| Literature DB >> 36110310 |
Cong Jiang1, Changwen Ye2, Yongfeng Liu3, Kuo Huang2, Xuedeng Jiang1, Dian Zou1, Lu Li4, Wenyuan Han1, Xuetuan Wei1.
Abstract
Alkaline protease has been widely applied in food, medicine, environmental protection and other industrial fields. However, the current activity and yield of alkaline protease cannot meet the demand. Therefore, it is important to identify new alkaline proteases with high activity. In this study, we cloned a potential alkaline protease gene bsp-1 from a Bacillus subtilis strain isolated in our laboratory. BSP-1 shows the highest sequence similarity to subtilisin NAT (S51909) from B. subtilis natto. Then, we expressed BSP-1 in Bacillus amyloliquefaciens BAX-9 and analyzed the protein expression level under a collection of promoters. The results show that the P43 promoter resulted in the highest transcription level, protein level and enzyme activity. Finally, we obtained a maximum activity of 524.12 U/mL using the P43 promoter after fermentation medium optimization. In conclusion, this study identified an alkaline protease gene bsp-1 from B. subtilis and provided a new method for high-efficiency alkaline protease expression in B. amyloliquefaciens.Entities:
Keywords: alkaline protease; bacillus amyloliquefaciens; fermentation optimization; promoter screening; recombinant expression
Year: 2022 PMID: 36110310 PMCID: PMC9468883 DOI: 10.3389/fbioe.2022.977215
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Strains and plasmids used in this study.
| Strains | Characteristics | Source |
|---|---|---|
| BAX-9 |
| Stored in lab |
| BAX-9/pHY-300 | BAX-9 harboring the plasmid pHY300PLK | Stored in lab |
| BAX-9/pHY-Psra/BSP-1 | BAX-9 harboring the plasmid pHY-Psra/BSP-1 | This study |
| BAX-9/pHY-Psrs/BSP-1 | BAX-9 harboring the plasmid pHY-Psrs/BSP-1 | This study |
| BAX-9/pHY-PrnpB/BSP-1 | BAX-9 harboring the plasmid pHY-PrnpB/BSP-1 | This study |
| BAX-9/pHY-Pffs/BSP-1 | BAX-9 harboring the plasmid pHY-Pffs/BSP-1 | This study |
| BAX-9/pHY-Phyp/BSP-1 | BAX-9 harboring the plasmid pHY-Phyp/BSP-1 | This study |
| BAX-9/pHY-Ppqq/BSP-1 | BAX-9 harboring the plasmid pHY-Ppqq/BSP-1 | This study |
| BAX-9/pHY-Pscp/BSP-1 | BAX-9 harboring the plasmid pHY-Pscp/BSP-1 | This study |
| BAX-9/pHY-Pcsp/BSP-1 | BAX-9 harboring the plasmid pHY-Pcsp/BSP-1 | This study |
| BAX-9/pHY-P43/BSP-1 | BAX-9 harboring the plasmid pHY-P43/BSP-1 | This study |
| BAX-9/pHY-PtrnQ/BSP-1 | BAX-9 harboring the plasmid pHY-PtrnQ/BSP-1 | This study |
| BAX-9/pHY-Psrf/BSP-1 | BAX-9 harboring the plasmid pHY-Psrf/BSP-1 | This study |
| BAX-9/pHY-Pitu/BSP-1 | BAX-9 harboring the plasmid pHY-Pitu/BSP-1 | This study |
| BAX-9/pHY-Pfen/BSP-1 | BAX-9 harboring the plasmid pHY-Pfen/BSP-1 | This study |
| BAX-9/pHY-Pbac/BSP-1 | BAX-9 harboring the plasmid pHY-Pbac/BSP-1 | This study |
|
| the strain containing P43 promoter | Stored inlab |
|
| CCTCC M208065, wild type | Stored inlab |
|
|
|
|
| pHY300PLK |
| Stored in lab |
| pHY-PX/BSP-1 | pHY300PLK + | This study |
| pHY-Psra/BSP-1 | pHY300PLK + Psra + | This study |
| pHY-Psrs/BSP-1 | pHY300PLK + Psrs + | This study |
| pHY-PrnpB/BSP-1 | pHY300PLK + PrnpB + | This study |
| pHY-Pffs/BSP-1 | pHY300PLK + Pffs + | This study |
| pHY-Phyp/BSP-1 | pHY300PLK + Phyp + | This study |
| pHY-Ppqq/BSP-1 | pHY300PLK + Ppqq + | This study |
| pHY-Pscp/BSP-1 | pHY300PLK + Pscp + | This study |
| pHY-Pcsp/BSP-1 | pHY300PLK + Pcsp + | This study |
| pHY-P43/BSP-1 | pHY300PLK + P43+ | This study |
| pHY-PtrnQ/BSP-1 | pHY300PLK + PtrnQ + | This study |
| pHY-Psrf/BSP-1 | pHY300PLK + Psrf + | This study |
| pHY-Pitu/BSP-1 | pHY300PLK + Pitu + | This study |
| pHY-Pfen/BSP-1 | pHY300PLK + Pfen + | This study |
| pHY-Pbac/BSP-1 | pHY300PLK + Pbac + | This study |
Primers used in this study.
| Primer name | Sequence of primer (5' to 3') |
|---|---|
|
| CG |
|
| TTATTGTGCAGCTGCTTGTACG |
|
| ACAGCTTCATTGCGAATGAGAAGCAAAAAATTGTGGAT |
|
| AAGAGCAGAGAGGACTTATTGTGCAGCTGCTTGTACG |
| TamyL-F | GCAGCTGCACAATAAAAGAGCAGAGAGGACGGATT |
| TamyL-R | GC |
| Psra-F | CG |
| Psra-R | CG |
| Psrs-F | CG |
| Psrs-R | CG |
| PrnpB-F | CG |
| PrnpB-R | CG |
| Pffs-F | CG |
| Pffs-R | CG |
| Phyp-F | CG |
| Phyp-R | CG |
| Ppqq-F | CG |
| Ppqq-R | TTTTTTGCTTCTCATTCGCAATGAAGCTGTCTTT |
| P43-F | CG |
| P43-R | CG |
| PtrnQ-F | CG |
| PtrnQ-R | CG |
| Pscp-F | CG |
| Pscp-R | CG |
| Pcsp-F | CG |
| Pcsp-R | CG |
| Psrf-F | CG |
| Psrf-R | CG |
| Pitu-F | CG |
| Pitu-R | CG |
| Pfen-F | CG |
| Pfen-R | CG |
| Pbac-F | CG |
| Pbac-R | CG |
| pHY300-YF | GTTTATTATCCATACCCTTAC |
| pHY300-YR | CAGATTTCGTGATGCTTGTC |
Note: Restriction sites highlight in bold.
FIGURE 1Sequence analysis of bsp-1 gene and deduced amino acids. (A) Nucleotide (upper line) and deduced amino acid (lower line) sequences of the protease BSP-1. The predicted signal peptide, propeptide and mature peptide are marked with arrows. (B) Amino acid sequence alignment of the protease BSP-1, with subtilisin (DJ-4, DFE) from B. amyloliquefaciens and subtilisin (NAT, BSF1) from B. subtilis. The signal peptide, pro-peptide, and mature peptide (mature) were indicated with arrows. “.” indicated the same residue as the first sequence. The catalytic center residues (Asp-32, His-64, and Ser-221) were boxed. The initial amino acid of the mature peptide was numbered as + 1.
FIGURE 2Heterologous expression of protease gene bsp-1 in B amyloliquefaciens BAX-9. (A) PCR analysis of recombinant strain colonies. M: Marker; 1-2: P BAX-9/pHY-300 and BAX-9/pHY-Ppqq/BSP-1. (B) SDS-PAGE of analysis of BAX-9/pHY-Ppqq/BSP-1. M: Marker; 1-2: BAX-9/pHY-300 and BAX-9/pHY-Ppqq/BSP-1.
FIGURE 3Illustration of pHY300-PX/BSP-1, where the promoter sequence can be easily replaced.
FIGURE 4Skim milk agar plates of the fermentation supernatant of different strains. CK: BAX-9/pHY-300, Psra: BAX-9/pHY-Psra/BSP-1, Psrs: BAX-9/pHY-Psrs/BSP-1, Prnp: BAX-9/pHY-Prnp/BSP-1, Pffs: BAX-9/pHY-Pffs/BSP-1, Pcsp: BAX-9/pHY-Pcsp/BSP-1, Ppqq: BAX-9/pHY-Pscp/BSP-1, Pscp: BAX-9/pHY-Pscp/BSP-1, Phyp: BAX-9/pHY-Phyp/BSP-1, Psrf: BAX-9/pHY-Psrf/BSP-1, Pitu: BAX-9/pHY-Pitu/BSP-1, Pfen: BAX-9/pHY-Pfen/BSP-1, Pbac: BAX-9/pHY-Pbac/BSP-1, P43: BAX-9/pHY-P43/BSP-1, PtrnQ: BAX-9/pHY-PtrnQ/BSP-1.
FIGURE 5SDS-PAGE analysis of the fermentation supernatant of different strains. M: Marker; 1-8: BAX-9/pHY-300, BAX-9/pHY-P43/BSP-1, BAX-9/pHY-Pscp/BSP-1, BAX-9/pHY-Pcsp/BSP-1, BAX-9/pHY-Ppqq/BSP-1, BAX-9/pHY-Psrf/BSP-1, BAX-9/pHY-Pitu/BSP-1, BAX-9/pHY-Pfen/BSP-1.
FIGURE 6Determination of enzyme activity and biomass of recombinant strains. Asterisks show the significant difference (p < 0.05) compared with the control.
FIGURE 7RT-PCR results of recombinant strains. Asterisks show the significant difference (p < 0.05) compared with the control.
FIGURE 8Enzyme activity and culture growth of BAX-9/pHY-P43/BSP-1 under fermentation using the optimized fermentation medium.