Chen Zhang1, Han Wang2, Xinhui Yang1, Zi Fu2, Xiuru Ji2, Yifan Shi3, Jie Zhong1, Weiguo Hu4, Youqiong Ye5, Zhengting Wang1, Dalong Ni2. 1. Department of Gastroenterology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200025, P.R. China. 2. Department of Orthopaedics, Shanghai Key Laboratory for Prevention and Treatment of Bone and Joint Diseases, Shanghai Institute of Traumatology and Orthopaedics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China. 3. Department of Endocrine and Metabolic Diseases, Shanghai Institute of Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China. 4. Department of Surgery, Medical Center on Aging of Ruijin Hospital, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China. 5. Shanghai Institute of Immunology, Department of Immunology and Microbiology, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China.
Abstract
Inflammatory bowel disease (IBD) affects millions of people each year. The overproduction of reactive oxygen species (ROS) plays a critical role in the progress of IBD and will be a potential therapeutic target. Here, we synthesize a kind of oral zero-valent-molybdenum nanodots (ZVMNs) for the treatment of IBD by scavenging ROS. These ultrasmall ZVMNs can successfully pass through the gastric acid and then be absorbed by the intestine. It has been verified that ZVMNs can down-regulate the quantity of ROS and reduce colitis in a mouse IBD model without distinct side effects. In addition, RNA sequencing reveals a further mechanism that the ZVMNs can protect colon tissues from oxidative stress by inhibiting the nuclear factor κB signaling pathway and reducing the production of excessive pro-inflammatory factors. Together, the ZVMNs will offer a promising alternative treatment option for patients suffering from IBD.
Inflammatory bowel disease (IBD) affects millions of people each year. The overproduction of reactive oxygen species (ROS) plays a critical role in the progress of IBD and will be a potential therapeutic target. Here, we synthesize a kind of oral zero-valent-molybdenum nanodots (ZVMNs) for the treatment of IBD by scavenging ROS. These ultrasmall ZVMNs can successfully pass through the gastric acid and then be absorbed by the intestine. It has been verified that ZVMNs can down-regulate the quantity of ROS and reduce colitis in a mouse IBD model without distinct side effects. In addition, RNA sequencing reveals a further mechanism that the ZVMNs can protect colon tissues from oxidative stress by inhibiting the nuclear factor κB signaling pathway and reducing the production of excessive pro-inflammatory factors. Together, the ZVMNs will offer a promising alternative treatment option for patients suffering from IBD.
Inflammatory bowel disease (IBD) is a nonspecific chronic inflammatory disease that affects certain segments of the gastrointestinal tract and often causes extraintestinal complications (). Approximately 6.8 million cases of IBD have been reported in 2017, and the incidence and prevalence of IBD are increasing worldwide, which brings a huge challenge to the health care system (–). Although some anti-inflammatory agents, immunosuppressants, and biologic agents such as infliximab and adalimumab have been used for IBD treatment in clinic, long-term use of these drugs will lead to a series of side effects including autoimmune responses, viral infection, and tumorigenesis (–). Therefore, it is urgent to explore more effective and suitable treatment for the therapy of IBD.Despite the complicated and poorly understood pathogenesis of IBD, many studies have pointed out that reactive oxygen species (ROS) play an important role in the progress of IBD (, ). ROS up-regulation has been observed in colitis tissues of patients with IBD and murine colitis models, which eventually contributes to the intestinal mucosa injury (–). First, pro-inflammatory cytokines can activate immune cells and amplify both inflammation and ROS generation in the occurrence of IBD (, ). Meanwhile, excessive ROS production will further activate the inflammatory/immune response through nuclear factor κB (NF-κB) signal pathway, leading to increased expression and secretion of pro-inflammatory cytokines (–). As a result, high ROS exposure gives rise to oxidative damage to mitochondria and consequently induces apoptosis of intestinal epithelial cells (IECs) (–). Therefore, scavenging the ROS in the gut is necessary to halt IBD progression. Unfortunately, several nonenzymatic and enzymatic antioxidants currently are not efficient, and many of them will cause undesirable immunological response (, ). A few trials have shown that the curative effect of natural antioxidants such as vitamin E, vitamin C, and coenzyme Q was not impressive (). In addition, it is reported that the ROS scavenger N-acetyl cysteine potentiated the generation of T helper 17 (TH17) cells (TH cells) in vivo in a Misshapen/NIK-related kinase 1-dependent manner and increased the risk of promoting autoimmune inflammatory diseases (). Hence, it is of great significance to develop novel antioxidants to overcome these limitations.Recently, Mo-based nanomaterials such as MoS2 and phosphomolybdate have achieved much attention in the area of antioxidants because of their favorable biocompatibility and effective antioxidant properties (–). For example, our group has reported that the molybdenum-based polyoxometalate nanoclusters could act as antioxidants for acute kidney injury repair with favorable ROS scavenging capability and biocompatibility (). Here, we synthesize a new kind of oral zero-valent-molybdenum nanodots (ZVMNs) through mechanical stripping for IBD treatment. Because of the high stability in an acidic environment, ZVMNs can be taken orally and accumulate in the gut. Because of the strong reducing action of zero-valent-molybdenum atoms, ZVMNs can effectively scavenge ROS and remodel the inflammatory microenvironment in dextran sulfate sodium (DSS)–induced IBD murine models. Both in vitro and in vivo experiments confirm the therapeutic effect of the ZVMNs. Moreover, the related molecular mechanisms are observed by RNA sequencing (RNA-seq) and 16S RNA-seq. We believe that this research will open up new perspectives for the treatments of IBD.
RESULTS AND DISCUSSIONS
Synthesis and characterization of ZVMNs
ZVMNs were synthesized by mechanical exfoliation of the mixture of Mo powder and isopropanol. Transmission electron microscopy (TEM) image showed that the size of the as-prepared ZVMNs was about 3 nm (Fig. 1A). The x-ray diffraction (XRD) pattern of Mo powder was the same as the standard powder diffraction file (Fig. 1B). However, after mechanical exfoliation, there were no obvious peaks in the ZVMNs, indicating the super small particle size of ZVMNs, which may promote the reaction rate (Fig. 1B). Next, the reaction between ZVMNs and ROS was characterized by using H2O2 on behalf of ROS. The solution of ZVMNs was bluish violet, while after oxidation, the products were colorless (fig. S1). The XRD pattern showed that the products were between MoO3 and MoO3·H2O (Fig. 1C). The peak spread of XRD and TEM image showed that the size of products was rather small (fig. S2). The increased binding energy of Mo 3d orbital of products in x-ray photoelectron spectroscopy (XPS) proved the raised valence state of Mo (Fig. 1D). Hence, these products were called hexavalent-molybdenum nanoparticles (HVMNs).
Fig. 1.
Characterization of ZVMNs.
(A) TEM images of ZVMNs. (B) XRD pattern of ZVMNs and Mo powder. (C) XRD pattern of hexavalent-molybdenum nanoparticles (HVMNs). (D) XPS spectra of Mo 3d of ZVMNs and HVMNs. R space of Mo K-edge x-ray absorption fine structure (EXAFS) of (E) ZVMNs and (F) HVMNs. Wavelet transform of EXAFS of (G) ZVMNs and (H) HVMNs. (I) Ability of ZVMNs to scavenge H2O2 at different concentrations (n = 5, means ± SD). (J) Zeta potential of ZVMNs in water and HCl solutions. (K) Hydrated radius of ZVMNs in water and HCl solutions. (L) Photographs of ZVMNs in water and HCl solutions.
Characterization of ZVMNs.
(A) TEM images of ZVMNs. (B) XRD pattern of ZVMNs and Mo powder. (C) XRD pattern of hexavalent-molybdenum nanoparticles (HVMNs). (D) XPS spectra of Mo 3d of ZVMNs and HVMNs. R space of Mo K-edge x-ray absorption fine structure (EXAFS) of (E) ZVMNs and (F) HVMNs. Wavelet transform of EXAFS of (G) ZVMNs and (H) HVMNs. (I) Ability of ZVMNs to scavenge H2O2 at different concentrations (n = 5, means ± SD). (J) Zeta potential of ZVMNs in water and HCl solutions. (K) Hydrated radius of ZVMNs in water and HCl solutions. (L) Photographs of ZVMNs in water and HCl solutions.Mo K-edge–extended x-ray absorption fine structure (EXAFS) was further carried out to analyze the structure of ZVMNs and HVMNs. Through comparison with standard sample, ZVMNs had major Mo─O bonds but few Mo─Mo bonds (Fig. 1E and fig. S3, A and B). HVMNs also had major Mo─O bonds (Fig. 1F and fig. S3B), and the fitted coordination number (table S1) was similar to ZVMNs. Wavelet transform of EXAFS provided more information about the difference between ZVMNs and HVMNs. As shown in Fig. 1 (G and H), most coordinate atoms in ZVMNs were located farther than that in HVMNs, indicating ZVMNs had a looser structure. On the basis of the above data, we supposed that ZVMNs consisted of loosely assembled monatomic Mo with O-containing ligands (such as hydroxyl and H2O), and HVMNs consisted of closely assembled MoO3 clusters with bound water. Then, the ability of ZVMNs to scavenge H2O2 was detected. As shown in Fig. 1I, ZVMNs could effectively reduce the content of H2O2 in solution. Quantificationally, each Mo atom could scavenge about 0.27 H2O2 molecules. We further measured the ability of ZVMNs to scavenge other kinds of ROS. As shown in fig. S4 (A and B), the ZVMNs exhibited favorable superoxide anions and hydroxyl radicals eliminating efficiencies, further indicating the high ROS scavenging activities of ZVMNs.Last, to clarify whether ZVMNs could be taken orally, the stability of ZVMNs in saline and gastric acid was evaluated. The hydrated radius of ZVMNs in saline showed few differences at 1-, 7-, and 14-day periods (fig. S6A), indicating the stability of ZVMNs in saline. Diluted HCl solutions (pH 1.5) were applied to simulated gastric acid. Because of the abundant H+, zeta potential of ZVMNs in HCl solutions decreased in half compared with that in water (Fig. 1J), leading to increased hydrated radius (Fig. 1K). Nevertheless, the TEM image showed the aggregation of ZVMNs rather than dissolution in HCl solutions (fig. S5). In addition, the hydrated radius of ZVMNs showed few differences at 1-, 7-, and 14-day periods (fig. S6B), and the color did not change (Fig. 1L), further indicating that ZVMNs could stay stable in HCl solutions. In summary, all these data present the favorable performance of scavenging ROS and the feasibility to be taken orally of ZVMNs.
Biocompatibility assessment of ZVMNs
Cytotoxicity assay kit and cell counting kit–8 (CCK-8) assessment and the staining of living and dead cells were performed to detect the biocompatibility of the ZVMNs in vitro. HCT116 cells (human colon cancer cells) and immortalized bone marrow–derived macrophages (iBMDMs) exposed to different concentrations of the ZVMNs for 24 hours exhibited normal cell morphology. Both CCK-8 assay results (figs. S7 and S9A) and calcein/propidium iodide (PI) staining results (fig. S8) indicated that the ZVMNs at test concentrations did not exhibit noticeable cytotoxicity. Moreover, blood routine and biochemistry indexes (fig. S9, B to D) and histopathology assays of the main organs (fig. S10) after ZVMNs administration demonstrated no observable impairments. These results are in accordance with previous findings in literature that the Mo-based nanomaterials are nontoxic at relatively low concentrations (, , ).
ZVMNs protect iBMDM cells from ROS-induced damage
Given the fact that the ZVMNs have strong antioxidative property, their potential capability in scavenging ROS in vitro was measured. A cellular inflammation model was established by treating iBMDMs with lipopolysaccharide (LPS). After LPS stimulation, an ROS-sensitive fluorescent dye, 2′,7′-dichlorofluorescin diacetate (DCFH-DA), was applied to stain the cells. As shown in Fig. 2A, the intracellular green fluorescent signal of iBMDMs increased markedly after treatment with LPS. In contrast, the intracellular ROS level obviously decreased when the iBMDM cells were pretreated with ZVMNs. We further performed the quantitative analysis of intracellular ROS levels via flow cytometry. The results (Fig. 2, B and C) showed that ZVMNs eliminated about 66.7% of intracellular ROS from LPS-treated iBMDM cells, demonstrating the favorable ROS scavenging capability of ZVMNs. To further confirm the anti-inflammatory activity of ZVMNs, the messenger RNA (mRNA) expression levels of inflammatory cytokines stimulated by LPS in the iBMDM cell line were detected. As shown in Fig. 2 (D to F), the levels of interleukin-1β (IL-1β), IL-10, and tumor necrosis factor–α (TNF-α) in the ZVMN-treated group were declined significantly compared to the levels in the LPS group (P < 0.05), indicating that the ZVMNs could relieve inflammation responses in vitro.
Fig. 2.
ZVMNs protect iBMDM cells from ROS-induced damage.
(A) Representative ROS staining (green fluorescence) of iBMDM cell lines under different treatment conditions. Scale bar, 10 μm. (B) ROS levels in untreated and ZVMN-treated iBMDM cell lines incubated with LPS. (C) Statistical analysis of ROS levels in the iBMDM cell lines under different treatment conditions (n = 3, means ± SD). Messenger RNA (mRNA) levels of pro-inflammatory cytokines including interleukin-1β (IL-1β) (D), IL-10 (E), and tumor necrosis factor–α (TNF-α) (F) (n = 3, means ± SD). (G) ECAR reflects the glycolytic flux. (H) OCR indicates mitochondrial respiration (n = 12, means ± SD). Significance between every two groups was calculated using Mann-Whitney U test. *P < 0.1, **P < 0.01, ***P < 0.001, and ****P < 0.0001. 2-DG, 2-Deoxy-Glucose.
ZVMNs protect iBMDM cells from ROS-induced damage.
(A) Representative ROS staining (green fluorescence) of iBMDM cell lines under different treatment conditions. Scale bar, 10 μm. (B) ROS levels in untreated and ZVMN-treated iBMDM cell lines incubated with LPS. (C) Statistical analysis of ROS levels in the iBMDM cell lines under different treatment conditions (n = 3, means ± SD). Messenger RNA (mRNA) levels of pro-inflammatory cytokines including interleukin-1β (IL-1β) (D), IL-10 (E), and tumor necrosis factor–α (TNF-α) (F) (n = 3, means ± SD). (G) ECAR reflects the glycolytic flux. (H) OCR indicates mitochondrial respiration (n = 12, means ± SD). Significance between every two groups was calculated using Mann-Whitney U test. *P < 0.1, **P < 0.01, ***P < 0.001, and ****P < 0.0001. 2-DG, 2-Deoxy-Glucose.Furthermore, metabolic flux analysis using Seahorse technology was performed. The extracellular acidification rate (ECAR) showed significant changes between LPS-stimulated cells and ZVMN-treated cells, indicating that the ZVMNs affected glycolytic function (Fig. 2G). The basal oxygen consumption rate (OCR) showed no changes in basal mitochondrial respiration, but maximal mitochondrial respiration in LPS-stimulated iBMDM cells was found in ZVMN-treated cells (Fig. 2H).
Therapeutic efficacy of ZVMNs in DSS-induced IBD mice model
On the basis of the good ROS scavenging activity of the ZVMNs in vitro, its therapeutic efficacy in vivo was then investigated for the treatment in the DSS-induced C57BL/6 mice IBD model. Mice were orally treated with 2.5% DSS in the drinking water to induce colitis (Fig. 3A). All mice were randomly divided into four groups, including the control group, model group (DSS), 5-aminosalicylic acid (5-ASA) group (DSS + 5-ASA), and ZVMNs treatment group (DSS + ZVMNs). Among them, the 5-ASA group was set as the positive control, which was the first-line drug in IBD treatment but with a risk of relapse and multiple adverse effects. The 5-ASA and ZVMNs were given separately by oral gavage every day. The therapeutic efficacy of the ZVMNs was assessed by measuring the body weight changes, the disease activity index (DAI), colon lengths, and levels of pro-inflammatory cytokines of IL-1, TNF-α, IL-6, and interferon-γ (IFN-γ) in colon tissues and histological analysis of colon sections.
Fig. 3.
Favorable therapeutic Efficacy of ZVMNs in the mice model with DSS-induced colitis.
(A) Experimental design of DSS-induced IBD model mice. The mice were provided with sterile water or water containing 2.5% DSS for 7 days. Oral administration of treatments was given from the second day. All mice were euthanized 1 day after DSS drinking stopped. (B) Macroscopic colon appearance of each group was shown. (C) Colon lengths of mice with indicated treatments on day 8 (n = 6, means ± SD). (D) Representative macroscopic spleen appearance of each group. (E) Spleen weight of mice with indicated treatments was measured and analyzed (n = 6, means ± SD). (F) Daily changes of body weight were recorded in detail every day (n = 6, means ± SD). (G) Everyday DAI scores were recorded and analyzed (n = 6, means ± SD). (H) Representative hematoxylin and eosin (H&E) and MPO histology images of colon tissue of each group. Scale bar, 200 μm. Significance between every two groups was calculated using Mann-Whitney U test. *P < 0.1, ***P < 0.001, and ****P < 0.0001. ns, not significant.
Favorable therapeutic Efficacy of ZVMNs in the mice model with DSS-induced colitis.
(A) Experimental design of DSS-induced IBD model mice. The mice were provided with sterile water or water containing 2.5% DSS for 7 days. Oral administration of treatments was given from the second day. All mice were euthanized 1 day after DSS drinking stopped. (B) Macroscopic colon appearance of each group was shown. (C) Colon lengths of mice with indicated treatments on day 8 (n = 6, means ± SD). (D) Representative macroscopic spleen appearance of each group. (E) Spleen weight of mice with indicated treatments was measured and analyzed (n = 6, means ± SD). (F) Daily changes of body weight were recorded in detail every day (n = 6, means ± SD). (G) Everyday DAI scores were recorded and analyzed (n = 6, means ± SD). (H) Representative hematoxylin and eosin (H&E) and MPO histology images of colon tissue of each group. Scale bar, 200 μm. Significance between every two groups was calculated using Mann-Whitney U test. *P < 0.1, ***P < 0.001, and ****P < 0.0001. ns, not significant.Compared with the DSS group, the DSS + ZVMN–treated group showed a longer colon length (P < 0.0001; Fig. 3, B and C), lighter spleen weight (P < 0.001; Fig. 3, D and E), heavier body weight (P < 0.001; Fig. 3F), and lower DAI (P < 0.0001; Fig. 3G). These results indicate the significant therapeutic effect of the ZVMNs on mice with DSS-induced colitis. In the histological analysis, mice with colitis showed severe destruction of crypts, massive infiltrations of immune cells, and severe colonic epithelial damage in the inflamed colon, while nearly normal histological microstructure and less inflammatory cell infiltration were observed in DSS + ZVMNs group. The myeloperoxidase (MPO)–positive neutrophils were significantly augmented in the colon tissue of the DSS group (Fig. 3H), and the ZVMNs markedly reduced its congregation, further verifying that the ZVMNs successfully could relieve the disease states of IBD.
Therapeutic mechanisms of ZVMNs on IBD
To further elucidate the therapeutic mechanism of the ZVMNs to IBD, RNA-seq of colonic tissues of mice was performed. An unguided principal components analysis (PCA) of the data revealed substantially different transcriptomic profiles among the control group, DSS group, and DSS + ZVMNs group (fig. S11). Volcano plots showed that 3229 genes are up-regulated, and 2818 genes were down-regulated in DSS-induced colitis mice compared to the control group. While 2550 genes were up-regulated, and 1863 genes were down-regulated after the ZVMNs treatment (Fig. 4A). Among the up-regulated and down-regulated genes, there were 1731 genes and 1234 genes overlapped between those two sets of comparison, respectively, which could be attributed to the presence of inflammation (Fig. 4B).
Fig. 4.
RNA-seq analysis of DSS-induced colitis regulated by ZVMNs.
(A) Volcano plot exhibiting the differentially expressed genes (fold change > 1.5; P adjust < 0.05; up-regulated genes: red; down-regulated genes: blue) in the DSS group compared to the control group (left) and in the DSS group versus the ZVMN-treated group (right) from RNA-seq data. (B) Venn diagram of RNA-seq analysis showing significantly up-regulated (bottom) or down-regulated (top) genes in the DSS group compared to the control group and in the DSS group versus the ZVMN-treated group. (C) Gene set enrichment analysis of response to ROS genes between different conditions. NES, normalized enrichment score. (D) Heatmap from RNA-seq analysis indicating the response to ROS-related genes in the control group or DSS group and ZVMN-treated group (fold change in the right). (E) KEGG pathways enriched the up-regulated genes in the DSS group compared to the control group (left) and in the DSS group versus the ZVMN-treated group (right). JAK-STAT, Janus kinase–signal transducers and activators of transcription; PD-L1, programmed cell death ligand 1; PD-1, programmed cell death protein 1; NOD, nonobese diabetic; MAPK, mitogen-activated protein kinase. AGE-RAGE, Advanced Glycation End products-the Receptor of Advanced Glycation End products.
RNA-seq analysis of DSS-induced colitis regulated by ZVMNs.
(A) Volcano plot exhibiting the differentially expressed genes (fold change > 1.5; P adjust < 0.05; up-regulated genes: red; down-regulated genes: blue) in the DSS group compared to the control group (left) and in the DSS group versus the ZVMN-treated group (right) from RNA-seq data. (B) Venn diagram of RNA-seq analysis showing significantly up-regulated (bottom) or down-regulated (top) genes in the DSS group compared to the control group and in the DSS group versus the ZVMN-treated group. (C) Gene set enrichment analysis of response to ROS genes between different conditions. NES, normalized enrichment score. (D) Heatmap from RNA-seq analysis indicating the response to ROS-related genes in the control group or DSS group and ZVMN-treated group (fold change in the right). (E) KEGG pathways enriched the up-regulated genes in the DSS group compared to the control group (left) and in the DSS group versus the ZVMN-treated group (right). JAK-STAT, Janus kinase–signal transducers and activators of transcription; PD-L1, programmed cell death ligand 1; PD-1, programmed cell death protein 1; NOD, nonobese diabetic; MAPK, mitogen-activated protein kinase. AGE-RAGE, Advanced Glycation End products-the Receptor of Advanced Glycation End products.Similarly, among the top ranking up-regulated signaling pathways (hypergeometric tests, P < 0.05), 15 overlapped signaling pathways were revealed in the comparison of colonic sections after the ZVMNs treatment in the colitis mice, according to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis (fig. S12). Gene set enrichment analysis (GSEA) revealed that the up-regulated genes of response to ROS are significantly enriched in the DSS group (Fig. 4C), which were decreased to normal level under ZVMNs treatment. As a further analysis, the normalized heatmap showed that the gene signature of response to ROS was predominantly decreased in IBD mice after the ZVMNs treatment (Fig. 4D). Functional pathway enrichment analysis displayed that the TNF signaling pathway, IL-17 signaling pathway, chemokine signaling pathway, and NF-κB signaling pathway are highly associated with the therapeutic mechanisms of the ZVMNs (Fig. 4E). Literature has reported that ROS could promote the production of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6. TNF-α could further trigger a strong cascade inflammatory response throughout the TNF-α/NF-κB signaling pathways, resulting in an excessive inflammation response in IBD (). Consistently, the above results indicated that the ZVMNs could reduce colitis in mice via inhibiting the NF-κB signaling pathway through decreasing the ROS level.To further confirm the therapeutic mechanisms of ZVMNs in vivo, we first detected the ROS levels in the colonic mucosa by using dihydroethidium (DHE) staining. The green staining was positive for ROS content. As shown in Fig. 5A, the ROS level in ZVMN-treated IBD mice was similar to that of healthy mice, indicating that the ZVMNs could function as antioxidants to scavenge ROS in vivo. Besides, as we know, the mitochondria are the central organelles in energy metabolism and are exposed to ROS. Excess ROS generation leads to lower ATP production, suppression of the intracellular electron transport chain, and DNA damage in mitochondria (, , ). However, we found that there was no significant difference in mitochondrial DNA (mtDNA) between the three groups (control group, DSS group, and DSS + ZVMNs group) (fig. S13), which was probably due to the short modeling period.
Fig. 5.
Therapeutic mechanisms of the ZVMNs on IBD.
(A) Representative ROS staining (green fluorescence) of colon tissues of each group by DHE. Scale bar, 500 μm. (B) Western blot analysis of the expression of phospho–NF-κB p65 (P-NF-κB p65), total NF-κB p65, phospho–IκB-α (P-IκB p65), and total IκB-α in colon tissues of DSS-induced colitis mice. Colonic mRNA levels of IFN-γ (C), IL-6 (D), IL-1β (E), TNF-α (F), and IL-10 (G) (n = 6, means ± SD). Significance between every two groups was calculated using Mann-Whitney U test. **P < 0.01, ***P < 0.001, and ****P < 0.0001. IκB, inhibitor of NF-κB.
Therapeutic mechanisms of the ZVMNs on IBD.
(A) Representative ROS staining (green fluorescence) of colon tissues of each group by DHE. Scale bar, 500 μm. (B) Western blot analysis of the expression of phospho–NF-κB p65 (P-NF-κB p65), total NF-κB p65, phospho–IκB-α (P-IκB p65), and total IκB-α in colon tissues of DSS-induced colitis mice. Colonic mRNA levels of IFN-γ (C), IL-6 (D), IL-1β (E), TNF-α (F), and IL-10 (G) (n = 6, means ± SD). Significance between every two groups was calculated using Mann-Whitney U test. **P < 0.01, ***P < 0.001, and ****P < 0.0001. IκB, inhibitor of NF-κB.Next, we validated the effects of the ZVMNs on the key proteins in the NF-κB signaling pathway, including NF-κB, phosphorylation of NF-κB, inhibitor of NF-κB (IκB), and phosphorylation of IκB. Western blotting of colon tissues was performed. As shown in Fig. 5B, the phosphorylation of NF-κB and IκB were significantly enhanced in the DSS-induced colitis mice, indicating the activation of NF-κB signaling pathway in IBD. While the phosphorylation of NF-κB and IκB was significantly decreased in the ZVMN-treated group, indicating that the ZVMNs could inhibit NF-κB signaling pathway, in accordance with the RNA-seq analysis result. The downstream inflammatory factors of the NF-κB signaling pathway were also detected. The mRNA expression of pro-inflammatory cytokines in the colonic mucosa was measured, including IFN-γ, IL-6, IL-1β, TNF-α, and IL-10, which played important roles in the pathologies of IBD (Fig. 5, C to G). Compared to the control group, these cytokines are highly increased in IBD group but significantly reduced in the ZVMN treatment group, which was consistent with our findings in vitro. According to the previous research, IL-1β is oversecreted because of the increased activity of the NOD-like receptor thermal protein domain associated protein 3, NLRP3 inflammasome on the development of IBD. Meanwhile, IL-1β can also stimulate the release of ROS by neutrophils, which will further increase TNF-α synthesis (, ). IL-6 and IFN-γ are also main pro-inflammatory cytokines activating immune cells. In patients with IBD, levels of IL-6 and IFN-γ will increase and mediate the activation of T cells, which eventually aggravate the intestinal inflammation (). In summary, the production of IL-1β, IL-6, IFN-γ and TNF-α by immune cells and IECs presented the key pro-inflammatory events in the initiation of IBD, while a markedly reduction in the inflammatory cytokines was observed, proving the efficacy of the ZVMNs.Besides, it is widely known that the perturbation of intestinal microbiota is densely associated with IBD onset and exacerbation (). The intestinal microbiota has been identified as a large source of pro-oxidants (). Excessive production of ROS could also result in the gut barrier dysfunction and the expansion of potentially harmful bacteria such as facultative anaerobic bacteria (). Now, targeting gut microbiota dysbiosis and overly intestinal inflammation with dietary or microbial interventions—such as the applications of probiotics, antibiotics, defined enteral nutritional therapy (ENT), and fecal microbiota transplantation—have become attractive strategies for IBD treatment (). To date, several studies have shown that microbial interventions could improve the disease severity. Nevertheless, part of these studies are not always repeatable. In addition, the gut microbiota varies greatly among individuals, targeting gut microbiota does not always bring benefits. For example, ENT has been reported to be associated with rapid changes in gut microbiota composition that could lead to even greater dysbiosis relative to healthy individuals (). Thus, to explore whether the ZVMNs affect the composition or abundance of gut microbiota, 16S ribosomal RNA-seq (rRNA-seq) technology was carried out to analyze the changes of mice enterobacterial composition. The results showed no significant difference in alpha diversity between the three groups (control group, DSS group, and DSS + ZVMNs group) (figs. S14 and S15). Principal Co-ordinates analysis (PCOA) indicated that the treatment of ZVMNs partly altered the composition of microflora in mice with colitis (fig. S16). Further investigation should be carried out in the future to clarify the effect of ZVMNs on the gut microbiota.IBD is a refractory chronic inflammatory disease, which has a close connection with excess ROS production. In this research, we have developed ZVMNs with the capability of antioxidant to treat IBD via oral administration. With IECs markedly impaired by IBD, oral administration could provide fast access to the inflamed region and avoid the inconvenience of injections and the associated pain. Then, ZVMNs can accumulate at the inflammatory site, scavenge the overproduced ROS, and repair the enlarging tight junctions and the increasing permeability. Combined with the good biocompatibility of ZVMNs, these features will facilitate the application of ZVMNs in clinic.The as-prepared ZVMNs with ultrasmall particle size exhibited good physiological stability especially in gastric acid, favorable biosafety, and significant ROS scavenging abilities. The structure of ZVMNs and their interaction with ROS has been clarified by XRD, XPS, and EXAFS. Both in vitro and in vivo experiments demonstrated the favorable therapeutic effects of the ZVMNs for IBD. RNA-seq revealed a potential mechanism that the ZVMNs could protect colon tissues from oxidative stress by inhibiting the NF-κB signaling pathway and reducing the production of excessive pro-inflammatory factors (Fig. 6). In addition, under laboratory conditions, one ultrasonic disrupter can produce about 300 mg of ZVMNs [or 300 ml of 1000–parts per million (ppm) ZVMNs solution] each day. Higher ultrasonic power and more ultrasonic disrupters will bring higher yield of ZVMNs. The cost of ZVMNs is about $5/g in consideration of the recycled raw materials (Mo powder and isopropanol), energy charge, and the abrasion of the ultrasonic amplitude transformer. Hence, ZVMNs have much potential for industrial production. We believe that our findings will provide a potential alternative treatment option for patients with IBD.
Fig. 6.
Schematic illustration of ZVMNs in the treatment of IBD.
The ZVMNs protect colon tissues from oxidative stress by inhibiting the NF-κB signaling pathway and reducing the production of excessive pro-inflammatory factors.
Schematic illustration of ZVMNs in the treatment of IBD.
The ZVMNs protect colon tissues from oxidative stress by inhibiting the NF-κB signaling pathway and reducing the production of excessive pro-inflammatory factors.
MATERIALS AND METHODS
Experimental apparatus
TEM image was carried out by FEI Talos F200X. XRD was measured by Rigaku D/Max 2250 V. Dynamic light scattering was measured by Malvern Zetasizer Nano S. XPS spectra were measured by Thermo Fisher Scientific ESCALAB 250Xi. Confocal laser scanning microscopy was carried out on Leica TCS SP8 STED 3X. The content of Mo was measured by inductively coupled plasma optical emission spectrometry (Agilent 725). The fluorescence microplate system was TECAN Spark. Mechanical exfoliation was carried out by an ultrasonic disrupter (Scientz JY92-IIN). Hydroxyl radicals were generated by Varian Clinac 21EX (Trilogy). The data of EXAFS were collected at the beamline of TPS44A1 in the National Synchrotron Radiation Research Center. For wavelet transform analysis, χ(k) exported from Athena was imported into the HAMA FORTRAN code. The parameters were listed as follow: R range, 0 to 6 Å; k range, 0 to 13.9 Å−1; k weight, 3; and Morlet function with κ = 10, σ = 1 was used as the mother wavelet to provide the overall distribution.
Reagents
Mo powder, isopropanol, 5-ASA, salicylic acid, and sodium chloride were purchased from Macklin. Phosphate-buffered saline (PBS), Dulbecco’s modified Eagle’s medium (DMEM), and fetal bovine serum (FBS) were obtained from Gibco. Streptomycin and penicillin were obtained from Adamas.
Synthesis of ZVMNs
ZVMNs were synthesized by mechanical exfoliation (450 W, 75% duty cycle, 20 hours) of the mixture of 3 g of Mo powder and 50 ml of isopropanol. The supernatant was taken out, and the isopropanol was removed by a rotary evaporator. At last, the as-prepared ZVMNs were dispersed in deionized water.
Cell culture
HCT116 cell line and mice iBMDMs were cultured in DMEM supplemented with 10% FBS, streptomycin (100 μg/ml), and penicillin (100 U/ml) at 37°C in an incubator supplied with a humidified atmosphere of 5% CO2.
Cell viability
HCT116 cells and iBMDMs were seeded at 5 × 103 cells per well in 96-well plates. After 1 day, cells were cocultured with different concentrations of nanomaterials. The cell viability was tested by using a CCK-8 kit (Dojindo Laboratories) or calcein/PI cell viability/cytotoxicity assay kit (Beyotime). By incubating the CCK-8 reagent with HCT116 cells and iBMDMs for 2 hours, the live cells reacting with the reagent can be detected by a microplate reader. After incubating with the calcein/PI buffer for 30 min, the live or dead cells can be observed under a fluorescent microscope.
Quantitative reverse transcription PCR
To assess the anti-inflammatory effect, iBMDM cells were seeded into six-well plates, which were stimulated by LPS (1 μg/ml) and then incubated with 50-ppm ZVMNs. The total RNA of cell and mice colon tissue was extracted by TRIzol reagent (Takara) and then transcribed into cDNA by the Hifair II First Strand cDNA Synthesis Kit (Yeasen). Next, quantitative polymerase chain reaction (qPCR) was performed using Hieff qPCR SYBR Green Master Mix (Yeasen) on LightCycler 480 Instrument II (Roche). The following qPCR conditions were used: 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s. A comparative threshold cycle method was used to analyze the qPCR data, where the amount of target was normalized to the endogenous reference of β-actin in each sample. The primer sequences used were as follows: β-actin (forward: CGTTGACATCCGTAAAGACC; reverse: TAGGAGCCAGAGCAGTAATC), IL-10 (forward: CAGGGATCTTAGCTAACGGAAA; reverse: GCTCAGTGAATAAATAGAATGGGAAC), TNF-α1 (forward: CAGGCGGTGCCTATGTCTC; reverse: CGATCACCCCGAAGTTCAGTAG), IL-1β (forward: TTCAGGCAGGCAGTATCACTC; reverse: GAAGGTCCACGGGAAAGACAC), IL-6 (forward: CTGCAAGAGACTTCCATCCAG; reverse: AGTGGTATAGACAGGTCTGTTGG), and IFN-γ (forward: GCCACGGCACAGTCATTGA; reverse: TGCTGATGGCCTGATTGTCTT).
DSS-induced colitis mouse model
All the experiments in vivo were approved by the Animal Ethics Committee of Shanghai Jiao Tong University, and the ethics number was B-2021-009. Six-week-old male C57BL/6 mice were housed in groups of six mice per cage and acclimatized for 1 week before inclusion in the study. Mice were randomly divided into four groups, including the normal control group, DSS-induced colitis group, DSS-induced colitis treated with the 5-ASA group, and the DSS-induced colitis treated with the ZVMNs group. Mice with colitis were induced by DSS (2.5 weight %, molecular weight: 36,000 to 50,000; MP Biomedicals) added in the drinking water for 7 days. The 5-ASA (50 mg/kg) and ZVMNs (4 mg/kg) were given daily by oral gavage. During the period, weight loss, stool consistency, and fecal blood of mice were evaluated daily to determine the DAI. On day 8, all mice were euthanized under isoflurane anesthesia and the colon, spleen, liver, lung, kidney, and heart were collected for further analysis.
Biocompatibility in vivo
The healthy mice were divided into three groups randomly. ZVMNs (4 mg/kg) were taken via oral administration into healthy mice of two groups. The other one group served as the control group. After ZVMNs oral administration of different times (7 and 30 days), the mice were euthanized. The blood of mice was collected for serum biochemistry tests and blood routine index tests.
Histological analysis
For histological analyses, the colon, spleen, liver, lung, kidney, and heart were fixed with paraformaldehyde (4% in PBS), embedded in paraffin wax, stained with hematoxylin and eosin, and analyzed by microscopy. For immunohistochemistry, tissue sections were deparaffinized, rehydrated, and rinsed, followed by antigen retrieval and blocking. Next, the tissue sections were incubated with anti-MPO (Abcam) prepared in 5% goat serum overnight in a moist chamber and then the Alexa Fluor–conjugated secondary antibody. After that, the tissue sections were observed under the fluorescence microscope. ROS staining was performed using a ROS staining kit (Beyotime) following the manufacturer’s protocol. A 0.5-cm-long colon section taken 1 cm from the anus was used to make frozen sections. Prepared colon sections were then incubated with DHE for 30 min at 37°C. After washing, colon sections were then incubated with 4′,6-diamidino-2-phenylindole (DAPI) solution at room temperature for 10 min to accomplish DAPI counterstain. Last, ROS staining was observed under a fluorescence microscope.
ROS scavenging in solution
The content of H2O2, superoxide anions, and hydroxyl radicals were measured by a hydrogen peroxide assay kit (Beyotime), total superoxide dismutase assay kit with nitroblue tetrazolium (Beyotime), and salicylic acid, respectively. Different concentrations of ZVMNs (0, 10, 20, 30, and 40 ppm) were applied to scavenge H2O2 (about 100 μM), superoxide anions (xanthine/xanthine oxidase), and hydroxyl radicals (10-gray x-rays). The content of H2O2, superoxide anions, and hydroxyl radicals was measured by the absorption at 560, 560, and 510 nm, respectively.
ROS scavenging in vitro
iBMDM cells were seeded into six-well plates, and the cells were stimulated by LPS (1 μg/ml) and then incubated with 50-ppm ZVMNs. DCFH-DA (Sigma-Aldrich), an oxidation-sensitive fluorescent dye, was used to detect the intracellular ROS level according to the previous literature. After the aforementioned incubation with LPS for 6 hours, cells were gently rinsed with serum-free medium, and then 10 μM DCFH-DA was added to the cells and incubated in dark at 37°C for 30 min. Afterward, the cells were washed with serum-free medium thrice to remove unloaded DCFH-DA probe, then were imaged using a laser confocal microscope, and were subjected to a flow cytometry analysis to quantify the intracellular ROS levels, respectively.
Western blot
The total proteins from colon tissue were extracted using radioimmunoprecipitation assay lysis buffer containing phosphatase and protease inhibitor. Bicinchoninic acid protein assay kit was used to determine the concentrations of extracted proteins. Eight percent of SDS-PAGE gel was prepared for an equal amount of protein from each sample to run and then transferred to polyvinylidene difluoride (PVDF) membranes. PVDF membranes were blocked with 5% skim milk and incubated with primary antibodies (including NF-κB p65, phospho–NF-κB p65, IκB-α, phospho-IκB-α, and β-actin) at 4°C overnight, followed by incubation with secondary horseradish peroxidase–conjugated antibodies for 1 hour at room temperature.
Seahorse analysis
To perform real-time ECAR and OCR analyses, iBMDMs were analyzed using the Seahorse XF24 Analyzer from Agilent Technologies by Mito Stress Test Kit or Glycolysis Stress Test Kit according to the manufacturer’s instructions. A total of 40,000 cells were used in each assay with n = 12 replicates in three independent experiments.
RNA-seq analysis
C57BL/6 mice were euthanized to collect the frozen colon sections. The total RNA of samples was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions, and genomic DNA was removed using deoxyribonuclease I. Then, RNA quality was analyzed by 2100 Bioanalyzer (Agilent) and quantified by the NanoDrop Technologies. Only a high-quality RNA sample was used to construct the sequencing library. The isolation of the desired RNA molecules, reverse transcription of RNA to cDNA, amplification of primed cDNA molecules, and sequencing were performed at Majorbio Bio-Pharm Biotechnology Co. Ltd. using Illumina HiSeq X10 (Illumina) according to the manufacturer’s instructions. For bioinformatics analysis, the expression level of each transcript was calculated according to the fragments per kilobase of exon per million mapped reads method. HTSeq was used to count the read numbers mapped to each gene. Data analysis was performed using R software (R Foundation for Statistical Computing). The DESeq2 was used to normalize the raw counts and identify differentially expressed genes (|fold change| ≥ 1.5; false discovery rate < 0.05) and generate the principal component plot. Gene Ontology enrichment analysis was performed by R package cluster Profiler, where the differentially expressed genes identified as described above were supplied as the input for genes by function enriched KEGG. Hypergeometric tests were used to calculate P values, which were then subjected to multiple testing adjustments by Benjamini-Hochberg correction. GSEA was performed to test whether interesting gene sets are substantially enriched in corresponding conditions. Besides, protein-protein interactions of genes were analyzed by the Search Tool for the Retrieval of Interacting Genes/Proteins algorithm (www.string-db.org/). The Cytoscape software was used to screen for hub genes according to degrees.
Microbiome analysis
Feces of each mouse were collected separately on day 8 and stored at −20°C. Total genomic DNA was extracted by using the E.Z.N.A. soil DNA Kit (Omega Bio-Tek, Norcross, GA, USA). The bacterial 16S rRNA gene (V3-V4 region) was amplified using the primer pairs 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) in an ABI GeneAmp 9700 PCR thermocycler (ABI). Microbiota composition was determined on Illumina MiSeq platform (Illumina) according to the standard protocols from Majorbio Bio-Pharm Technology Co. Ltd. Operational taxonomic units (OTUs) were clustered in UPARSE (version 7.1) and the taxonomy of each OTU representative sequence was analyzed by RDP Classifier. All data were lastly analyzed on the Majorbio Biocloud platform.
Statistical analysis
Statistical analyses were conducted using SPSS software version 19.0 (IBM) and GraphPad Prism 9.0 (GraphPad). Quantitative variables are expressed as means ± SD or median, whereas categorical variables are expressed as numbers and percentages. The Mann-Whitney U test and analysis of variance (ANOVA) were used to compare the differences in two or more groups when appropriate. P < 0.05 was considered statistically significant.
Authors: Alexandra Petruş; Oana M Duicu; Adrian Sturza; Lavinia Noveanu; Loránd Kiss; Maria Dănilă; István Baczkó; Danina M Muntean; Norbert Jost Journal: Can J Physiol Pharmacol Date: 2015-06-30 Impact factor: 2.273
Authors: Jeremy N Myers; Michael W Schäffer; Olga Y Korolkova; Amanda D Williams; Pandu R Gangula; Amosy E M'Koma Journal: Inflamm Bowel Dis Date: 2014-09 Impact factor: 7.290