| Literature DB >> 36105308 |
Xue Lin1, Zi-Hao Bo2, Wenqi Lv1, Zhanping Zhou2, Qin Huang1, Wenli Du1, Xiaohui Shan1, Rongxin Fu1, Xiangyu Jin1, Han Yang1, Ya Su1, Kai Jiang1, Yuchen Guo3, Hongwu Wang4,5, Feng Xu2, Guoliang Huang1,6.
Abstract
Identifying new biomarkers is necessary and important to diagnose and treat malignant lung cancer. However, existing protein marker detection methods usually require complex operation steps, leading to a lag time for diagnosis. Herein, we developed a rapid, minimally invasive, and convenient nucleic acid biomarker recognition method, which enabled the combined specific detection of 11 lung cancer typing markers in a microliter reaction system after only one sampling. The primers for the combined specific detection of 11 lung cancer typing markers were designed and screened, and the microfluidic chip for parallel detection of the multiple markers was designed and developed. Furthermore, a miniaturized microfluidic-based analyzer was also constructed. By developing a microfluidic chip and a miniaturized nucleic acid analyzer, we enabled the detection of the mRNA expression levels of multiple biomarkers in rice-sized tissue samples. The miniaturized nucleic acid analyzer could detect ≥10 copies of nucleic acids. The cell volume of the typing reaction on the microfluidic chip was only 0.94 μL, less than 1/25 of that of the conventional 25-μL Eppendorf tube PCR method, which significantly reduced the testing cost and significantly simplified the analysis of multiple biomarkers in parallel. With a simple injection operation and reverse transcription loop-mediated isothermal amplification (RT-LAMP), real-time detection of 11 lung cancer nucleic acid biomarkers was performed within 45 min. Given these compelling features, 86 clinical samples were tested using the miniaturized nucleic acid analyzer and classified according to the cutoff values of the 11 biomarkers. Furthermore, multi-biomarker analysis was conducted by a machine learning model to classify different subtypes of lung cancer, with an average area under the curve (AUC) of 0.934. This method shows great potential for the identification of new nucleic acid biomarkers and the accurate diagnosis of lung cancer.Entities:
Keywords: AI diagnosis; loop-mediated isothermal amplification; lung cancer; microfluidic chip; nucleic acid biomarker
Year: 2022 PMID: 36105308 PMCID: PMC9466282 DOI: 10.3389/fchem.2022.946157
Source DB: PubMed Journal: Front Chem ISSN: 2296-2646 Impact factor: 5.545
Clinical features of subjects.
| Variable | Number of subjects | Percentage (%) |
|---|---|---|
| Subjects with clinical features | 86 | 100 |
| Age (median 60, range 14–88) | ||
| ≤60 | 42 | 48.8 |
| >60 | 44 | 51.2 |
| Gender | ||
| Male | 58 | 67.4 |
| Female | 28 | 32.6 |
| Histology | ||
| Benign | 20 | 23.3 |
| Adenocarcinoma | 15 | 17.4 |
| Squamous carcinoma | 28 | 32.6 |
| SCLC | 6 | 7.0 |
| Pulmonary metastasis | 17 | 19.7 |
FIGURE 1Sample acquisition and mRNA expression detection of multiple lung cancer typing biomarkers via a microfluidic chip and miniaturized fluorescence analyzer.
ProGRP LAMP primer sequences.
| Primer name | Sequence (5′-3′) |
|---|---|
| ProGRP-F3 | GCTGACCAAGATGTACCCG |
| ProGRP-B3 | ACGAAGGCTGCTGATTGC |
| ProGRP-FIP | CTCAGCTGCTGCTTCAGGCTC-TGGGGCACTTAATGGGGA |
| ProGRP-BIP | ACATCAGGTGGGAAGAAGCTGC-GGCTGGTGGTTTCTGTTCT |
| ProGRP-LF | GAAACAGAAGAAGACTCCCCTG |
| ProGRP-LB | GCTGGGTCTCATAGAAGCAAAG |
FIGURE 2Working principle of the miniaturized microfluidic chip system. (A) Structure and liquid distribution of the microfluidic chip. (B) Reaction principles of LAMP in a bioreactor cell. (C) Schematic of the miniaturized real-time fluorescence detector. DSP: Digital signal processor; PMT: Photo-multiplier; LED: Light-emitting diode; PID: Proportional integral derivative; and MC: Moving controller.
FIGURE 3Multi-biomarker typing analysis based on machine learning. (A) Feature selection. (B) Feature transformation. (C) SVM classifier and prediction.
FIGURE 4Limit of detection (LOD), linearity, and specificity analysis of ProGRP. (A) LOD analysis of ProGRP. (B) Linearity analysis of ProGRP. (C) Specificity analysis of ProGRP.
FIGURE 5Analysis of the minimally invasive and rapid diagnostic method based on single biomarkers. (A–D) CYFRA21-1, EGFR, CD56, and IDH1 mRNA levels in different histology types. (E) Single-biomarker statistical classification analysis of the 11 biomarkers.
FIGURE 6Analysis of the minimally invasive and rapid diagnostic method based on multiple biomarkers. (A–E) Mean receiver operating characteristic (ROC) curve with the 95% confidence interval (CI) and the optimal point for five binary multi-biomarker classification tasks based on machine learning. (F) Specific mean sensitivity, specificity, and AUC score for the five tasks, in which ± indicates the 95% CI. Note that the values in F are averages of all values with different optimal points of every cross-validation experiment and differ from the mean ROC curves in (A–E) that are averaged based on all curves. (G) Selected (green) and rejected (red) biomarkers generated by the feature selection module via recursive elimination. The selected biomarker features were fed into the feature transformation and the classifier modules to build the final prediction.