 virus.
Replacement of the MaMN99 PA endonuclease region with that of GFHK99 PA increases reliance on multiple infection.
(A) Chimeric PA gene segments that introduce regions of the GFHK99 PA into the MaMN99 PA: the endonuclease (GFHK99 Endo), the middle region (GFHK99 Arch), and the C-terminal domain (GFHK99 C-term). Amino acid positions are noted at the top of the figure. (B) The relationship between cells dually-infected with WT and VAR and cells infected with WT, VAR, or both. Data shown for each virus are derived from three independent experiments. Curve similarity to GFHK99 PA is determined by least sum-of-squares F test: GFHK99 PA Endo is represented by the same curve (p = 0.9385, F = 0.1356) while MaMN99, GFHK99 PA Arch and GFHK99 C-term are represented by different curves (p < 0.0001, F = 47.59, 34.24, and 39.01) (C) The percentage of progeny viruses with any reassortant genotype is plotted against the percentage of cells expressing hemagglutinin (HA). Curve similarity to GFHK99 PA is determined by least sum-of-squares F test: GFHK99 PA Endo is represented by the same curve (p = 0.8962, F = 0.11.0) while MaMN99, GFHK99 PA Arch and GFHK99 C-term are represented by different curves (p < 0.001, F = 23.73, 9.789, and 18.11) Data shown for each virus are derived from two independent experiments. The PA segment genotype of WT and VAR viruses is indicated in the legend. All viruses carried the remaining seven segments from MaMN99 virus.Using flow cytometry, the frequency of cellular coinfection between WT and VAR viruses was evaluated. Since this assay detects viral protein, it measures the extent to which viral gene expression relies on multiple infection. MDCK cells were coinfected with homologous WT and VAR pairs and, to enable quantitative analysis, infections were limited to a single cycle such that progeny viruses cannot be propagated onward. The relationship between the percentage of cells that stained with one or both epitope tags (total HA+) and the percentage of cells staining with both tags (dual-HA+) was evaluated (Fig 1B). As seen previously, MaMN99 WT and VAR viruses produced distinct populations of singly-infected cells and coinfected cells, with the frequency of coinfection increasing with total infection levels. Conversely, for the GFHK99 PA in a MaMN99 background (GFHK99 PA virus), nearly all infected cells were coinfected with both WT and VAR. Thus, a linear relationship was seen between dual-HA+ and total HA+, with a slope of 1.02 (95% C.I. 0.979 to 1.07, R2 = 0.981). Both the GFHK99 Arch PA and GFHK99 C-term PA viruses showed similar infection patterns to that of MaMN99 virus. In contrast, the GFHK99 Endo PA virus displayed a linear relationship between dual-HA+ and total HA+, like the GFHK99 PA virus. The slope obtained from a linear regression of GFHK99 PA Endo was comparable to that of GFHK99 PA at 1.03 (95% C.I. 0.959 to 1.10, R2 = 0.971).The prevalence of reassortant viruses within the progeny virus population was then determined. Since only cells coinfected with WT and VAR viruses can produce reassortants, this assay gives an indication of the relative productivity of singly- and multiply-infected cells. Reassortants were identified by deriving clonal isolates from the progeny population and then genotyping each segment therein. The frequency of reassortants within MaMN99 progeny virus populations was low at lower infection levels and increased as the percentage of HA+ cells increased. By comparison, GFHK99 PA virus coinfections resulted in high frequencies of reassortment even at low levels of infection, signifying that most of the progeny viruses were produced in cells infected with both WT and VAR (Fig 1C). WT-VAR coinfections with GFHK99 Arch and GFHK99 C-term viruses exhibited similar reassortment outcomes as seen with MaMN99 virus. Conversely, GFHK99 Endo PA coinfections displayed high percentages of reassortant progeny, on par with those seen for GFHK99 PA. The high frequencies of reassortant progeny and high levels of dual HA positivity observed in coinfections with GFHK99 Endo PA viruses indicate that the endonuclease region of GFHK99 PA confers a high reliance on multiple infection.
Disruption of PA-X does not alter reliance on multiple infection
The endonuclease domain is shared by the PA and PA-X proteins. To determine whether PA-X was the driving force behind high reliance on multiple infection, viruses were created in which the PA-X reading frame was disrupted [16]. Because PA-X is difficult to detect by western blotting, the effectiveness of this disruption was verified at a functional level. Using plasmid transfection, the full length MaMN99 PA gene segment with or without mutations to PA-X was introduced into cells together with a Renilla luciferase reporter construct. The wild type PA construct strongly suppressed the reporter signal relative to that seen with the ΔPA-X construct, consistent with the host shut-off activity of PA-X [16] and confirming the effectiveness of the mutations introduced (Fig 2A).
Fig 2
Disrupting PA-X does not alter reliance on multiple infection of GFHK99 and MaMN99 viruses.
(A) Relative luciferase activity of cells co-transfected with a Renilla luciferase expression plasmid and either MaMN99 PA or MaMN99 PA ΔPA-X expression plasmids. Values represent means ± SD of three replicates. Statistical significance was analyzed by unpaired t-test. (B) The relationship between cells dually-infected with WT and VAR MaMN99 ΔPA-X or GFHK99 PA ΔPA-X (dual-HA+) and cells infected with WT, VAR, or both (HA+). Data plotted are from three independent experiments. Curve similarity to GFHK99 PA is determined by least sum-of-squares F test: GFHK99 PA ΔPA-X is represented by a similar curve (p = 0.38, F = 1.05) while MaMN99 ΔPA-X is represented by a different curve (p < 0.0001, F = 51.4) (C) The percentage of progeny viruses with any reassortant genotype is plotted against the percentage of cells expressing hemagglutinin (HA). Curve similarity was determined by least sum-of-squares F test: GFHK99 PA ΔPA-X is represented by a similar curve to GFHK99 PA (p = 0.11, F = 2.8) while MaMN99 ΔPA-X is represented a similar curve to MaMN99 (p = 0.059, F = 3.4). Data shown are derived from two independent experiments. The PA segment genotype of WT and VAR viruses is indicated in the legend. All viruses carried the remaining seven segments from MaMN99 virus. Results for GFHK99 PA and MaMN99 viruses are reproduced from Fig 1 for comparison.
Disrupting PA-X does not alter reliance on multiple infection of GFHK99 and MaMN99 viruses.
(A) Relative luciferase activity of cells co-transfected with a Renilla luciferase expression plasmid and either MaMN99 PA or MaMN99 PA ΔPA-X expression plasmids. Values represent means ± SD of three replicates. Statistical significance was analyzed by unpaired t-test. (B) The relationship between cells dually-infected with WT and VAR MaMN99 ΔPA-X or GFHK99 PA ΔPA-X (dual-HA+) and cells infected with WT, VAR, or both (HA+). Data plotted are from three independent experiments. Curve similarity to GFHK99 PA is determined by least sum-of-squares F test: GFHK99 PA ΔPA-X is represented by a similar curve (p = 0.38, F = 1.05) while MaMN99 ΔPA-X is represented by a different curve (p < 0.0001, F = 51.4) (C) The percentage of progeny viruses with any reassortant genotype is plotted against the percentage of cells expressing hemagglutinin (HA). Curve similarity was determined by least sum-of-squares F test: GFHK99 PA ΔPA-X is represented by a similar curve to GFHK99 PA (p = 0.11, F = 2.8) while MaMN99 ΔPA-X is represented a similar curve to MaMN99 (p = 0.059, F = 3.4). Data shown are derived from two independent experiments. The PA segment genotype of WT and VAR viruses is indicated in the legend. All viruses carried the remaining seven segments from MaMN99 virus. Results for GFHK99 PA and MaMN99 viruses are reproduced from Fig 1 for comparison.WT and VAR homologous pairs of these viruses were used to coinfect MDCK cells and the frequencies of coinfected cells and reassortant viruses were examined across a range of MOIs (Fig 2). By both measures, MaMN99 ΔPA-X and GFHK99 PA ΔPA-X viruses displayed similar coinfection reliance phenotypes to their respective parental strain. Since expression of PA-X did not modulate the extent of reliance on multiple infection in either strain, PA-X does not appear to be a major driver of the high reliance phenotype displayed by GFHK99.
Reliance on multiple infection is dependent on PA 26 in the endonuclease region
An alignment of the PA endonuclease regions of MaMN99 and GFHK99 showed five coding differences at PA amino acids 20, 26, 85, 101, and 118 (Fig 3A). Owing to the charge difference at PA 26, where MaMN99 has a glutamic acid (E) and GFHK99 has a lysine (K), we focused on this position, which is located proximal to the active site of the endonuclease region (Fig 3B). Reciprocal mutants were generated in the MaMN99 and GFHK99 PA segments and each was incorporated into the MaMN99 background. WT and VAR homologous pairs of MaMN99 PA E26K and MaMN99: GFHK99 PA K26E (GFHK99 PA K26E) viruses were used in coinfections.
Fig 3
PA 26K is associated with a higher reliance on multiple infection than PA 26E.
(A) The MaMN99 and GFHK99 PA endonuclease regions differ by five amino acids. (B) A model of the endonuclease domain of GFHK99 PA with the active site residues labeled in green and PA 26K labeled in cyan. (C) The relationship between cells dually-infected with WT and VAR (dual HA+) and cells infected with WT, VAR, or both (HA+). Data plotted are from three independent experiments. Significance of differences between the curves was evaluated by a least sum-of-squares F test: GFHK99 PA E26K differs from GFHK99 PA (p < 0.0001, F = 65.5) and MaMN99 E26K differs from MaMN99 (p< 0.0001, F = 18.8). (C) The percentage of progeny viruses with any reassortant genotype is plotted against the percentage of cells expressing hemagglutinin (HA+). Similarity between curves was assessed by least sum-of-squares F test: GFHK99 PA E26K differs from GFHK99 PA (p = 0.0017, F = 8.7) and MaMN99 E26K can be represented by a similar curve as GFHK99 PA (p = 0.078, F = 9.16). Data plotted are from two independent experiments. The PA segment genotype of WT and VAR viruses is indicated in the legend. All viruses carried the remaining seven segments from MaMN99 virus.
PA 26K is associated with a higher reliance on multiple infection than PA 26E.
(A) The MaMN99 and GFHK99 PA endonuclease regions differ by five amino acids. (B) A model of the endonuclease domain of GFHK99 PA with the active site residues labeled in green and PA 26K labeled in cyan. (C) The relationship between cells dually-infected with WT and VAR (dual HA+) and cells infected with WT, VAR, or both (HA+). Data plotted are from three independent experiments. Significance of differences between the curves was evaluated by a least sum-of-squares F test: GFHK99 PA E26K differs from GFHK99 PA (p < 0.0001, F = 65.5) and MaMN99 E26K differs from MaMN99 (p< 0.0001, F = 18.8). (C) The percentage of progeny viruses with any reassortant genotype is plotted against the percentage of cells expressing hemagglutinin (HA+). Similarity between curves was assessed by least sum-of-squares F test: GFHK99 PA E26K differs from GFHK99 PA (p = 0.0017, F = 8.7) and MaMN99 E26K can be represented by a similar curve as GFHK99 PA (p = 0.078, F = 9.16). Data plotted are from two independent experiments. The PA segment genotype of WT and VAR viruses is indicated in the legend. All viruses carried the remaining seven segments from MaMN99 virus.The results showed that swapping the amino acid at PA 26 swapped the phenotypes displayed by MaMN99 and GFHK99 PA. Introduction of K26E within the GFHK99 PA decreased frequencies of dually HA+ cells, while introduction of E26K into the MaMN99 PA had the opposite effect (Fig 3C). In line with the coinfection results, GFHK99 PA K26E virus yielded fewer reassortants than GFHK99 PA virus, while MaMN99 PA E26K infection progeny were predominantly reassortant (Fig 3D). Thus, in both PA backgrounds, PA 26K was associated with higher reassortment than PA 26E. Taken together, the data show that viral gene expression and progeny production were focused within coinfected cells to a greater extent for viruses encoding PA 26K compared to those encoding PA 26E.
High reliance on multiple infection is associated with increased ratio of genome copies to infectious units
A classical means of evaluating the efficiency of viral infection is to determine the specific infectivity; that is, the relationship between infectious units and a measure of physical viral particles such as protein or RNA content. To relate the viral phenotypes observed during coinfection to specific infectivity, we determined the ratio of genome copy number to plaque forming units (PFU) for MaMN99, GFHK99 PA, and GFHK99 PA K26E viruses (Table 1). As anticipated, each infectious unit of GFHK99 PA virus was associated with a higher number of genome copies than the other two strains.
Table 1
High reliance on multiple infection is associated with increased ratio of genome copies to infectious units.
Virus
Mean genome copy/PFU ratio (+/- SD)1
MaMN99
22.6 (0.51)
GFHK99 PA
97.9 (51)
GFHK99 PA K26E
26.3 (9.8)
1Genome copy / PFU ratio was determined for three replicate samples of virus stock
1Genome copy / PFU ratio was determined for three replicate samples of virus stock
Endonuclease activity and transcript production are suppressed by PA 26K
We reasoned that the high reliance on multiple infection resulting from PA 26K might be a result of reduced PA protein levels in infected cells or impeded functionality of the PA protein. To evaluate the first possibility, PA protein levels in cells infected with GFHK99 PA or GFHK99 PA K26E viruses were compared by western blotting (Fig 4A). GFHK99 PA virus did not display less PA protein than GFHK99 PA K26E virus, indicating that PA 26K did not reduce the accumulation of PA during infection.
Fig 4
Levels of PA protein are not decreased by PA 26K.
Western blot of cell lysates collected at 8 or 16 h post-infection with GFHK99 PA virus, GFHK99 PA K26E virus, or mock infected, as indicated above the blot. Blot was probed for PA, NP, and β-actin.
Levels of PA protein are not decreased by PA 26K.
Western blot of cell lysates collected at 8 or 16 h post-infection with GFHK99 PA virus, GFHK99 PA K26E virus, or mock infected, as indicated above the blot. Blot was probed for PA, NP, and β-actin.To evaluate viral endonuclease activity of MaMN99 and GFHK99 PA, we assayed the extent to which the corresponding PA-X proteins disrupted expression of Renilla luciferase in transfected cells. This approach was used because PA and PA-X carry the same endonuclease domain, but PA-X activity is more readily monitored in a cell-based assay. As expected based on the mRNA-degrading function of PA-X, the activity of Renilla luciferase gradually decreased with an increase in the amount of PA-X plasmid introduced into cells (Fig 5A). Of note, the effect was markedly weaker with the GFHK99 PA-X than the MaMN99 PA-X, indicating that the GFHK99 PA-X has lower endonuclease activity. Next, E26K or K26E variants of MaMN99 and GFHK99 PA-X, respectively, were tested and PA-X expression of each was verified by Western blot. The E26K mutation in MaMN99 PA-X reduced PA-X activity, showing less reduction of Renilla luciferase activity than the wild-type (Fig 5B and 5D). Conversely, the K26E mutation in GFHK99 PA-X enhanced PA-X activity (Fig 5C and 5E). Thus, position 26 within the viral endonuclease modulates its enzymatic activity.
Fig 5
26K confers lower endonuclease activity than PA 26E.
PA (A-C) Dose-dependent effect of PA-X protein on expression of Renilla luciferase in co-transfected cells. Plots include data from three independent experiments, compared via 2-way ANOVA. ****p < 0.0001, *p = 0.020, **p = 0.0017. (A) MaMN99 PA-X and GFHK99 PA-X. (B) GFHK99 PA-X and GFHK99 PA-X K26E. (C) MaMN99 PA-X and MaMN99 PA-X E26K. (D-E) Representative western blots confirming expression of PA-X in transfected cells. Samples correspond to one of the replicates shown in panels A–C. Amount of PA-X plasmid transfected is indicated underneath (ng). (F-I) Quantification of viral mRNA (F, H) and vRNA (G, I) in cells infected at low MOI of 0.5 RNA copies/cell (F,G) and high MOI of 1000 RNA copies/cell (H, I). The mean log10 fold change relative to the 0 h time point is plotted, with error bars showing SD. vRNA and mRNA levels were compared via unpaired Student’s t-test. ****p < 0.0001, ***p = < 0.001, **p = < 0.01.
26K confers lower endonuclease activity than PA 26E.
PA (A-C) Dose-dependent effect of PA-X protein on expression of Renilla luciferase in co-transfected cells. Plots include data from three independent experiments, compared via 2-way ANOVA. ****p < 0.0001, *p = 0.020, **p = 0.0017. (A) MaMN99 PA-X and GFHK99 PA-X. (B) GFHK99 PA-X and GFHK99 PA-X K26E. (C) MaMN99 PA-X and MaMN99 PA-X E26K. (D-E) Representative western blots confirming expression of PA-X in transfected cells. Samples correspond to one of the replicates shown in panels A–C. Amount of PA-X plasmid transfected is indicated underneath (ng). (F-I) Quantification of viral mRNA (F, H) and vRNA (G, I) in cells infected at low MOI of 0.5 RNA copies/cell (F,G) and high MOI of 1000 RNA copies/cell (H, I). The mean log10 fold change relative to the 0 h time point is plotted, with error bars showing SD. vRNA and mRNA levels were compared via unpaired Student’s t-test. ****p < 0.0001, ***p = < 0.001, **p = < 0.01.We further measured the effect of the E26K mutation in MaMN99 PA on viral transcription during infection by measuring the accumulation of viral mRNA under low and high MOI conditions in MDCK cells. At a low MOI, markedly less mRNA was produced in MaMN99-PA-E26K infection compared to MaMN99 infection (Fig 5F). However, at a high MOI, mRNA accumulated at a similar rate for MaMN99 and MaMN99-PA-E26K viruses (Fig 5H). These data suggest that low endonuclease activity of PA carrying the 26K polymorphism suppresses viral transcription at a low MOI but is compensated by multiple infection. Measurement of viral genomic RNA (vRNA) in the same cells (Fig 5G and 5I) revealed similar patterns, indicating that the effects of PA 26K and multiple infection are also borne out at the level of viral genome replication, most likely as a downstream consequence of the effects on viral transcription.
Inhibition of endonuclease activity increases reliance on multiple infection
We postulated that inhibiting the PA endonuclease cap-snatching function would enforce an increased reliance on cellular coinfection for productive replication. The drug baloxavir marboxil (Xofluza) targets cap-snatching by chelating the ions in the active site of the PA protein and baloxavir acid (BXA), the active form of the drug, is available for use in cell culture. MaMN99 WT and VAR virus coinfections were treated with an intermediate dose of BXA designed to handicap but not wholly abolish infection (Fig 6A). The frequency of reassortant progeny resulting from these infections increased across the range of MOIs tested, indicating that nearly all progeny arose from coinfected cells under BXA treatment. This outcome is in stark contrast to that seen in mock-treated MaMN99 infections, where frequencies of reassortment suggest that appreciable levels of virus emanate from singly infected cells.
Fig 6
Inhibition of cap-snatching increases reliance on multiple infection.
The MaMN99 PA endonuclease was inhibited using baloxavir acid (BXA) during a coinfection with homologous WT and VAR viruses. (A) The relationship between percentages of HA+ cells and dual-HA+ cells. The curve representing BXA-treated MaMN99 differs from that representing the untreated virus (p< 0.0001, F = 167.0, least sum-of-squares F test) (B) The percentage of progeny with reassortant genotypes was plotted as a function of percent cells HA+. The curve representing BXA-treated MaMN99 differs from that representing the untreated virus (p = 0.0077, F = 7.54, least sum-of-squares F test). Data from two independent experiments are plotted together.
Inhibition of cap-snatching increases reliance on multiple infection.
The MaMN99 PA endonuclease was inhibited using baloxavir acid (BXA) during a coinfection with homologous WT and VAR viruses. (A) The relationship between percentages of HA+ cells and dual-HA+ cells. The curve representing BXA-treated MaMN99 differs from that representing the untreated virus (p< 0.0001, F = 167.0, least sum-of-squares F test) (B) The percentage of progeny with reassortant genotypes was plotted as a function of percent cells HA+. The curve representing BXA-treated MaMN99 differs from that representing the untreated virus (p = 0.0077, F = 7.54, least sum-of-squares F test). Data from two independent experiments are plotted together.
Discussion
Although cellular coinfection can strongly impact infection outcomes in many virus-host systems, the mechanistic basis for these effects is generally poorly understood. Here we sought to address this deficiency by focusing on GFHK99, an IAV that shows extremely high reliance on cellular coinfection. We identified a polymorphism at position 26 within the PA endonuclease domain as the driver of high reliance on multiple infection. Functionally, PA 26K reduces the activity of the endonuclease, lowering the efficiency of viral transcription and impacting the host shutoff capabilities of the virus. Importantly, however, under high MOI conditions, the inefficiency is overcome. Consistent with these results, BXA-imposed inhibition of the PA endonuclease leads to a focusing of viral replication within cells that are multiply-infected. Our data suggest a model in which the delivery of many viral genomes to the cell compensates for inefficient cap-snatching by providing greater opportunity for that process to unfold (Fig 7).
Fig 7
Multiple infection allows a virus with an inefficient PA endonuclease to replicate.
The PA protein, located within the viral polymerase complex, cleaves host mRNAs to generate the capped primers needed for viral transcription. Our data show that PA 26K has low cleavage activity compared with PA 26E. Under low multiplicity conditions, this deficiency results in inefficient viral transcription. However, delivery of multiple copies of the viral genome to the cell allows a PA 26K polymerase to produce high levels of viral mRNA, enabling successful completion of the viral life cycle. Figure was created with BioRender.com.
Multiple infection allows a virus with an inefficient PA endonuclease to replicate.
The PA protein, located within the viral polymerase complex, cleaves host mRNAs to generate the capped primers needed for viral transcription. Our data show that PA 26K has low cleavage activity compared with PA 26E. Under low multiplicity conditions, this deficiency results in inefficient viral transcription. However, delivery of multiple copies of the viral genome to the cell allows a PA 26K polymerase to produce high levels of viral mRNA, enabling successful completion of the viral life cycle. Figure was created with BioRender.com.To successfully propagate its genome, an infecting virus must complete a number of discrete steps of the early life cycle, many of which are the targets of cellular defense mechanisms. For IAV, each barrier must be overcome by eight unique vRNP complexes. This process appears to be prone to failure, such that the likelihood of a single IAV establishing an infection is extremely low [9, 17]. Consistent with low rates of productive infection, IAV infected cells typically support expression from and replication of fewer than eight segments [6, 9]. In the case of GFHK99 virus, incomplete viral genomes were detected with a frequency of approximately 90% [7]. While high, this frequency is not sufficient to account for the extremely high reliance on multiple infection exhibited by this strain in mammalian systems [7]. The data reported here indicate that this additional reliance stems from a deficiency in viral cap-snatching, the process by which the IAV polymerase acquires capped RNA oligomers to prime transcription [12]. With multiple viral genomes infecting together, the larger number of NP-RNA templates and associated polymerases available for primary transcription appears to enable levels of mRNA synthesis sufficient to sustain robust infection.Our previous work revealed that the extent to which GFHK99 virus relies on multiple infection for productive infection is strongly dependent on host species: in avian systems, the need for multiple infection was greatly diminished [7]. Since we focused our studies herein on mammalian systems, our data do not reveal whether the GFHK99 PA enzyme is more active in avian cells or whether this avian virus is simply less sensitive to the cap-snatching deficiency in a host environment to which it is well-adapted. However, prior work suggests the latter model is correct and that PA 26K is deleterious in both mammalian and avian hosts. First, PA 26K does not fall within interacting surfaces of defined cellular binding partners that might differ with host species. Second, PA 26K occurs rarely in sequenced strains, including those of the G1 lineage of H9N2 viruses [18], suggesting its occurrence in GFHK99 is the result of genetic drift. Third, introduction of PA K26E was seen to improve the kinetics and yield of GFHK99 viral replication in chicken cells and eggs [18]. Fourth, GFHK99 variant viruses carrying PA K26E rapidly emerged and underwent positive selection in experimentally infected quail [19]. Thus, while GFHK99 shows a reduced need for multiple infection in avian cells compared to mammalian cells [7], there is a fitness cost of PA 26K even in avian systems. We therefore suggest that PA 26K has a greater impact in mammalian systems owing to a confluence of mal-adaptions to the mammalian cellular environment.In using BXA treatment to substantiate the link between deficient cap-snatching and the need for many incoming viral genomes, we show that viral replication can proceed under anti-viral treatment within multiply-infected cells. While potentially consequential for clinical use of baloxavir marboxil and the development of resistance [20, 21], our data more broadly suggest that the targeting of viral cap-snatching and other steps of the viral life cycle that precede genome replication are likely to be efficient therapeutic strategies. This approach is expected to increase the frequency of abortive infections, potentially pushing the rate of productive infections below a threshold needed to sustain viral propagation.The viral population dynamics documented herein are consistent with the ecological principle of positive density dependence and, more specifically, the Allee effect. Positive density dependence is a situation in which increasing population density leads to a higher population growth rate [22]. An Allee effect refers specifically to positive density dependence within low density populations (such as in a low MOI viral infection). Allee effects occur when the members of a species rely on intra-species interactions for survival or reproduction [23, 24]. For example, predators may be more effective in packs and pollination may be more efficient when individual plants are in close proximity [25, 26]. A similar dynamic appears to apply within low density IAV populations: as more viruses are added to a cell, burst size increases. We propose that the positive relationship between initial viral input and ultimate viral output arises because essential steps of the early viral life cycle are less prone to stochastic failure when the infecting population is larger. In unfavorable contexts—such as a new host species, antiviral treatment or deleterious mutation—the frequency with which these essential steps fail may be increased. In these situations, viral density would be expected to have a greater impact on viral growth rates. The acute density dependence of GFHK99 in mammalian systems is well explained by this paradigm and we expect these concepts apply broadly to IAV and many other viruses.This work reveals that, in the specific case of GFHK99, multiple infection mitigates the deleterious effects of a specific mutation affecting a core viral process–transcription. It further suggests that multiple infection is likely to modulate the fitness effects of any mutation, such that the topology of fitness landscapes vary with viral population density. Finally, this effect is expected to be most potent under adverse conditions, such as in a new host species.
Methods
Cells and cell culture
Madin-Darby canine kidney (MDCK) cells and 293T cells (ATCC, CRL-3216) were maintained in minimal essential medium supplemented with 10% fetal bovine serum and 100 ug/mL normocin. MDCK cells gifted by Peter Palese, Icahn School of Medicine at Mount Sinai were used for experiments. MDCK cells gifted by Daniel Perez, University of Georgia, were used for plaque assays. All cells were maintained at 37°C and 5% CO2 in a humidified incubator and monitored monthly for mycoplasma contamination.
Viruses
Influenza A viruses used in these experiments were generated via reverse genetics [27, 28]. Briefly, 293T cells transfected with ambisense plasmids encoding the eight viral gene segments were injected 16–24 h after transfection into the allantoic cavity of 10–11 day-old embryonated chicken eggs (Hyline International) and incubated for 32–36 h at 37°C. Allantoic fluid was collected and used as the virus stock for experiments. Infectious titers were determined by plaque assay in MDCK cells and by flow cytometry targeting virally encoded epitope tags. Levels of internally deleted defective interfering segments derived from PB2, PB1, PA, and NP segments were confirmed to be minimal for each virus stock using previously-described procedures [29]. Briefly, primers specific to terminal and internal regions of each segment were used in digital droplet PCR. Stocks were deemed low in defective interfering segments if the terminal:internal ratio was below a threshold of 4. All viruses used contained PB2, PB1, HA, NP, NA, M, and NS segments derived from influenza A/mallard/Minnesota/199106/99 (H3N8) virus (MaMN99). MaMN99 PA viruses contained the PA gene segment from MaMN99. MaMN99: GFHK99 PA viruses contained the PA gene segment from influenza A/guinea fowl/Hong Kong/WF10/99 (H9N2) virus. The N-terminus of the HA segment of each virus used was engineered to contain either a 6xHIS or an HA epitope tag connected via a flexible GGGS linker following the signal peptide. This approach was described previously and allows the signal to be present on mature HA proteins without interfering with the folding [30]. Homologous WT and VAR viruses were tagged with opposite epitopes to allow differentiation of infected cells via flow cytometry. GFHK99 Endo PA and MaMN99 viruses were tagged WT as HIS-tag and VAR as HA-tag. All other viruses were tagged WT as HA-tag and VAR as HIS-tag. Homologous VAR viruses included one synonymous mutation in each segment relative to the WT strain, as detailed previously [7].
Generation of modified PA plasmids
Plasmids encoding chimeric PA gene segments were created using the NEBuilder HiFi DNA Assembly Master Mix (New England Biosciences) according to the manufacturer’s instructions using the primers in S1 Table. PCR-amplified fragments encoding the endonuclease region (GFHK99 Endo), linker and arch region (GFHK99 Arch), or C-terminal region (GFHK99 C-term) of GFHK99 PA were combined with a fragment containing the rest of the MaMN99 PA segment in a pDP2002 plasmid, a gift from Daniel Perez [31]. Mutations to the PA 26 codon were introduced using site-directed mutagenesis (QuikChange, Agilent) using primers listed in S2 Table. Two nucleotide changes were introduced to avoid reversion. MaMN99 ΔPA-X and MaMN99:GFHK99 PA ΔPA-X were designed as described previously [16]: site-directed mutagenesis of three bases at the X-ORF (t597c, t600c, and t627a) decrease the likelihood of frameshifting and add a TAG stop codon to truncate the C-terminal region of PA-X. These mutations do not affect the PA coding frame. Sequences of purified plasmid preparations were verified by Sanger sequencing (Genewiz). WT and VAR pairs of each recombinant virus were generated as described above. ΔPA-X segment loss-of-function was verified via host shutoff capacity: 293T cells were transfected with 40 ng of either pCAGGS-MaMN99-PA or pCAGGS-MaMN99-PA-ΔPA-X plasmids and 50 ng of pRL-TK plasmid (Promega). At 24 h post-transfection, the transfected cells were lysed and 20 μl of lysate was transferred to a 96-well plate. 100 μl of Renilla luciferase assay reagent (Promega) was added and then Renilla luciferase activity was measured on a BioTek Synergy H1 Hybrid Reader. Renilla luciferase activity was plotted relative to empty vector transfected cells.
Infection of cells for quantification of cellular coinfection and viral reassortment
Infections of cultured cells were performed as described previously [7, 32]. Briefly, homologous WT and VAR viruses were mixed in equivalent amounts based on infectious titers as determined by flow cytometry, diluted serially in 1x PBS, and used to inoculate 80% confluent MDCK cells in 6 well dishes. Synchronized single-cycle infection conditions were used: to synchronize viral entry, virus was allowed to attach during a 45 min incubation at 4°C before addition of warm virus medium (1xMEM, 4.3% BSA, 100 IU penicillin/streptomycin) and incubation for 2 h at 37°C. At the end of this 2 h incubation, residual inoculum was inactivated using a 5 min acid wash in PBS-HCl (pH = 3). Cells were then placed in virus medium (pH = 7.1) supplemented with 20 mM NH4Cl and 50 mM HEPES and incubated at 37°C. This medium prevents endosomal acidification and therefore blocks any further viral entry, imposing single cycle conditions [33, 34]. Released virus and cells were collected at 16 hpi (with 0 hpi defined as the time of warming). Supernatant was stored at -80°C until use in plaque assays.To verify the effectiveness of our method for limiting an infection to a single round of replication, we set up an experiment in which cells were infected with MaMN99 virus either within medium containing 20 mM NH4Cl and 50 mM HEPES or with standard medium supplemented with TPCK trypsin (i.e. the medium used to allow ‘multi-cycle conditions’). At 24 h post-infection, cell culture supernatant was sampled and infectious titers were determined by plaque assay. Results of this validation experiment showed that, in contrast to the multi-cycle conditions, no viral propagation was detected when single cycle conditions were imposed throughout the inoculation and growth stages of the experiment (S2 Fig).Coinfections with baloxavir acid (MedChemExpress, CAS No. 1985605-59-1) were completed in the same manner as above, with 5nM BXA added to the virus medium both during the 2 h viral entry period and the 14 h viral replication period.
Quantification of infection and coinfection
Frequencies of infection and coinfection in cell monolayers co-inoculated with WT and VAR viruses were evaluated based on surface expression of HA- and HIS-tags. Samples were stained for 45 min on ice with Penta HIS Alexa Fluor 647 conjugated antibody (5 ug/ml; Qiagen) and Anti-HA-FITC Clone HA-7 (7 ug/ml; Sigma Aldrich). Cells were then washed and resuspended in PBS-2% FBS in cluster tubes for flow cytometry analysis on a BD-FACSymphony A3 cytometer in the Emory University Flow Cytometry Core. Analysis was performed using FlowJo 10.8.1 software. Non-linear regressions (least squares) and linear regressions of the data were performed in Prism Graphpad.
Quantification of reassortment
The frequency of reassortant viruses was determined as described previously [35]. Plaque assays were performed in 10 cm-diameter dishes to isolate viral clones and agar plugs were collected with 1 mL serological pipettes into 160 μl PBS. vRNA was extracted using the Quick RNA 96 extraction kit (Zymo) then reverse transcribed using Maxima reverse transcriptase (Thermofisher) per the manufacturer’s instructions using the Universal F(A)+6 primer (gcgcgcagcaaaagcagg). cDNA was diluted 1:4 in nuclease-free water and combined with segment-specific primers [7] to differentiate WT and VAR segments by high-resolution melt analysis with Precision Melt Supermix (Bio-Rad) using a CFX384 Touch Real-time PCR detection system (Bio-Rad) and BioRad CFX Manager 3.1 software. Data were analyzed using Precision Melt Analysis 1.3 software (Bio-Rad) to assign a genotype based on the combination of WT and VAR segments in each isolate. Percent reassortment was calculated as the number of viral isolates with any reassortant genotype divided by the number of isolates screened, multiplied by 100. Results were plotted as a function of percent HA+ cells as determined by flow cytometry. Semi-log curves were fitted to the data in Graphpad.
Analysis of RNA copy number per infectious unit
Genome copy numbers were determined as follows. RNA was extracted from virus stocks using the QIAamp Viral RNA Mini kit (Qiagen) and reverse-transcribed using Maxima RT (Thermo Scientific) according to the manufacturer’s instructions and using the Universal F(A)+6 primer (gcgcgcagcaaaagcagg). Viral cDNA was then quantified by digital droplet PCR using primers targeting the NP segment (MaMN99 NP F: cgacaaagagatcagaagaagga, MaMN99 NP R: tcatcaaatgggtgagacca, GFHK99 NP F: gaaggagagacgggaaatg, GFHK99 NP R: ggctcttgttctctggtatg) and QX200 ddPCR EvaGreen Supermix (BioRad) on a QX200 digital droplet PCR instrument (BioRad). Infectious titers were determined by plaque assay and used to calculate the genome copy:PFU ratio for each sample of virus. Three samples per virus stock were analyzed in this way. The significance of differences between ratios were compared using an unpaired, two-tailed t-test.
Analysis of the shutoff of cellular gene expression
250, 50, 10, 2, or 0.4 ng of MaMN99 or MaMN99 PA E26K plasmids were ectopically transfected to 293T cells with 50 ng of pRL-TK plasmid using X-tremeGENE 9 (Roche). At 24 h, the transfected cells were lysed and 20 μl of lysate was transferred to a 96-well plate. 100 μl of Renilla luciferase assay reagent (Promega) was added and then Renilla luciferase activity was measured on a Synergy H1 Hybrid Reader (BioTek).
Strand-specific quantification of vRNA and mRNA over time
MDCK cells (1 × 105 cells per well) were seeded onto 24-well plate and incubated at 37°C for 24 h. The cells were washed three times with PBS, then chilled viruses were inoculated under single cycle infection conditions, low MOI of 0.5 RNA copies/cell and high MOI of 1000 RNA copies/cell. After 1h of absorption, the cells were washed three times with PBS. The cells were collected at 0, 2, 8, and 12 h post-infection, and the RNA was extracted using RNeasy Mini kit (Qiagen). To reverse-transcribe specific RNA species, two different primers targeting vRNA or mRNA of NA segment were used (vRNA primer: ggccgtcatggtggcgaat; mRNA primer: ccagatcgttcgagtcgt) [7]. The quantitative PCR was conducted with Ssofast EvaGreen Supermix (Bio-Rad) and specific primer set targeting vRNA or mRNA of NS using CFX384 Touch Real-time PCR (Bio-Rad) (S3 Table) [36].
Western blotting
Western blotting was performed using the Thermo scientific miniblot module. SDS-PAGE of reduced samples was run on Bolt Bis-Tris 4–12% premade gels in MOPS. Blotting was performed onto 0.2nm nitrocellulose membranes at 15V for 30 minutes. Blots were blocked with 5% milk in PBS-0.05% Tween 20 for 1h at room temperature, then incubated overnight at 4°C with primary antibodies at 1:2,000: rabbit anti-PA polyclonal (Genetex), mouse anti-β-actin (Sigma, clone AC-74), and mouse anti-influenza NP (Kerafast, clone HT103). Secondary antibodies (1:3,000) goat anti-Rabbit IgG-HRP (Sigma) and goat anti-mouse IgG-HRP (Promega) were incubated with the blots for 1h at room temperature and the blots were developed using Bio-Rad Clarity Western ECL Substrate. Images were taken on the Bio-Rad ChemiDoc MP imaging system.
Protein modeling
Models of PA were created using the Phyre2 protein fold recognition server (http://www.sbg.bio.ic.ac.uk/phyre2/) to predict structures based on the published sequence of GFHK99 PA (Genbank accession # MN267497.1) [37]. Visualization was performed with UCSF Chimera (https://www.rbvi.ucsf.edu/chimera/), developed by the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco, with support from NIH P41-GM103311 [38].
Quantification and statistical analysis
Analysis of these data was performed using the GraphPad Prism statistical software. Replicate sizes are indicated on figure legends where applicable. Linear and non-linear (least-fit) regressions were performed on data collected via flow cytometry and curve similarity assessed via least fit sum-of-squares F test. Semi-log lines were fitted to reassortment data. PA-X host shutoff capacity was analyzed using unpaired Student’s t-tests and reported +/- SD for Fig 2A. Data in Fig 5 were analyzed via 2-way ANOVA. Alpha = 0.05.
Example gating strategy for quantification of coinfection frequencies.
The ancestral gates for flow cytometry analysis of coinfection are shown, gating on cells, single cells, and, finally, sorting by epitope tag expression for uninfected, HA-tag+, HIS-tag+, and dual-tag+ cells.(TIF)Click here for additional data file.
Validation of inhibition of infection by addition of HEPES buffer and NH4Cl to culture medium.
To confirm that the addition of 20 mM NH4Cl and 50 mM HEPES blocks infection, MDCK cells were inoculated with MaMN99 virus either in standard virus medium supplemented with trypsin or in virus medium lacking trypsin but including 20 mM NH4Cl and 50 mM HEPES. Viral replication was evaluated by titration of released virus sampled at 24 h post-inoculation. N = 3. Significance of differences was evaluated by unpaired, two-sided t-test.(TIF)Click here for additional data file.
Primers used for chimeric PA segment Gibson Assembly.
(DOCX)Click here for additional data file.
Primers for ΔPA-X site-directed mutagenesis.
(DOCX)Click here for additional data file.
Primers used for strand-specific qPCR of MaMN99.
(DOCX)Click here for additional data file.
Raw data corresponding to each of the main and supplementary figures and Table 1 are compiled here.
(XLSX)Click here for additional data file.
Transfer Alert
This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.5 Jul 2022Dear Dr. Lowen,Thank you very much for submitting your manuscript "Beneficial effects of cellular coinfection resolve inefficiency in influenza A virus transcription" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.Both reviewers liked the paper but had a few minor concerns that appear worth addressing.Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Christopher B BrookeGuest EditorPLOS PathogensCarolina LopezSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064***********************Both reviewers liked the paper but had a few minor concerns that appear worth addressing.Reviewer Comments (if any, and for reference):Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: This manuscript by Shartouny et al. is an interesting follow-up on their prior work indicating that infectious dose could overcome a species barrier for the virus GFHK99, and that the relevant variation to this phenomenon could be found in the PA segment. They find that endonuclease activity, but not specifically the action of PA-X but rather likely the contribution of this activity to mRNA production, is the feature which is compensated by multiple-dose infection. The manuscript is well-written, and other than a few minor suggestions below, the data are easy to follow and well-presented. Overall I would say this is a great contribution to influenza dynamics and the true impacts of deleterious variation in a viral population and the idea that MOI is more than just a number. I also really appreciate the authors providing raw numbers on much of their data, this is a really good thing to do!My only “real” experimental suggestion is that, given the authors own expertise in working with avian cells, it would be of interest to measure the impact of this variant in avian cells. I admit, my assumption (which could be wrong) from the authors not providing this data is that this variant also is limited in activity in avian cells, which perhaps complicates the host adaptation story. But, if so, I think it is worth pointing out that this mutation could simply be the straw that breaks the camel’s back (ie it is bad in both contexts, but due to other, perhaps smaller effect size, impacts throughout the viral genome, there is a non-linear fitness cliff, below which multiple particles are required to produce robust infection, and above which this effect is marginal, so switching host species reveals pre-existing maladaptive variation simply due to more stringent selection throughout the genome). This is obviously conjecture on my own part, and while I really do think this manuscript would benefit from a simple measurement in this regard, if there are difficulties in procuring that measurement about which I am ignorant I do also feel that the data as presented already present a compelling and interesting story.Great paper! Looking forward to seeing it in print.Reviewer #2: Coinfection can modulate viral replication. The authors of this study had previously shown that this was the case for an avian influenza virus, A/guinea fowl/Hong Kong/WF10/99(H9N2) (GFHK99), that was attenuated in mammalian cells and was therefore reliant on the replication boost that came from coinfection. In this follow-on study they seek to understand the mechanism behind this. They map the determinant of attenuation to residue 26 of the viral proteins PA and PA-X, and showed that as the deletion of PA-X did not affect attenuation the primary affect would be in PA. In PA the residue is in the endonuclease domain, and endonuclease ‘up’ mutations at this site also help the virus to overcome the effects of baloxivir marboxil. Both for host-dependent and drug-dependent restriction, more restriction correlates with a greater need for coinfection, which the authors propose is due to achieving a critical level of transcripts in the infected cell.The experimental work was generally convincing and well-described and the paper clearly written. I found the framing to be a little unexpected – mapping what appears to be a new (if currently rare) host determinant for influenza is interesting and rather underplayed, whereas the framing of the paper as a ‘rare mechanistic insight’ seems a bit overstated. The main finding (which is important on its own terms) seems to be that *any* mechanism that attenuates the virus would lead to an increased reliance on coinfection. This seems important conceptually rather than mechanistically (it could occur through many mechanisms, as indeed it does in this paper and as the authors note in line 307). As a mechanism of PA endonuclease attenuation the paper is really not very detailed, but as a concept the connection between attenuation and coinfection it is important – do the authors think that antiviral treatment might increase the risk of novel viruses emerging through reassortment, for example?**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: 1. Representative (or if possible all) flow cytometry data should be shown to show gating schema.Reviewer #2: On an experimental note, I am a bit concerned by the way in which MOI was measured – if PA activity is attenuated, HA positivity above a threshold may no longer be a reliable read-out for infection. It would be good to see additional data confirming that for MOIs of GFHK99 and the authors are MaMN99 the authors are in fact comparing like with like.I also liked the insistence on single cycle infections (line 83) and the method used to achieve this (line 384). However, as the authors note spill-over multi-cycle infections would distort the interpretation of the data, so it would be nice to see data showing that this method for limiting infections to a single cycle is robust.**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: 1. As above, a measurement of the impact of this variation in avian cell polymerase assays would be of considerable interest if possible.2. Looking at the coinfection frequency, it looks non-saturated (ie the number of particles required to produce an HA+ event is less than the number at which coinfection measurements equal 100%). Given that it is non-saturated, my naïve understanding is that, assuming Poisson kinetics, you can place some kind of estimate on the average # of particles required to produce HA+. This might be a really nice number to share with the field. Not necessary, but would definitely be neat to have some kind of estimate.3. Figure 5 “high” and “low” MOI. The numbers are given in the methods, but why not just write what genome equivalents you are using here in the figure? If not in the figure body, maybe just in the legend?4. The authors, due to their genome-normalized infection schema, also have a genome/HA+ ratio. I definitely think the reliance on coinfection tells a compelling story, but I also think this ratio would be more immediately graspable in addition to the coinfection measurements. It would be nice if this number was presented to contextualize the coinfection data and show the skew of less infectivity per unit virus (with the coinfection data showing this is due to multiple-dose requirements).Reviewer #2: General: While it was nice to use a modelled structure for the endonuclease domain of the virus in question, it would also be interesting to discuss this site in the context of the structures of the polymerase trimer during cap-snatching (albeit this would be the homologous site in a different viral strain). Does this give any more mechanistic explanation about what’s going on here – or if not, does it identify a surface to which an as-yet-unidentified host factor might bind? (Or a known factor, such as the ANP32A binding site - do the authors currently have any thoughts on why this site might be host-type dependent?)Line 10: ‘additional viral templates’ this implies that just adding more vRNA helps, which is an odd mental image – do the authors mean additional RNPs?Line 113: please clarify how this was done to confirm that this mutation did not affect PA (if indeed this was the case)Line 136: ‘viruses displayed similar…’ was there any statistical testing? What does similar mean here?Fig 5G-I: relative to what?Line 243: ‘lowering the efficiency of viral transcription’ this is true, but there is a connected impact on host shut-off that could also be relevantLine 248-9: ‘a positive density dependence’ – a bit more discussion would help here. To what extent is there evidence for (more limited) density dependence with WT viruses? What does it mean that the effect of adding more genomes seems greater when the virus is attenuated? Is it that following infection there is a progression towards a point when the cell is saturated, and that if the kinetics of that initial replication are slower there is more scope for additional genomes to make a difference? I appreciate that this might be speculative without further experimental work, but this is the main model that the paper develops and it would be useful to explore its implications in more depth here.Line 280: The caveats about BXA are probably necessary, but a bit lengthy – I don’t think it’s particularly surprising that viral replication can proceed in the presence of an antiviral drug, and indeed all antiviral drugs tend to have a defined IC50.Line 343: ‘minimal’ – define (and briefly outline what the procedures were)Line 348-9: the tag location should be explained more explicitly in a figure or tableLine 384: what is the pH (this is critical)?Typos, etcLine 239: ‘basis for these effects are’ -> ‘basis for these effects is’Line 249: ‘per capita’ – this tends to be used for counting people rather than viruses**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: Yes: Edward HutchinsonFigure Files:While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Data Requirements:Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Reproducibility:To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsReferences:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.7 Sep 2022Submitted filename: Response to reviewers_Final.pdfClick here for additional data file.8 Sep 2022Dear Dr. Lowen,We are pleased to inform you that your manuscript 'Beneficial effects of cellular coinfection resolve inefficiency in influenza A virus transcription' has been provisionally accepted for publication in PLOS Pathogens.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Christopher B BrookeGuest EditorPLOS PathogensCarolina LopezSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogens
orcid.org/0000-0002-7699-2064
***********************************************************Reviewer Comments (if any, and for reference):14 Sep 2022Dear Dr. Lowen,We are delighted to inform you that your manuscript, "Beneficial effects of cellular coinfection resolve inefficiency in influenza A virus transcription," has been formally accepted for publication in PLOS Pathogens.We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064
Authors: Eric F Pettersen; Thomas D Goddard; Conrad C Huang; Gregory S Couch; Daniel M Greenblatt; Elaine C Meng; Thomas E Ferrin Journal: J Comput Chem Date: 2004-10 Impact factor: 3.376
Authors: Marianita Santiana; Sourish Ghosh; Brian A Ho; Vignesh Rajasekaran; Wen-Li Du; Yael Mutsafi; Dennise A De Jésus-Diaz; Stanislav V Sosnovtsev; Eric A Levenson; Gabriel I Parra; Peter M Takvorian; Ann Cali; Christopher Bleck; Anastasia N Vlasova; Linda J Saif; John T Patton; Patrizia Lopalco; Angela Corcelli; Kim Y Green; Nihal Altan-Bonnet Journal: Cell Host Microbe Date: 2018-08-08 Impact factor: 21.023
Authors: Lawrence A Kelley; Stefans Mezulis; Christopher M Yates; Mark N Wass; Michael J E Sternberg Journal: Nat Protoc Date: 2015-05-07 Impact factor: 13.491